ID: 1049750304

View in Genome Browser
Species Human (GRCh38)
Location 8:144279936-144279958
Sequence CAGCTCACATCCTGTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 233}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049750304_1049750306 -4 Left 1049750304 8:144279936-144279958 CCCAGAGCACAGGATGTGAGCTG 0: 1
1: 0
2: 1
3: 35
4: 233
Right 1049750306 8:144279955-144279977 GCTGAGTGTCGATCTTCCTCAGG No data
1049750304_1049750310 20 Left 1049750304 8:144279936-144279958 CCCAGAGCACAGGATGTGAGCTG 0: 1
1: 0
2: 1
3: 35
4: 233
Right 1049750310 8:144279979-144280001 GGAATGTACCAGAACCCTCTGGG No data
1049750304_1049750309 19 Left 1049750304 8:144279936-144279958 CCCAGAGCACAGGATGTGAGCTG 0: 1
1: 0
2: 1
3: 35
4: 233
Right 1049750309 8:144279978-144280000 TGGAATGTACCAGAACCCTCTGG No data
1049750304_1049750311 21 Left 1049750304 8:144279936-144279958 CCCAGAGCACAGGATGTGAGCTG 0: 1
1: 0
2: 1
3: 35
4: 233
Right 1049750311 8:144279980-144280002 GAATGTACCAGAACCCTCTGGGG No data
1049750304_1049750313 29 Left 1049750304 8:144279936-144279958 CCCAGAGCACAGGATGTGAGCTG 0: 1
1: 0
2: 1
3: 35
4: 233
Right 1049750313 8:144279988-144280010 CAGAACCCTCTGGGGCTCCCCGG No data
1049750304_1049750307 -1 Left 1049750304 8:144279936-144279958 CCCAGAGCACAGGATGTGAGCTG 0: 1
1: 0
2: 1
3: 35
4: 233
Right 1049750307 8:144279958-144279980 GAGTGTCGATCTTCCTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049750304 Original CRISPR CAGCTCACATCCTGTGCTCT GGG (reversed) Intronic
900119955 1:1044356-1044378 CAGCTCACACTCGGTGCTGTAGG - Exonic
900230141 1:1552540-1552562 CAGCTCAGAGCCTGAGCTCCAGG + Intronic
901092805 1:6653508-6653530 CAGCTCTCATCCTGAGCCCTGGG - Intronic
901188259 1:7388795-7388817 CAGCTCCCATCCTGTCCCATGGG + Intronic
901804222 1:11727505-11727527 GAGCTGACATCCTGTGGCCTTGG - Intergenic
902449586 1:16488398-16488420 TACCTCACATCCTGTGCAATTGG - Intergenic
902744127 1:18461827-18461849 CAGCTCACGTTCTGTCCTCGTGG + Intergenic
902916436 1:19642922-19642944 AAGTTCTCATCCTGTGCTCCAGG + Intronic
902916457 1:19643066-19643088 AAGTTCTCATCCTGTGCTCCAGG + Intronic
903560217 1:24221458-24221480 CATCTCCCCTCCTGTGCTCATGG - Intergenic
904247059 1:29195228-29195250 CAGCTCAGATCTAGTGCTCCAGG + Intronic
904330397 1:29754707-29754729 CAGGTCCCATGCTGGGCTCTGGG + Intergenic
904466679 1:30712279-30712301 CAGGTCACACCCTGAGATCTCGG - Exonic
904517488 1:31067522-31067544 CAGCTCAATTCCTGGGCTCAAGG - Intergenic
904747502 1:32720160-32720182 CATCTCTCAGCCTGTGCCCTGGG + Intergenic
905164768 1:36073523-36073545 CAGCTCACCTCCTGGGCTCAAGG + Intergenic
905969255 1:42128783-42128805 CAGCTCTGATCCACTGCTCTGGG - Intergenic
908121717 1:60992040-60992062 AAGCTCAAATCCTGTCCTCAAGG - Intronic
909602747 1:77478083-77478105 CAGCTCACCTCTTGTGCCATGGG + Intronic
910484812 1:87701463-87701485 CACCTCTAATCCTGTGCTTTGGG + Intergenic
911946545 1:104116392-104116414 CAGTTCACCTTCTGTGCTTTTGG - Intergenic
