ID: 1049749491

View in Genome Browser
Species Human (GRCh38)
Location 8:144276555-144276577
Sequence CCTGGGCTGACACGGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049749481_1049749491 -5 Left 1049749481 8:144276537-144276559 CCTCCCGGGGCCTCTGTCCCTGG 0: 1
1: 0
2: 5
3: 75
4: 579
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749475_1049749491 24 Left 1049749475 8:144276508-144276530 CCCTGTCCTCTGTGAGGGCTGGA 0: 1
1: 1
2: 3
3: 47
4: 382
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749476_1049749491 23 Left 1049749476 8:144276509-144276531 CCTGTCCTCTGTGAGGGCTGGAC 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749485_1049749491 -9 Left 1049749485 8:144276541-144276563 CCGGGGCCTCTGTCCCTGGGCTG 0: 1
1: 0
2: 5
3: 82
4: 852
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749484_1049749491 -8 Left 1049749484 8:144276540-144276562 CCCGGGGCCTCTGTCCCTGGGCT 0: 1
1: 0
2: 8
3: 58
4: 600
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749471_1049749491 30 Left 1049749471 8:144276502-144276524 CCACGGCCCTGTCCTCTGTGAGG 0: 1
1: 0
2: 3
3: 39
4: 342
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data
1049749477_1049749491 18 Left 1049749477 8:144276514-144276536 CCTCTGTGAGGGCTGGACTGCAG 0: 1
1: 0
2: 1
3: 19
4: 275
Right 1049749491 8:144276555-144276577 CCTGGGCTGACACGGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049749491 Original CRISPR CCTGGGCTGACACGGGTGTC AGG Intronic
No off target data available for this crispr