ID: 1049749746

View in Genome Browser
Species Human (GRCh38)
Location 8:144277499-144277521
Sequence CTTCAGCCCCGGCCACTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 2, 1: 0, 2: 3, 3: 17, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049749746_1049749755 27 Left 1049749746 8:144277499-144277521 CCTCACAGTGGCCGGGGCTGAAG 0: 2
1: 0
2: 3
3: 17
4: 176
Right 1049749755 8:144277549-144277571 TGCTCATGGGCCGCAGTCCCAGG No data
1049749746_1049749750 13 Left 1049749746 8:144277499-144277521 CCTCACAGTGGCCGGGGCTGAAG 0: 2
1: 0
2: 3
3: 17
4: 176
Right 1049749750 8:144277535-144277557 AGTCCCAGCCTCGCTGCTCATGG No data
1049749746_1049749748 -10 Left 1049749746 8:144277499-144277521 CCTCACAGTGGCCGGGGCTGAAG 0: 2
1: 0
2: 3
3: 17
4: 176
Right 1049749748 8:144277512-144277534 GGGGCTGAAGCACCGCACGCTGG No data
1049749746_1049749751 14 Left 1049749746 8:144277499-144277521 CCTCACAGTGGCCGGGGCTGAAG 0: 2
1: 0
2: 3
3: 17
4: 176
Right 1049749751 8:144277536-144277558 GTCCCAGCCTCGCTGCTCATGGG No data
1049749746_1049749756 28 Left 1049749746 8:144277499-144277521 CCTCACAGTGGCCGGGGCTGAAG 0: 2
1: 0
2: 3
3: 17
4: 176
Right 1049749756 8:144277550-144277572 GCTCATGGGCCGCAGTCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049749746 Original CRISPR CTTCAGCCCCGGCCACTGTG AGG (reversed) Intronic
900218755 1:1495923-1495945 CCCCTGCCCAGGCCACTGTGAGG + Exonic
900226112 1:1534364-1534386 CCCCTGCCCAGGCCACTGTGAGG + Exonic
900572097 1:3363667-3363689 CCTGCCCCCCGGCCACTGTGGGG - Intronic
902421920 1:16287665-16287687 CTTGAGGCCAGGCCACTCTGAGG - Intronic
902580209 1:17403259-17403281 CTTCAGCCTCGGGCCCAGTGTGG - Intergenic
902688642 1:18095704-18095726 CTTCAGCCAGCGTCACTGTGGGG + Intergenic
903186475 1:21632124-21632146 CTTCAGCCCCTGTGTCTGTGTGG + Intronic
908301093 1:62761622-62761644 CGTCAGCCCCGGGCAGTGAGGGG + Intergenic
909340319 1:74524367-74524389 CTTCTGCACCTGACACTGTGCGG + Intronic
909349801 1:74637877-74637899 CTTCAGCCTGGGCCACAGAGTGG + Intronic
909487446 1:76189420-76189442 GTTCAGCCCAGACCAATGTGGGG - Intronic
913246079 1:116871228-116871250 GTTCAGCTCCGCCCACTGTCTGG + Intergenic
915379976 1:155431636-155431658 CTGCAGTCCCAGCCACTGTGGGG + Intronic
918056117 1:181023151-181023173 CGTAAGCCCCGCCCACTGGGGGG - Intergenic
918950052 1:191125688-191125710 CTTCAGCCTCGGCTTCTGTATGG - Intergenic
919430586 1:197486868-197486890 GGTCTGCCACGGCCACTGTGGGG - Intergenic
919929085 1:202209395-202209417 CTGCAGCCCAGAACACTGTGGGG - Intronic
920508342 1:206532771-206532793 CTCCAGCCCAGGCCAAGGTGTGG - Intronic
923182387 1:231532219-231532241 CTTCAGCCTGGGCCAGGGTGAGG - Intronic
923338239 1:232987769-232987791 CTTCAGCCTAGGCCACGGTGGGG - Intronic
1067369225 10:45667498-45667520 CTTCAGCCCGGGCAACAGAGTGG - Intronic
1069919833 10:71809863-71809885 CTACAGCCCCGGCTACTTCGTGG + Exonic
1070190938 10:74111705-74111727 ACTCAGCCCAAGCCACTGTGTGG - Intronic
1070812616 10:79305959-79305981 CTTCCGCCTCGTCCACAGTGTGG + Intronic
1075354862 10:121762486-121762508 CTCCTGCCAGGGCCACTGTGTGG + Intronic