915219271 1:154361128-154361150 CAGCTCAAGACCTGTCCTCTAGG - Intergenic
915674132 1:157515164-157515186 CAGCACACAGCCTGTGCACATGG - Exonic
916379203 1:164189566-164189588 CAGCTCAGCCCCTGAGCTCTTGG - Intergenic
918179036 1:182070186-182070208 CAGCTCTGATTCAGTGCTCTTGG - Intergenic
919786223 1:201260089-201260111 CGGCTCACATCCTGTCATCTGGG + Intergenic
923227420 1:231951267-231951289 AAGCTCAGAGCCTGTGCTTTTGG + Intronic
1062812321 10:476292-476314 CAGCTCAGATCCGGTCCTCCGGG + Intronic
1063660636 10:8033596-8033618 CAGCTCTCAACCTGTACTCCAGG + Intergenic
1065001981 10:21345617-21345639 GAGCTCACAACCTGTTCTCTAGG + Intergenic
1065246899 10:23767859-23767881 CAGCTTACACCCTACGCTCTGGG - Intronic
1067794089 10:49308142-49308164 CTGCTCACATCCAGTTCTGTGGG + Intronic
1069828467 10:71268531-71268553 CAGCTCAGATCCTGGGCTATGGG - Intronic
1071346808 10:84701234-84701256 TACCTCACATCCTGTACTCATGG - Intergenic
1072660291 10:97359810-97359832 CAGCTCACCTACTGTGCCCTGGG - Intronic
1076336541 10:129710332-129710354 CCGCTCACATCCTTCTCTCTTGG + Intronic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1076449791 10:130548984-130549006 CATCATACATCCTGGGCTCTGGG + Intergenic
1077468356 11:2744637-2744659 CAGTTCACATCCTAAGCTCTAGG - Intronic
1077590537 11:3487518-3487540 CAGCTCCCATCCTGCTCTCCAGG - Intergenic
1079144631 11:17839752-17839774 CACCTCACATCCTGAGGTGTTGG + Intronic
1079331340 11:19535423-19535445 CAGCTCACAGCCTTTGCACCTGG + Intronic
1080077617 11:28170197-28170219 AAGTCCCCATCCTGTGCTCTGGG - Intronic
1081621287 11:44620406-44620428 CTGCTCACACCCTCTGCCCTGGG - Intergenic
1081934706 11:46896702-46896724 CAGCTCTGATACTGTGCTCCAGG + Intronic
1082842171 11:57698734-57698756 CAGCTCAAAGCCTGTGCCCTGGG - Exonic
1083789920 11:64977823-64977845 CAGATCAGAGCCTGTGCTCAGGG - Intergenic
1084246259 11:67859299-67859321 CAGCTCCCATCCTGCTCTCCAGG - Intergenic
1084332273 11:68437169-68437191 CAGCTCACAGTCTGTCCTCCTGG - Intronic
1084786455 11:71444444-71444466 CCGCTCATATTCTGAGCTCTGGG - Intronic
1085036705 11:73305309-73305331 CAGCTCACCCCCTTTTCTCTGGG - Intergenic
1086508341 11:87528862-87528884 CAGCCTCCTTCCTGTGCTCTTGG + Intergenic
1088812499 11:113400992-113401014 CATCTCACGTCTTGGGCTCTTGG + Intergenic
1089567414 11:119379013-119379035 CAGCTCCCATCCAGTGCCCCTGG - Intronic
1089638408 11:119831454-119831476 CAGCCCACCTGCTGTCCTCTGGG - Intergenic
1090646369 11:128769555-128769577 CAGCTGCCTCCCTGTGCTCTGGG + Intronic
1091307075 11:134543081-134543103 CTGCACACCTCCTTTGCTCTCGG + Intergenic
1091849196 12:3681432-3681454 CAGCTCAGCTGCTTTGCTCTTGG - Intronic
1092416825 12:8296424-8296446 CAGCTCCCATCCTGCTCTCCAGG - Intergenic
1093596449 12:20966947-20966969 AATCTAACATTCTGTGCTCTTGG - Intergenic
1096504544 12:52084523-52084545 GAGCTCTCATTCTCTGCTCTCGG - Intergenic
1099254668 12:80300795-80300817 CATCTCAAGTCCTGTGCGCTTGG - Intronic
