ID: 1049751733

View in Genome Browser
Species Human (GRCh38)
Location 8:144287890-144287912
Sequence GGAAGTTACGGCCTTGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049751733_1049751737 -3 Left 1049751733 8:144287890-144287912 CCTCTGCCAAGGCCGTAACTTCC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1049751737 8:144287910-144287932 TCCAGAACACCGAAACTACTGGG No data
1049751733_1049751736 -4 Left 1049751733 8:144287890-144287912 CCTCTGCCAAGGCCGTAACTTCC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 1049751736 8:144287909-144287931 TTCCAGAACACCGAAACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049751733 Original CRISPR GGAAGTTACGGCCTTGGCAG AGG (reversed) Intronic
900428934 1:2592955-2592977 CGAAGTTCCGGCCTGGGCAGGGG + Exonic
903560677 1:24224766-24224788 GGAAGGCAGGGCTTTGGCAGAGG + Intergenic
904953448 1:34263057-34263079 GGAAGCTACAGGCTTGCCAGTGG - Intergenic
906179865 1:43808915-43808937 GGAAGGTATTGCCTTAGCAGTGG + Intronic
906236574 1:44214774-44214796 AGAAGGTGCGGCCTTGGAAGTGG + Exonic
908251591 1:62270129-62270151 GGAAGGAACGGCAGTGGCAGGGG + Intronic
909858679 1:80575324-80575346 GGAAGTTACAGTGTTGGCTGGGG - Intergenic
910588457 1:88903438-88903460 GGAAGTTACAGTGTTGGCTGCGG + Intergenic
911235342 1:95406017-95406039 GGAAGTAACGTACTTGGAAGAGG + Intergenic
912129679 1:106586345-106586367 GGAAGTTACAGTGTTGGCTGGGG - Intergenic
913081390 1:115390516-115390538 GGAAGTTATGGTTTTGGCTGGGG + Intergenic
917764773 1:178203725-178203747 GGAAGTTACTGTGTTGGCTGGGG + Intronic
920920422 1:210293327-210293349 GGAAGTTAAGGCCGGGGAAGGGG - Intergenic
922549594 1:226484308-226484330 GGAGGCTACGGCCGTGGCTGAGG - Intergenic
923203599 1:231736289-231736311 GGAAGGTACTGCTTTGGGAGTGG + Intronic
924840536 1:247706113-247706135 GGAAGTTACCGTGTTGGCTGGGG - Intergenic
1069717391 10:70529879-70529901 GGAAGTAGCGGCCCTGGCAGGGG - Exonic
1069785332 10:70984184-70984206 GGAAGCTATGGCCTTGGTAGAGG + Intergenic
1072163358 10:92788491-92788513 GGTAGTTACGGTCTTGGCCATGG + Intergenic
1073918256 10:108430735-108430757 GGAAGTTACAGTGTTGGCTGGGG - Intergenic
1075811195 10:125226389-125226411 GGAAGAGAAGGCCTTGGTAGAGG + Intergenic
1075871513 10:125774885-125774907 GGAACTGAGGGGCTTGGCAGTGG + Intronic
1076123514 10:127955010-127955032 GGGAGTTACGGTGTTGGCTGCGG + Intronic
1081110764 11:39130432-39130454 GGAAGTTACAGCGTTGGCTGGGG + Intergenic
1081814985 11:45934037-45934059 GGAGGTGGCGGCATTGGCAGGGG + Exonic
1083657698 11:64237587-64237609 GGAAGCTGCGGCGTCGGCAGCGG - Exonic
1083668714 11:64288822-64288844 GGAAGCAAAGGCCATGGCAGGGG - Intronic
1084835757 11:71800885-71800907 GGGAGTTAGGGACTTGGGAGGGG - Exonic
1086141393 11:83504485-83504507 GGAAGTTACAGTGTTGGCTGGGG - Intronic
1088836894 11:113585071-113585093 GGGAGTTACGGTGTTGGCTGGGG + Intergenic
1090605336 11:128417182-128417204 GGAAGCAATGGCCTTGGCAAAGG - Intergenic