1075643333 10:124081017-124081039 CTCCAGCCTGGGCCACTGTGGGG + Intronic
1076167880 10:128296933-128296955 CTTCAGAACCGGCCTCTGTCAGG - Intergenic
1076179893 10:128399018-128399040 CATCAGCCCAGACCCCTGTGTGG - Intergenic
1076485150 10:130811060-130811082 ATTCATACCCGTCCACTGTGGGG + Intergenic
1077017553 11:403610-403632 CAGCACCCCCGCCCACTGTGGGG - Exonic
1077229788 11:1453627-1453649 CTGCCTCCTCGGCCACTGTGCGG - Intronic
1077373122 11:2192859-2192881 CTACAGCCCTGCCCACTGAGGGG + Intergenic
1080535183 11:33214601-33214623 CTCCAGCCCAGGCCACTGGGAGG - Intergenic
1080720851 11:34847420-34847442 CTTCAGCTCTGTCCACTGTCTGG - Intergenic
1081959823 11:47127508-47127530 CTTCAGCTCCAGCCAGTGGGTGG - Intronic
1084692848 11:70737040-70737062 CTTCACCCGCGGCCAAAGTGGGG + Intronic
1092165801 12:6341616-6341638 CCTCAGCCACTGCCAGTGTGGGG - Intronic
1095491900 12:42743707-42743729 TGTCAGCCCCACCCACTGTGAGG - Intergenic
1096411448 12:51379650-51379672 CTTCAGCCACGGCTTCTCTGTGG + Exonic
1097333344 12:58355879-58355901 CTCCAGCCTGGGCCACAGTGTGG - Intergenic
1101782769 12:107850131-107850153 CTTCAGCCCCAGCCACTTCCAGG - Intergenic
1102058392 12:109913946-109913968 CTCCAGCCCAGGCCACAGTCAGG - Intronic
1103012043 12:117465256-117465278 CCTGAGCCCCAGCCACTCTGGGG - Exonic
1103321724 12:120096149-120096171 CTGCAGCCTCGGGCACTGTGGGG - Exonic
1104426833 12:128684889-128684911 CTTCAGCTCTGGCCACTGCAAGG + Intronic
1104978472 12:132562417-132562439 CATCCGACCCGGCCCCTGTGTGG + Intronic
1108668413 13:52655309-52655331 CTCCAGCCCAGGCGACAGTGAGG + Intronic
1113038207 13:106074530-106074552 CTTGTGCCCCAGCCACTGCGTGG - Intergenic
1113746915 13:112751626-112751648 CTTCAGCCTGGGCGACAGTGAGG + Intronic
1113955373 13:114097708-114097730 CTGCATCCCGGGCAACTGTGTGG - Intronic
1115312975 14:31997585-31997607 CTTCAGCCCCTGCCTCTGTGAGG + Intergenic
1118393614 14:65317132-65317154 CTCCATCCCCAGCCACTGTCAGG - Intergenic
1119646330 14:76351104-76351126 CCCCAACCCTGGCCACTGTGGGG + Intronic
1122208281 14:100159313-100159335 TTTCAGACCCGGCCAGGGTGGGG + Intronic
1124410439 15:29432445-29432467 CTTCAGGCCAAGCCACTGGGAGG - Intronic
1124881463 15:33646482-33646504 CTTCAGCCACAGCCCCTGTCTGG + Exonic
1125033511 15:35096816-35096838 CTTAATCCCAGGCCAATGTGGGG - Intergenic
1125252436 15:37720833-37720855 CTTCAGCCTCTGCCTCTCTGGGG + Intergenic
1126499727 15:49332180-49332202 CTTCAGTTCCACCCACTGTGTGG + Intronic
1128369905 15:67033193-67033215 CTTCAAGCCCAACCACTGTGCGG + Intergenic
1129351640 15:74958846-74958868 CTCCAGCCCCCACCGCTGTGTGG - Intronic
1132615567 16:839751-839773 TTGCAGCCCCGGCCACTCGGTGG - Intergenic
1132781138 16:1626284-1626306 CATCAGCCTCCGCCACTGCGGGG - Intronic
1132945337 16:2529036-2529058 CTCCAGCCCCAGCAACTGGGCGG - Exonic
1132976681 16:2714536-2714558 CTCCACCCCTGGCCGCTGTGTGG + Intronic
1134438780 16:14285368-14285390 CTTCAGCCCGGGCCAAAGCGCGG + Intergenic
1136426498 16:30171186-30171208 CTGCAGTCCCAGCCACTCTGGGG - Intergenic