1102141949 12:110622519-110622541 CAGCTCAGCTCCTGTTTTCTGGG - Intronic
1102591151 12:113957814-113957836 CAGCTGGCATCCCTTGCTCTTGG + Exonic
1103362563 12:120362480-120362502 CAGCTCACAGCCAATCCTCTGGG + Intronic
1108323176 13:49306024-49306046 CAGCTGACACGATGTGCTCTTGG - Intergenic
1108495273 13:51018706-51018728 CTTCTCACTTCCTGTCCTCTAGG + Intergenic
1112241329 13:97684492-97684514 CTGCTCTCTTCCTGTCCTCTCGG + Intergenic
1114216594 14:20661885-20661907 CTGGTCCCATCCTATGCTCTGGG - Intergenic
1116630754 14:47328551-47328573 GTGCTCACAGCCTGTACTCTTGG + Intronic
1117667649 14:58073783-58073805 CTGCTCACTATCTGTGCTCTTGG + Intronic
1117862805 14:60110415-60110437 CAGGTCACCGCCAGTGCTCTAGG - Intronic
1118456420 14:65948880-65948902 CAGCTCAGAGACTGGGCTCTGGG + Intergenic
1121742174 14:96261885-96261907 TAGATCCCATCCTGTGCTCATGG - Intronic
1124666130 15:31594559-31594581 CAGCTCTCTAACTGTGCTCTGGG - Intronic
1127644434 15:60945756-60945778 CAGGTCTCATCATGTGCACTGGG - Intronic
1127905288 15:63371757-63371779 CAGCTAACATGATGTGCTCTCGG + Intronic
1128262710 15:66243527-66243549 CAGCTCACTTCCAGTGATCGTGG - Intronic
1128806234 15:70533102-70533124 CAGCTCCCTTCCTGGGCTCTAGG + Intergenic
1131114335 15:89784769-89784791 CGTCTCCCCTCCTGTGCTCTGGG + Intergenic
1131299403 15:91183012-91183034 CAGTTCAGATCCTGTGCTCATGG + Intronic
1131675120 15:94663464-94663486 CAGCTCCCGTCCTGTCCTCCTGG + Intergenic
1131905682 15:97139478-97139500 CAGCTCCCATCCTTTTCTCTGGG - Intergenic
1133355908 16:5136603-5136625 CAGCTCCCATCCTGCTCTCCAGG - Intergenic
1134050917 16:11136792-11136814 CAGCACACATCCTGTCCCCTGGG + Intronic
1134250516 16:12570698-12570720 CAATTCACATCCTGTGCTTTGGG - Exonic
1136026801 16:27473870-27473892 CAGCTTCCCTCCAGTGCTCTAGG - Intronic
1136035287 16:27534654-27534676 CAGCTGCCACCCTGTGTTCTTGG + Intronic
1136287605 16:29253617-29253639 AAGCTCACATCCTGCGTGCTGGG - Intergenic
1136542549 16:30936208-30936230 TAGCTCACATCCTCAGCTCTGGG + Intronic
1136577349 16:31132461-31132483 CAGCACACACCATGTCCTCTTGG + Exonic
1139470780 16:67177052-67177074 CAGCTCACAGCCTTTGCTCCGGG + Intronic
1141022200 16:80507984-80508006 CAGCTGAAATTCTGGGCTCTGGG - Intergenic
1141820885 16:86444602-86444624 CAGCTCACATCCTTTGCAGAAGG + Intergenic
1142093228 16:88226245-88226267 AAGCTCACATCCTGCGTGCTGGG - Intergenic
1142289487 16:89186767-89186789 CAGAGCACCTACTGTGCTCTGGG - Intronic
1143337933 17:6187452-6187474 CAGTGCATATCCTGTGCTCCAGG - Intergenic
1144672353 17:17140025-17140047 CTGCTCCCATCCTGTGATCCAGG + Intronic
1144970873 17:19108734-19108756 CAACTCACTTCCTGTCCTGTAGG + Intergenic
1144991175 17:19234896-19234918 CAACTCACTTCCTGTCCTGTAGG + Intronic
1145098430 17:20052570-20052592 CTGCTCCCAGCCTGTGGTCTAGG - Intronic
1148770357 17:50062785-50062807 CAGCTCAGAACTTGGGCTCTGGG - Intronic
1149194045 17:54098450-54098472 CAGCTCACATCCTCTCTTTTAGG - Intergenic
