ID: 1049749602

View in Genome Browser
Species Human (GRCh38)
Location 8:144276949-144276971
Sequence ATCCCGCCGGGTCACAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049749592_1049749602 3 Left 1049749592 8:144276923-144276945 CCACGTCCACAGCCCAGGCTGAC 0: 1
1: 0
2: 5
3: 28
4: 258
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data
1049749588_1049749602 10 Left 1049749588 8:144276916-144276938 CCACCCACCACGTCCACAGCCCA 0: 1
1: 3
2: 4
3: 67
4: 527
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data
1049749591_1049749602 6 Left 1049749591 8:144276920-144276942 CCACCACGTCCACAGCCCAGGCT 0: 1
1: 0
2: 6
3: 42
4: 563
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data
1049749590_1049749602 7 Left 1049749590 8:144276919-144276941 CCCACCACGTCCACAGCCCAGGC 0: 1
1: 0
2: 0
3: 40
4: 244
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data
1049749587_1049749602 11 Left 1049749587 8:144276915-144276937 CCCACCCACCACGTCCACAGCCC 0: 1
1: 0
2: 1
3: 32
4: 425
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data
1049749595_1049749602 -10 Left 1049749595 8:144276936-144276958 CCAGGCTGACCCCATCCCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data
1049749584_1049749602 26 Left 1049749584 8:144276900-144276922 CCTGCCCAGCGTTCTCCCACCCA 0: 1
1: 0
2: 0
3: 34
4: 341
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data
1049749586_1049749602 21 Left 1049749586 8:144276905-144276927 CCAGCGTTCTCCCACCCACCACG 0: 1
1: 0
2: 1
3: 14
4: 174
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data
1049749594_1049749602 -9 Left 1049749594 8:144276935-144276957 CCCAGGCTGACCCCATCCCGCCG 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data
1049749593_1049749602 -3 Left 1049749593 8:144276929-144276951 CCACAGCCCAGGCTGACCCCATC 0: 1
1: 0
2: 8
3: 61
4: 606
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data
1049749585_1049749602 22 Left 1049749585 8:144276904-144276926 CCCAGCGTTCTCCCACCCACCAC 0: 1
1: 0
2: 0
3: 42
4: 232
Right 1049749602 8:144276949-144276971 ATCCCGCCGGGTCACAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049749602 Original CRISPR ATCCCGCCGGGTCACAGAGT GGG Intronic
No off target data available for this crispr