1136673459 16:31878182-31878204 CTCCAGCCCAGGCCTCTGTGAGG - Intronic
1137350384 16:47708596-47708618 CTTCAGCCCAGCCTCCTGTGAGG + Intergenic
1137714902 16:50592666-50592688 CTGGAGCCCCGGGCTCTGTGCGG - Intronic
1139962244 16:70724688-70724710 CTTCAGCCCTGGCCCCTGGGCGG + Intronic
1142025152 16:87808677-87808699 CTTCAGCCCCCGCCACTTCCAGG + Intergenic
1143658811 17:8312470-8312492 CCTCAGCTCCTGGCACTGTGCGG + Exonic
1144179243 17:12736491-12736513 ATTCAGCGCAGGCCTCTGTGTGG + Intronic
1145942454 17:28749743-28749765 CTTCAGCCCTGGCCCCTGTGGGG + Exonic
1147889780 17:43709239-43709261 ATTCAGCCCCAGCCACAGTGAGG + Intergenic
1148055279 17:44790864-44790886 CTTCAGCCTCGGCAACAGAGTGG - Intergenic
1148152444 17:45404667-45404689 CTCCAGCCTCACCCACTGTGGGG + Exonic
1148568299 17:48646716-48646738 CTTCTGCCCCCGCCTCTGTGAGG + Intergenic
1148591955 17:48823095-48823117 CTCCAGCCCTGGCGACAGTGAGG - Intergenic
1149990934 17:61383206-61383228 CTACAGCCCAGGACACGGTGAGG - Intronic
1150464760 17:65383011-65383033 CTTCAGGCCTGGCCACTGGAAGG + Intergenic
1150640915 17:66948825-66948847 CTTCAGAGCCAGCCACGGTGGGG + Intergenic
1151651850 17:75475159-75475181 CTTCCACGCCAGCCACTGTGAGG - Intronic
1152784694 17:82241639-82241661 CCTCACCCACGGCCACAGTGAGG + Intronic
1153700557 18:7688915-7688937 CCTCAGCCCTGGTGACTGTGAGG + Intronic
1155158440 18:23177185-23177207 CTTCCTCCCCAGTCACTGTGAGG - Intronic
1156513200 18:37658993-37659015 CTACAGCACCTGCCACTGTCTGG + Intergenic
1157974630 18:52313156-52313178 CATCAGGCCCAGCCACTGTTTGG + Intergenic
1160455387 18:78995479-78995501 CTCCAGCCCCGGCTGCGGTGCGG + Intronic
1160843861 19:1158170-1158192 GTTCAGAACTGGCCACTGTGCGG + Intronic
1163321211 19:16576138-16576160 GTTCACCCCCGGCCACTGGCTGG + Exonic
1163593130 19:18205224-18205246 CTCCAGCCCCGCCTACTGGGAGG - Intergenic
1163690472 19:18735799-18735821 CTTCAGCCTGAGCCACTGTGCGG - Intronic
1163806888 19:19405239-19405261 CTTCGGCCCCGGTGTCTGTGGGG - Intronic
1166382138 19:42360769-42360791 CCTCAGGCTCGGCCTCTGTGGGG + Exonic
1166648242 19:44548952-44548974 CTCCAGCACCTACCACTGTGAGG - Intergenic
1168364852 19:55777551-55777573 GTTCAGCCATGGCCACTGTCTGG - Intergenic
1168607267 19:57769964-57769986 CTGCAGCCCAGGCCTCTGTCAGG + Intronic
1168709863 19:58493033-58493055 CTGCAGCCCCAGCTACTGGGGGG + Intronic
925893859 2:8456865-8456887 CTGCAGCCTCGTCCACTGTGAGG + Intergenic
927496009 2:23552457-23552479 CTGCTGTCCTGGCCACTGTGGGG + Intronic
932675800 2:73779934-73779956 CTCCGGCCCCAGCCACTGCGGGG + Exonic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
934774181 2:96926883-96926905 TTTGAGCCCTGGCCATTGTGAGG + Intronic
935276633 2:101480963-101480985 CGGCAGCCACGGCCAATGTGTGG - Intergenic
939624191 2:144456736-144456758 CTTAAGCCCTGGCCACTGTACGG - Intronic
941114159 2:161452361-161452383 CTTCAGCACCACCCAATGTGAGG + Intronic
945069701 2:205977596-205977618 CTTCACCTGCGGCCCCTGTGCGG + Intergenic
948553438 2:238791429-238791451 CTTCAGCCCTGGCCTCTGCAGGG + Intergenic
948591589 2:239054020-239054042 CTCCACCCCCAGCCTCTGTGAGG - Intronic