1149220102 17:54407314-54407336 GACTCCACATCCTGTGCTCTTGG + Intergenic
1150856644 17:68759570-68759592 CAGCTGACATCCTGGGGTCAGGG + Intergenic
1152297399 17:79476053-79476075 CACCTGACACCCTGTGCTCTGGG + Intronic
1152471190 17:80490915-80490937 CTGCCAACATTCTGTGCTCTTGG - Intergenic
1152566347 17:81102088-81102110 CAGCTGACCTCCTGGGCTCGTGG + Intronic
1152780529 17:82225769-82225791 CAGCCCACATCCTGCGTCCTTGG - Intergenic
1155046047 18:22104106-22104128 CACCTCACATACTGTCCTCAAGG - Intergenic
1155250020 18:23945375-23945397 CAGATCACATCCTGTGATTTGGG + Intronic
1158545522 18:58392993-58393015 GAGTTCAAATCCTGTGATCTGGG - Intronic
1159379857 18:67643308-67643330 CAGCTCACATCCAGTGCTTCAGG + Intergenic
1159928285 18:74288703-74288725 CAGGTGACTTCCTGTGCTCCTGG - Intronic
1159962190 18:74564240-74564262 CTGCATGCATCCTGTGCTCTAGG + Intronic
1160133495 18:76250902-76250924 CAGCTCACAGGCTGCACTCTTGG - Intergenic
1161531898 19:4794620-4794642 CAGCTCACTCCCTGTGCCCTCGG - Exonic
1162908550 19:13837203-13837225 GAGCTTGGATCCTGTGCTCTGGG - Intergenic
1162919255 19:13890418-13890440 CAGCTGGCATCCTGGACTCTGGG + Exonic
1164047857 19:21558200-21558222 CAGAACACATCCTGAGCTCAGGG - Intergenic
1165086144 19:33348862-33348884 CAGATAAGATCATGTGCTCTGGG - Intergenic
1166214118 19:41324713-41324735 CAGCTCTCATCCTGCACTCTTGG - Exonic
925262637 2:2541739-2541761 CCCCTCTCCTCCTGTGCTCTGGG - Intergenic
926214315 2:10894805-10894827 TGGTCCACATCCTGTGCTCTGGG + Intergenic
929601227 2:43206088-43206110 CAGCCCAGAGACTGTGCTCTGGG + Intergenic
930101849 2:47609530-47609552 GGTCTCACAGCCTGTGCTCTGGG - Intergenic
931435634 2:62243741-62243763 GAACTCCCACCCTGTGCTCTGGG + Intergenic
932430417 2:71670766-71670788 CAGCACCCATTCTGTGCTCTGGG - Intronic
932783312 2:74577710-74577732 CTACTGACTTCCTGTGCTCTGGG - Intronic
932817687 2:74874846-74874868 CAGCTGTCAGCCTGTCCTCTGGG - Intronic
933901664 2:86854618-86854640 CAGCTGTCTTCCTTTGCTCTGGG - Intronic
934572161 2:95379583-95379605 CAGCTCACATCCTCTTTTATAGG - Intronic
935460496 2:103327058-103327080 CAGTTCATATGCTGTCCTCTTGG + Intergenic
935778884 2:106494650-106494672 CAGCTGTCTTCCTTTGCTCTGGG + Intergenic
936156392 2:110050043-110050065 CATGTCACAGCCTGGGCTCTGGG - Intergenic
936188298 2:110321401-110321423 CATGTCACAGCCTGGGCTCTGGG + Intergenic
937230343 2:120394922-120394944 CAGCTGAGGTCCTGTTCTCTGGG - Intergenic
939784301 2:146490447-146490469 CCGCTCTCATTCTGTTCTCTCGG - Intergenic
941336807 2:164255503-164255525 CAGCTATCATCCAGTGCTTTAGG - Intergenic
945198224 2:207257138-207257160 CAGCTTCCATCCGGTGCTGTCGG - Intergenic
945323080 2:208449540-208449562 CTGCTCAAATTCTGTGTTCTAGG - Intronic
946941509 2:224774550-224774572 CAGCTCTTATCGTGTGCTTTGGG - Intronic
947734600 2:232448152-232448174 CAGGCCCAATCCTGTGCTCTGGG + Intergenic
948844880 2:240678266-240678288 AAGGGCACATCCTGTGTTCTGGG - Intronic
948848980 2:240696613-240696635 AAGGGCACATCCTGTGTTCTGGG + Intronic
