ID: 1049750411

View in Genome Browser
Species Human (GRCh38)
Location 8:144280471-144280493
Sequence CTCAGCGAAGGCTCTGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049750411_1049750424 27 Left 1049750411 8:144280471-144280493 CCATTCCCAGAGCCTTCGCTGAG No data
Right 1049750424 8:144280521-144280543 TGTGCATTATGCTCCGGCACAGG No data
1049750411_1049750423 21 Left 1049750411 8:144280471-144280493 CCATTCCCAGAGCCTTCGCTGAG No data
Right 1049750423 8:144280515-144280537 CAAGAGTGTGCATTATGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049750411 Original CRISPR CTCAGCGAAGGCTCTGGGAA TGG (reversed) Intronic