948781518 2:240324490-240324512 CTCCAGGCCCTGCCAGTGTGGGG + Intergenic
949073404 2:242040227-242040249 CTTCAGCCAGGGCCACTATCTGG - Intergenic
1168745190 20:233344-233366 CTCCAGTCCCTGCTACTGTGGGG + Intergenic
1171388120 20:24783874-24783896 CTGCAGCCCTGGCCACTGCTGGG - Intergenic
1172008631 20:31833828-31833850 CTTCAGCCCCGGCCACTGTGTGG - Exonic
1176051605 20:63122617-63122639 GTTCAGACACGGCCACTTTGTGG + Intergenic
1176217569 20:63955628-63955650 TTGCAGCCCCGGGCACTGCGTGG + Intronic
1176387546 21:6146268-6146290 CCGCAGCCCCAGCCTCTGTGTGG - Intergenic
1179735926 21:43391980-43392002 CCGCAGCCCCAGCCTCTGTGTGG + Intergenic
1179954754 21:44732409-44732431 CTTCTGCCCCTGCAACAGTGAGG + Intergenic
1181696544 22:24595500-24595522 CATCAGCCCCGGGAACTGAGAGG - Intronic
1184754245 22:46507473-46507495 CTCCCTCCCCGGCCTCTGTGTGG + Intronic
1185288569 22:50013153-50013175 CTTCAGCCCCAGCCCCTAAGGGG + Intergenic
949851618 3:8426378-8426400 CCTCAGCCCTGGCTGCTGTGAGG + Intergenic
952351598 3:32544032-32544054 CTTCAGCCTGGGCAACAGTGTGG + Intronic
954412755 3:50378173-50378195 ATTGTGCCCCAGCCACTGTGAGG + Intronic
956046410 3:65200584-65200606 CTTCACCCCCTGGCACTTTGGGG + Intergenic
956724499 3:72145935-72145957 CCTCAGCCCTGCCCACTGGGTGG - Intergenic
960968804 3:123124487-123124509 CTTGAGTCTAGGCCACTGTGGGG + Intronic
962936004 3:140081552-140081574 CTGCAGCCCCAGGCACTGGGAGG + Intronic
967493704 3:190120661-190120683 CTACTGCCGCCGCCACTGTGGGG - Exonic
967556304 3:190862952-190862974 CTTCACACCCGGCCCCAGTGTGG + Intronic
968503168 4:960514-960536 CCACAGGGCCGGCCACTGTGTGG + Exonic
969229812 4:5822058-5822080 CTTCAGCCCTGACCACCTTGTGG + Intronic
973774841 4:54233317-54233339 GTCCAGCCCCCGCCACTGTCCGG - Intronic
974101133 4:57418486-57418508 CTTCAGCCCCTAGCACAGTGTGG + Intergenic
976619666 4:87114991-87115013 CTGCTGCCGCTGCCACTGTGGGG - Exonic
983927779 4:173420178-173420200 CTTCAGGCCCGGCCCTAGTGGGG + Intergenic
984854897 4:184186762-184186784 CTTCAGCCCAGGCCACGGCGGGG - Intronic
990777949 5:59324378-59324400 CCTCAGCCCCAGCCACCATGAGG + Intronic
999693503 5:154168650-154168672 CTTCAGCCATGGTCACTGTCTGG + Intronic
1001040654 5:168332829-168332851 CTTCAGTCCCAGCCACTTGGGGG - Intronic
1001077529 5:168641690-168641712 CTCCATCCTCTGCCACTGTGTGG + Intergenic
1002482067 5:179508222-179508244 CTCCAGCCCCGGCCACAGAGCGG + Intergenic
1004161124 6:13213807-13213829 TTCCAGCCCCGACAACTGTGAGG + Intronic
1006044517 6:31283376-31283398 CTCCAGCCCAGGCCAGAGTGAGG + Intronic
1006335753 6:33419833-33419855 CTTCACCACCCCCCACTGTGGGG - Intergenic
1006873249 6:37272508-37272530 CTGTAGTCCCAGCCACTGTGGGG - Intronic
1007622985 6:43226129-43226151 CTTCTGCCACGACCACTGGGAGG + Exonic
1007854076 6:44835887-44835909 ATTCAGCCCTGGTCTCTGTGAGG + Intronic
1012696312 6:102389351-102389373 CTTCTGCCTCTGCCACTCTGGGG - Intergenic
1015032438 6:128611612-128611634 CTTCAGCACCGGAAACTGTCAGG + Intergenic
1017825064 6:158075728-158075750 CTTGAGCCCCTTCCAGTGTGTGG + Intronic
1018398389 6:163399098-163399120 CTTCAGGCCCGTCCACTGCACGG - Intergenic
