ID: 1049750101

View in Genome Browser
Species Human (GRCh38)
Location 8:144279061-144279083
Sequence GTCATGGCCCGTGGTGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049750101_1049750110 2 Left 1049750101 8:144279061-144279083 CCAAGACCACCACGGGCCATGAC 0: 1
1: 1
2: 1
3: 17
4: 95
Right 1049750110 8:144279086-144279108 CCAAGGGCCATGACCGTCACGGG No data
1049750101_1049750114 18 Left 1049750101 8:144279061-144279083 CCAAGACCACCACGGGCCATGAC 0: 1
1: 1
2: 1
3: 17
4: 95
Right 1049750114 8:144279102-144279124 TCACGGGCCACGACCGCCATGGG No data
1049750101_1049750113 17 Left 1049750101 8:144279061-144279083 CCAAGACCACCACGGGCCATGAC 0: 1
1: 1
2: 1
3: 17
4: 95
Right 1049750113 8:144279101-144279123 GTCACGGGCCACGACCGCCATGG No data
1049750101_1049750108 1 Left 1049750101 8:144279061-144279083 CCAAGACCACCACGGGCCATGAC 0: 1
1: 1
2: 1
3: 17
4: 95
Right 1049750108 8:144279085-144279107 ACCAAGGGCCATGACCGTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049750101 Original CRISPR GTCATGGCCCGTGGTGGTCT TGG (reversed) Intronic
900528442 1:3140761-3140783 CTCATGGGCTGTGGGGGTCTGGG - Intronic
904029654 1:27526191-27526213 GTCAGGGCCCGTGGTCCTCTGGG + Intergenic
904281070 1:29418550-29418572 GTCCTGGGCCTTGGTGGCCTTGG - Intergenic
915048640 1:153042686-153042708 GTCCTGGCCAGTGGTGATCTTGG - Intergenic
920382899 1:205545971-205545993 CACATGGCACGTGGAGGTCTGGG + Intergenic
924620080 1:245652884-245652906 GTAATGGCACATGATGGTCTCGG + Intronic
1062897696 10:1116760-1116782 GTCATGTTCAGGGGTGGTCTTGG + Intronic
1066212294 10:33252006-33252028 GTGGTGGGCCATGGTGGTCTTGG - Intronic
1068134630 10:52939856-52939878 GTGGTGGGCCATGGTGGTCTTGG - Intergenic
1077142544 11:1030875-1030897 GTGGGGGCCCTTGGTGGTCTCGG + Intronic
1082986168 11:59172604-59172626 GGCCTCGGCCGTGGTGGTCTGGG + Exonic
1083997187 11:66278345-66278367 GGCATGGCCCGTGGGGCTCGGGG - Exonic
1084573947 11:69976817-69976839 GTCATGGCCCGGGCCGGTCAGGG - Intergenic
1091009480 11:131985592-131985614 GTCAAGACTCGTGGTGATCTTGG - Intronic
1103743303 12:123105900-123105922 GTCTTGGTCAGTGGTGGTCTGGG - Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1106577692 13:30991184-30991206 GTCATGGTCAGTGATTGTCTGGG + Intergenic
1113530752 13:111023918-111023940 GTGATGGCCAGGGGTAGTCTAGG + Intergenic
1122739940 14:103866416-103866438 GTCATGGCCCGTCATCGTCAGGG - Intergenic
1122896340 14:104759314-104759336 GTCATGTCCTGAGGTGTTCTGGG + Intronic
1123065283 14:105616041-105616063 GTCCCTGCCCGTGGTGGTCCGGG + Intergenic
1123069482 14:105635477-105635499 GTCCCTGCCCGTGGTGGTCCGGG + Intergenic
1123088579 14:105731262-105731284 GTCCCTGCCCGTGGTGGTCCGGG + Intergenic
1123094530 14:105760635-105760657 GTCCCTGCCCGTGGTGGTCCGGG + Intergenic
1125995814 15:44159872-44159894 GTCATAGCCCCTGATTGTCTGGG - Intronic
1126187940 15:45848696-45848718 GTCATGGCCCGAGGAGGCCAAGG - Intergenic
1132327588 15:100984772-100984794 GTAATTTCCCGTGGTGGTCTTGG + Intronic
1133234657 16:4382249-4382271 GTCAGGGACCGTGGTGGCCTCGG - Exonic