948886114 2:240885767-240885789 CAGCTCACACCTTTGGCTCTTGG - Intergenic
1169733914 20:8816157-8816179 CAGATGGGATCCTGTGCTCTGGG - Intronic
1170714863 20:18822968-18822990 CAGATCTCATCCTGGGCTTTGGG - Intronic
1171307316 20:24117522-24117544 CAGCTAAAATGCTGTGCTCATGG + Intergenic
1171468138 20:25347024-25347046 CATCTCTCATCCTGTGCTTCAGG - Intronic
1172123307 20:32611014-32611036 CTGCCCACGTCCTGTCCTCTCGG + Intergenic
1175409967 20:58760981-58761003 CAGCTCAGATGCTCTGCTTTAGG - Intergenic
1175825092 20:61932334-61932356 CAGCTCACTGCCTGGGCACTGGG - Intronic
1176222644 20:63977353-63977375 CAGCTGACACCGTGTGCTCCAGG + Exonic
1177838669 21:26213389-26213411 CAGCCCACCTCCTGGGCTCAAGG + Intergenic
1179468559 21:41595141-41595163 CACCTAACATCCTGTCATCTAGG - Intergenic
1179629655 21:42668536-42668558 CAGCACACTTCCTGTTCTTTTGG + Intronic
1180121245 21:45749866-45749888 CAGACCACATCCTGTGCTGGAGG - Intronic
1180199291 21:46215096-46215118 CAGCTCACAGCCCGGCCTCTAGG + Intronic
1181805620 22:25372888-25372910 GTGCTCACACCCTGGGCTCTGGG - Intronic
1181894565 22:26095762-26095784 CAGGTCAGTTCCTGTGCTGTGGG + Intergenic
1182348431 22:29683622-29683644 CATATCAGACCCTGTGCTCTGGG - Intronic
1183174279 22:36211401-36211423 CAACTCACTTCCTGTGTTTTTGG + Intergenic
1183588307 22:38765896-38765918 CTGCTCTCATCCAGTGCTCTAGG + Intronic
951961073 3:28321249-28321271 CAGTTAACTTCCTGTGCTCTAGG - Exonic
954750310 3:52809883-52809905 CATCTTCCATCCTTTGCTCTTGG + Intergenic
955003655 3:54949848-54949870 CATCTGGCATGCTGTGCTCTGGG + Intronic
955107094 3:55908765-55908787 CATATCAGCTCCTGTGCTCTAGG + Intronic
956133597 3:66077234-66077256 CAGTGCACATCCTGATCTCTGGG - Intergenic
956718599 3:72099263-72099285 CAGCTGACATCCAGTGCTGGAGG + Intergenic
960464098 3:117974186-117974208 TAGGTGACCTCCTGTGCTCTAGG - Intergenic
961181148 3:124878668-124878690 CAGCACACAGCCTGTGGTTTTGG - Intronic
961894378 3:130155025-130155047 CAGCTCCCATCCTGCTCTCCAGG - Intergenic
964792289 3:160463599-160463621 CAGCTCACATTCTCTGGGCTGGG - Intronic
965524220 3:169699540-169699562 CAGCTCAGCTCCTCTGCTGTGGG + Intergenic
966102443 3:176287799-176287821 CAGCTCTCATTCTTTGATCTTGG - Intergenic
968534668 4:1115996-1116018 AAGCTCACACCCTGTGCTACTGG + Intergenic
969004466 4:4008103-4008125 CAGCTCCCATCCTGCTCTCCAGG - Intergenic
969078402 4:4599028-4599050 CAGCTTGCATACTGAGCTCTGGG - Intergenic
969696303 4:8737039-8737061 CAGCTCTCATCCTGTGTTTCTGG - Intergenic
969931645 4:10636667-10636689 CAGCTCTCATACCGTGCACTTGG + Intronic
971044591 4:22791233-22791255 CAGCTGACATCCTTTCTTCTTGG - Intergenic
971403472 4:26298290-26298312 AGTCTCACATCCTGTGGTCTTGG + Intronic
971538435 4:27784283-27784305 GACCTCACTTCTTGTGCTCTGGG - Intergenic
975173671 4:71262055-71262077 CAGGTCACATCCTGTGGTTTGGG + Intronic
975906018 4:79213172-79213194 CAGTTGTCATCCTGTGCTTTTGG - Intergenic
977722389 4:100254716-100254738 CTGCTCAGATGCTGTGCTGTGGG - Intergenic