1018849347 6:167576135-167576157 GCTCAGCCCCAGCCACTGGGAGG - Intergenic
1019319376 7:408707-408729 CTGCAGCACCGGCAGCTGTGGGG + Intergenic
1019422647 7:958217-958239 AATTAGCCCCGGCCCCTGTGCGG - Intronic
1019537991 7:1538799-1538821 CTGCAGCCGCCGGCACTGTGGGG - Intronic
1019592735 7:1843905-1843927 CTTCAGCCACGGCCACTCCATGG + Intronic
1023837546 7:44077197-44077219 CTACAGCTTCTGCCACTGTGTGG - Intronic
1024057361 7:45670519-45670541 CATCAGCCCCGACCACAGGGAGG + Intronic
1026960838 7:74406075-74406097 CTTCAGCTCCAGCCCCTCTGAGG - Intergenic
1029203647 7:98855484-98855506 CTTCAGCACCTGCCACTGACAGG - Intronic
1029218712 7:98970781-98970803 CTAGAGCCCCAGCCCCTGTGTGG - Intronic
1029380940 7:100214116-100214138 CTTCAGCCCTGGGCTCTGAGGGG + Exonic
1029400314 7:100341054-100341076 CTTCAGCCCTGGGCTCTGAGGGG + Intronic
1029751439 7:102544739-102544761 CTTCATCCCCAGCCTCTGTCAGG + Intronic
1029769391 7:102643832-102643854 CTTCATCCCCAGCCTCTGTCAGG + Intronic
1032192467 7:129772739-129772761 CTTCAGGCCCGGCTGCTCTGGGG - Intergenic
1033925389 7:146452970-146452992 CAACAGCCCCAGCTACTGTGTGG + Intronic
1035076169 7:156179049-156179071 CTGCTGCCCCGGCCTCTCTGCGG - Intergenic
1035571179 8:673679-673701 CTTCCTCCCCGGCCAGTGTCGGG + Exonic
1039953661 8:42191180-42191202 CATCAGCTGCGGCCACTGGGCGG - Intronic
1040063127 8:43121661-43121683 CTTCCTCCCCACCCACTGTGTGG + Intronic
1041252764 8:55950507-55950529 CTTCATCCCCAGCAACTATGTGG + Exonic
1041257978 8:55995710-55995732 CTACACCCCCTGCCTCTGTGTGG - Intronic
1043928633 8:86065845-86065867 CTGTAGCCCCGGCTACTGAGGGG + Intronic
1048047904 8:130790722-130790744 CCTCAGCTCAGGCCACTGTTGGG + Intronic
1048193958 8:132316497-132316519 CTTCAACACTGGCCACTGTGTGG + Intronic
1049230271 8:141478213-141478235 CTCCAGCCCAGGTCACTGTGAGG - Intergenic
1049530789 8:143153819-143153841 CTTCACCCGGGGCCACTCTGAGG + Intergenic
1049749746 8:144277499-144277521 CTTCAGCCCCGGCCACTGTGAGG - Intronic
1049841672 8:144777315-144777337 CTTCAGCAAAGGCCACTGTCAGG + Intronic
1053062322 9:35042166-35042188 GTTAAGCCCAGGCCTCTGTGGGG + Intronic
1056946236 9:90999731-90999753 CTTCAGTCCATGCCACTGTGTGG + Intergenic
1056998814 9:91488610-91488632 CTTCTGCCCCGGCTAGTGAGGGG - Intergenic
1057230741 9:93319945-93319967 CTCCTGCCCGGTCCACTGTGGGG + Intronic
1059738191 9:117123139-117123161 TCTCAGCCCCTGCCACTGTAGGG - Intronic
1060072496 9:120562551-120562573 CTTCAGCCACTTCCACTGAGCGG + Intronic
1062250824 9:135592695-135592717 CTGGAGCCTCGGCCCCTGTGCGG + Intergenic
1062623392 9:137432705-137432727 CCTGGGCCCCGGCCTCTGTGTGG - Intronic
1186024547 X:5295026-5295048 CTGCAGCCCCAGCTACTTTGGGG + Intergenic
1186206628 X:7207156-7207178 CTTCAGCCTGGGCAACTGAGTGG + Intergenic
1186967088 X:14799332-14799354 CTTCAACCCTGGCCAGTGTCTGG - Intergenic
1197783355 X:130177870-130177892 CTTCACCCCCATCCACTGTATGG + Intronic
1199893891 X:152114569-152114591 CTGCAGCCAGGGCCACTGCGAGG - Intergenic
1200054370 X:153451085-153451107 CTTGAGCCCCGGCCACTTTGGGG - Intronic