1137958136 16:52853351-52853373 TTCAGGGCCCGTGATGGTCAAGG + Intergenic
1141534896 16:84672534-84672556 GTCACGGCCGCTGCTGGTCTAGG - Intergenic
1142103870 16:88291703-88291725 CTCATGGCTGCTGGTGGTCTCGG + Intergenic
1143101352 17:4506419-4506441 TCCCTGGCCCCTGGTGGTCTTGG + Intronic
1144778561 17:17796784-17796806 GCCATTGCCCTTGGTGGGCTTGG - Exonic
1145042030 17:19584048-19584070 GACATGGAGCGTGGTGTTCTGGG + Intergenic
1146662857 17:34676181-34676203 GTCAGGGCCCTTGGTGACCTGGG + Intergenic
1148124310 17:45229084-45229106 GTCCTGGCCCTTGGAGGGCTGGG + Intronic
1150620909 17:66807190-66807212 GCCAGGGCCTGTGGAGGTCTAGG + Exonic
1153893718 18:9540757-9540779 GTCATGGCTTGTGGTGGTCACGG - Intergenic
1156461329 18:37322921-37322943 GTCCTGCCACGTGGTGGCCTTGG - Intronic
1157293166 18:46424291-46424313 GGCAAGGCCCCTGGGGGTCTGGG + Intronic
1159863910 18:73682256-73682278 TTCATGGCTGGTGATGGTCTGGG + Intergenic
1160805419 19:990375-990397 CTCATGGACCGTGGTGGGGTGGG - Intronic
1161683758 19:5693237-5693259 GGCCTGTCCCGTGGTGGTGTGGG + Intronic
1164060783 19:21671733-21671755 GTCAAGGCCTGTGATGGTATAGG - Intergenic
1165306239 19:35004728-35004750 GTCATGGGCAGTGGTGCACTGGG + Intronic
1165455539 19:35908383-35908405 GGCATGGCCCCTGGGTGTCTGGG - Intergenic
925040930 2:732306-732328 GTCACGGCCCGGGGGGGTCACGG + Intergenic
925041012 2:732524-732546 GTCACGGCCCGGGGGGGTCACGG + Intergenic
925041062 2:732657-732679 GTCACGGCCCGGGGGGGTCACGG + Intergenic
925041134 2:732841-732863 GTCACGGCCCGGGGGGGTCACGG + Intergenic
925041143 2:732857-732879 GTCACGGCCCGGGGGGGTCACGG + Intergenic
925905332 2:8536602-8536624 GTGATGGCCCGTGGAGGCCCAGG + Intergenic
927267132 2:21163250-21163272 GACATGGCCCCGGGTGGTCCTGG + Intergenic
928692058 2:33810282-33810304 GTCATGGCCTCTGGGGGACTGGG - Intergenic
937867687 2:126766380-126766402 GCCATGGCCTGTGGTGCTCCTGG + Intergenic
939282197 2:140078683-140078705 GCCAAGGCCCGTGGTTGGCTTGG + Intergenic
1169344340 20:4818459-4818481 GTCATGGCCCGATGTGTGCTGGG + Intronic
1176687715 21:9865994-9866016 GTGCTGGCCAGTGGAGGTCTTGG + Intergenic
1177639953 21:23833551-23833573 GTGGTGGGCCGTGGTGGTCTTGG + Intergenic
1180255061 21:46621276-46621298 GTCATGGCAGGTTGTCGTCTGGG - Intergenic
1180790112 22:18571207-18571229 GACACGGCCCTTGGTGGTGTGGG - Intergenic
1181231627 22:21424108-21424130 GACATGGCCCTTGGTGGTGTGGG + Intronic
1181247024 22:21510760-21510782 GACATGGCCCTTGGTGGTGTGGG - Intergenic
1181876051 22:25941731-25941753 GGCCTGCCCCGTGGAGGTCTTGG + Intronic
1182095048 22:27620428-27620450 GGCATGGCCTGTGGAGATCTAGG - Intergenic
1182293483 22:29299652-29299674 CTCATGGATCGTGGTGGTCCCGG + Exonic
1183061396 22:35338457-35338479 GTCATAGCCATTGGTGGTCTTGG + Intronic
955065669 3:55531780-55531802 GTCATTGCCAGTGGTGGCCCAGG - Intronic
956601238 3:71024949-71024971 CTCATGGCCAGTGGTGTGCTGGG + Intronic
961195362 3:124996898-124996920 GTCAGGGTGCGTGGTGCTCTTGG + Intronic
962859912 3:139389817-139389839 GTCACGGCCCTTAGTGGTCTAGG - Intergenic
968886397 4:3336147-3336169 GTCCTGTCCCTCGGTGGTCTGGG + Intronic