978881616 4:113710215-113710237 CAGCTCAGGTCCTATACTCTAGG - Intronic
980007668 4:127559919-127559941 CAGCTCACCTCTTGTTCTTTTGG - Intergenic
980077165 4:128306164-128306186 CACCCCACCTCCTCTGCTCTGGG - Intergenic
980378221 4:131976812-131976834 ACGCTCACTGCCTGTGCTCTTGG - Intergenic
981769004 4:148285073-148285095 CAGCTCACATCAAGAGCTGTGGG - Intronic
982644196 4:158002382-158002404 CAGTTCACATAATGTTCTCTAGG - Intergenic
984149754 4:176112241-176112263 CCACTCACATCCCGTGCCCTTGG + Intronic
984921887 4:184771841-184771863 CAGCCCACATCCAGTGCTTCTGG - Intronic
986376803 5:7140779-7140801 AAGCTCATATCCTGCACTCTGGG - Intergenic
986591638 5:9376473-9376495 AAGCCCACATCCTGGGCTGTAGG - Intronic
987327441 5:16825210-16825232 CAGCTCAAATGCTATCCTCTCGG + Intronic
989249527 5:39293666-39293688 CAGCTTAAATCCTGTGTTCTTGG - Intronic
990513324 5:56509266-56509288 CAGCTCACATGCTCTGCATTTGG + Intergenic
992812324 5:80401238-80401260 CAGGTCACATTTTGTGCTTTGGG + Intergenic
992839792 5:80677000-80677022 CTGATGACATCCTGAGCTCTGGG + Intronic
994366144 5:98919679-98919701 CAACTCTAATCCTGTGCTATAGG - Intronic
998151302 5:139759017-139759039 CAGCTCACATTCCATGCTCCAGG + Intergenic
999342038 5:150780646-150780668 CAGGTCAGATCCTGGGCCCTTGG + Intronic
1000275617 5:159732368-159732390 CAGCCCACATCCTGTCCTGTGGG + Intergenic
1002089725 5:176797466-176797488 CAGCTCACACCCTGTGGCCTCGG + Intergenic
1002516430 5:179762348-179762370 CACCTGCCATCCTCTGCTCTGGG - Intronic
1003181094 6:3792344-3792366 CAGCTCACCTACTGTGGACTAGG + Intergenic
1003594051 6:7458821-7458843 CAGCCTACAGCCTGAGCTCTGGG - Intergenic
1004094145 6:12536040-12536062 CAGTTCACACCATCTGCTCTTGG - Intergenic
1005342425 6:24855772-24855794 CACCTGTGATCCTGTGCTCTGGG + Intronic
1006554649 6:34855473-34855495 CACCTCACATCCTGGCCTTTTGG + Intronic
1009498796 6:64384823-64384845 CTTCTCACATCCTGAGCTCTGGG + Intronic
1010354857 6:74920825-74920847 CAGCTCACAACCTTCTCTCTGGG + Intergenic
1015799541 6:137046305-137046327 CACCTCACATCCTGTCCTCCTGG + Intergenic
1018152466 6:160953173-160953195 GAGCTCACATTCTTTTCTCTGGG - Intergenic
1019118631 6:169785709-169785731 CAGCTCTCAGCTTGTCCTCTAGG - Intergenic
1019713141 7:2526440-2526462 CACGTCCCTTCCTGTGCTCTCGG - Intronic
1020016364 7:4834337-4834359 TAGGTCACCTCCTGAGCTCTGGG - Intronic
1020324599 7:6964601-6964623 CAGCTCCCATCCTGCTCTCCAGG - Intergenic
1022704327 7:32788443-32788465 CAGCTCTCACCCTGTGCTGCAGG + Intergenic
1022908506 7:34878185-34878207 CAGCTCTCACCCTGTGCTGCAGG + Exonic
1023208065 7:37772630-37772652 CAGCTCCCTTCCTGTGCTCTGGG + Intronic
1023874870 7:44281503-44281525 CAGCTCGGATCCTGTGGTCCCGG + Intronic
1024057331 7:45670365-45670387 CAGCTCACCTGCTGTGTCCTGGG - Intronic
1024573542 7:50746004-50746026 CAGCTCAGATACTGGACTCTGGG - Intronic
1032141024 7:129330084-129330106 GAGCTCACCTCCTGGGCTCAAGG + Intronic
1034355994 7:150451129-150451151 TTCCTCACATCCTGTGCCCTGGG + Exonic