970577024 4:17437499-17437521 GTGGCGGCCCGGGGTGGTCTTGG + Intergenic
979169061 4:117576173-117576195 TTTATGGTCCGTGGTGCTCTGGG - Intergenic
980351070 4:131683810-131683832 GTGCTGGCCAGTGGAGGTCTTGG + Intergenic
985652498 5:1113422-1113444 GTCATGCCCTGGGGTGGCCTAGG + Intergenic
990307018 5:54503758-54503780 GTCAAGGCCTGTGATGGTATTGG - Intergenic
992473024 5:77076846-77076868 GCCATGGCACTGGGTGGTCTGGG + Exonic
1001651354 5:173318360-173318382 GGCATGGCCAGTGCTTGTCTTGG + Intronic
1004297775 6:14429600-14429622 GTCCCGGCCCTTGGAGGTCTGGG + Intergenic
1009062845 6:58418039-58418061 GTCAAGGCCTGTGATGGTATCGG - Intergenic
1009250519 6:61292586-61292608 GTCAAGGCCTGTGATGGTATCGG - Intergenic
1019299360 7:295712-295734 GACATGGCCCCTGGTGGGCTGGG + Intergenic
1029472619 7:100764131-100764153 GTCCTGGCAGGTGGTGGTCATGG - Exonic
1029708374 7:102286987-102287009 CTCATGGCCCGCGGCGGACTGGG - Intronic
1030289883 7:107861605-107861627 TTCATGGCCCTCAGTGGTCTTGG - Intergenic
1032875202 7:136031343-136031365 GTCATGGTCCTTGGTTGTGTTGG + Intergenic
1038125448 8:24668306-24668328 GTCATGGCACTTGGAGTTCTGGG + Intergenic
1042661343 8:71157855-71157877 GTCATGGCCAGTGGTGGAATGGG - Intergenic
1042722719 8:71842726-71842748 GACATGGCCATTCGTGGTCTCGG - Exonic
1044361185 8:91286135-91286157 TTCATGGCCCTTCTTGGTCTGGG + Intronic
1046138296 8:110059988-110060010 ATCATGGCCCAGGGTGGTCTTGG - Intergenic
1049642346 8:143721376-143721398 GTCATGGCCTGGGCTGCTCTGGG - Exonic
1049750101 8:144279061-144279083 GTCATGGCCCGTGGTGGTCTTGG - Intronic
1049750106 8:144279077-144279099 GTCATGGCCCTTGGTGGTCATGG - Intronic
1049750111 8:144279093-144279115 GTCGTGGCCCGTGACGGTCATGG - Intronic
1049750115 8:144279109-144279131 GTCATGGCCCATGGCGGTCGTGG - Intronic
1049750141 8:144279208-144279230 GTCGTGGCACGCAGTGGTCTTGG - Intronic
1049750165 8:144279295-144279317 GTCAGGGCCCATGGTGGTATAGG - Intronic
1049750173 8:144279327-144279349 GTCGTGGCCCATGGTGGTTGTGG - Intronic
1049750184 8:144279361-144279383 GTCTTGGCCCGTGGTGGTCTTGG - Intronic
1049750191 8:144279392-144279414 CACATGGCTGGTGGTGGTCTTGG - Intronic
1053321319 9:37101393-37101415 GTCATGGACCATGGTTGTCATGG - Intergenic
1053344849 9:37370780-37370802 GTCTTGGCCCCTGGTGGCCTAGG - Intergenic
1053781641 9:41615905-41615927 GTGCTGGCCAGTGGAGGTCTTGG - Intergenic
1054169589 9:61826059-61826081 GTGCTGGCCAGTGGAGGTCTTGG - Intergenic
1054667949 9:67754756-67754778 GTGCTGGCCAGTGGAGGTCTTGG + Intergenic
1062211100 9:135364522-135364544 TTCATGGGCCGTGGAGGGCTGGG - Intergenic
1062464128 9:136673729-136673751 GTCATGCCCTGCCGTGGTCTGGG + Exonic
1062725473 9:138071010-138071032 GCCAGAGGCCGTGGTGGTCTTGG + Intronic
1187138474 X:16570881-16570903 ATGGTGGCCCGGGGTGGTCTTGG - Intergenic
1188252239 X:27911289-27911311 GTGTTTGCCCATGGTGGTCTAGG + Intergenic
1194403550 X:93467357-93467379 CTCATGTCTTGTGGTGGTCTAGG - Intergenic
1199156179 X:144551391-144551413 CTCATGGCCTGTGGTGGTGGTGG + Intergenic
1200603202 Y:5231922-5231944 GTCATGGCCTGAGGTGGTGGTGG - Intronic