1034896171 7:154877837-154877859 CACCCCACATCCTCTGCTCAGGG - Intronic
1034899084 7:154896366-154896388 CTGCTCAAATCCTGACCTCTGGG - Intergenic
1036371466 8:8166339-8166361 CAGCTCCCATCCTGCTCTCCAGG + Intergenic
1036879437 8:12499305-12499327 CAGCTCCCATCCTGCTCTCCAGG - Intergenic
1036969464 8:13338739-13338761 TAGCTCACCTCCTGTGATCTGGG - Intronic
1037498618 8:19464255-19464277 CAACCCACATCCTGGCCTCTGGG + Intronic
1037828865 8:22176814-22176836 CAGCACACAGCCTGGGCACTCGG + Intronic
1037874302 8:22532639-22532661 CACCTAACAACCTGTGCGCTAGG - Intronic
1042456292 8:69007826-69007848 CTGCTAACAACCAGTGCTCTTGG - Intergenic
1044480520 8:92682081-92682103 CAACTCCCATCCTCTGTTCTGGG + Intergenic
1044674033 8:94711856-94711878 CAGATCTGATCATGTGCTCTTGG + Intergenic
1045373488 8:101548834-101548856 GAGCTCACATCAGGGGCTCTTGG + Intronic
1045711930 8:104994987-104995009 CCGCACACATTCTGTGCTCAAGG + Intronic
1048321468 8:133403782-133403804 CTGCTCACATCCCTTGTTCTTGG + Intergenic
1048973140 8:139656347-139656369 CACCTGAGGTCCTGTGCTCTCGG + Intronic
1049305218 8:141899273-141899295 CAGCTCAAATCCTGTGTCCTGGG - Intergenic
1049510935 8:143026348-143026370 CTGCTCACACCCTGAGCTCTGGG - Intergenic
1049750304 8:144279936-144279958 CAGCTCACATCCTGTGCTCTGGG - Intronic
1052044914 9:23782865-23782887 CAGCTCACTTCTTGTGCCCCGGG - Intronic
1053438003 9:38090047-38090069 CACCTCACAGCCAGTGCTGTAGG + Intergenic
1054707010 9:68472862-68472884 AAGGACACATCCTGTGCTGTGGG - Intronic
1054749164 9:68886858-68886880 CAGACCACATCCAGTGCTATAGG - Intronic
1057168853 9:92948892-92948914 CAGCTCACACCATCTGTTCTGGG + Intronic
1057307016 9:93918346-93918368 CAGGTGACATCTTGTGCTCCAGG + Intergenic
1057551454 9:96053827-96053849 CAGCTCACCTGCTGTGGCCTGGG - Intergenic
1058582924 9:106478570-106478592 TAGGCCACATCCTGTGTTCTGGG + Intergenic
1058951954 9:109912219-109912241 CAGCTCACATCCTTTCCTGGTGG - Intronic
1062305291 9:135902883-135902905 AAGCTCCCATCCAGTGCCCTAGG + Intronic
1062533344 9:137011117-137011139 CAGCTCAGGGCCTGTGCTCTGGG + Intronic
1185475678 X:413945-413967 CACCCCACATCCCGAGCTCTCGG - Intergenic
1186415525 X:9380289-9380311 CAGCTCTCCACCTGTGCTCAGGG + Intergenic
1189716280 X:43870122-43870144 CAGCTCAGATTCTGGGTTCTTGG - Intronic
1193278743 X:79623623-79623645 CAGATCATATCCTGAGCTCATGG - Intergenic
1195943835 X:110188631-110188653 CAGGTAACATCCTTTGCTCTAGG - Intergenic
1196250562 X:113455233-113455255 GAAAACACATCCTGTGCTCTTGG - Intergenic
1196798331 X:119520377-119520399 GAGCTCACCCCCTGTGCTTTAGG + Intergenic
1197281782 X:124545384-124545406 TTGCTCACATGCTCTGCTCTGGG + Intronic
1200062845 X:153491301-153491323 GAGCTCACAGCCTGCCCTCTGGG + Intronic
1200243231 X:154508466-154508488 GAGCTCACATCTTGTCCTCGAGG + Exonic
1201017853 Y:9623885-9623907 GACCTCTCATCCTGTGCCCTGGG + Intergenic
1201561934 Y:15327041-15327063 CAGAGCACATCCTCTTCTCTCGG + Intergenic