1091862490 12:3798402-3798424 GGAAGTTACTACCTTAGCAATGG - Intronic
1092107638 12:5933777-5933799 AGAAGTAACAGCCTAGGCAGAGG - Intronic
1092407569 12:8231518-8231540 GGGAGTTAGGGACTTGGGAGGGG + Intergenic
1093283451 12:17226757-17226779 AGAAGGTAGGGCCTTTGCAGAGG - Intergenic
1099230541 12:80018943-80018965 TGAAGATAAGGCCTTGGAAGAGG + Intergenic
1101139742 12:101782999-101783021 GGAAGTGTCGGCCAGGGCAGGGG - Intronic
1105042421 12:132970868-132970890 GGGAGGTGGGGCCTTGGCAGAGG + Intergenic
1108023071 13:46149244-46149266 GGTAGGTAAGGCCTGGGCAGAGG + Intronic
1115923101 14:38399477-38399499 AGAAATTACTACCTTGGCAGTGG + Intergenic
1118921131 14:70150927-70150949 AGAAGTTCCAGCCTAGGCAGGGG - Intronic
1119059464 14:71460504-71460526 GGGAGTTACAGTGTTGGCAGGGG - Intronic
1120244378 14:81989404-81989426 GGAAGTTATGCTCTTGGGAGGGG - Intergenic
1130115300 15:81000945-81000967 GGAGGTTACGGCCGAGGCGGCGG + Exonic
1131918015 15:97292164-97292186 GGAAGTTCTGGCCAGGGCAGTGG - Intergenic
1133348271 16:5084630-5084652 GGGAGTTAGGGACTTGGGAGGGG + Exonic
1135376573 16:21952725-21952747 GGAATTTACGTCCTAGGCTGGGG - Exonic
1139521061 16:67483024-67483046 GGAGGCTCAGGCCTTGGCAGAGG - Exonic
1143685673 17:8513804-8513826 TGAAATTACGGCACTGGCAGTGG - Exonic
1150520799 17:65865570-65865592 GGAGGTTGAGGCCGTGGCAGAGG - Intronic
1152266491 17:79297745-79297767 GGAAGTTATGCCCTTGGAATTGG + Intronic
1152883154 17:82831873-82831895 GAAAGACACGGCCTTGGCAGTGG + Exonic
1165468039 19:35986645-35986667 AGAAGTTCAGGCCTGGGCAGTGG + Intergenic
1165667479 19:37645567-37645589 GGAAGTTTTGGCCATAGCAGTGG - Intronic
1167024208 19:46903074-46903096 TTAAGTTAAGGCCTTGACAGTGG + Intergenic
1168309523 19:55453319-55453341 GGGAGTTCTGGCCTTGGAAGAGG + Exonic
927793591 2:26029929-26029951 AGAAGTTAGGGCCTTCCCAGAGG - Intergenic
928708844 2:33981858-33981880 GGAAGTTACTGCATTGGTCGAGG + Intergenic
931676693 2:64703667-64703689 GGTGGTTAAGGCCCTGGCAGTGG + Intronic
932772090 2:74506163-74506185 GGAAGGTATGTCCTTGGCCGCGG - Exonic
934568335 2:95352792-95352814 GGAAGGTCCGGCATTGCCAGTGG - Intronic
934754414 2:96815890-96815912 GGAAGTTCCCGGCTTGGGAGCGG - Intergenic
945717603 2:213378981-213379003 GGGAGTTACAGTCTTGGCTGGGG - Intronic
1169416932 20:5425451-5425473 GGAACTGACAGCCTAGGCAGGGG - Intergenic
1169574444 20:6942607-6942629 GGAAGATACTTCCTTGTCAGAGG - Intergenic
1169977806 20:11350352-11350374 GGAGGTTCTGGCCTTGGCTGTGG + Intergenic
1170004258 20:11647730-11647752 GGAAGTCACGGCCCTGGCTTGGG - Intergenic
1175861217 20:62151390-62151412 GGAAGCCACGGCCATGGCAATGG - Intronic
1178041261 21:28643031-28643053 AGAAGCTTGGGCCTTGGCAGTGG + Intergenic
1179191898 21:39129970-39129992 GGAATTTAGGGCTTTAGCAGGGG - Intergenic
1181379901 22:22493655-22493677 AGAAGTTGCGGCCTGGGCTGGGG - Intronic
950109023 3:10406825-10406847 AGAAGGTAAGGCCTGGGCAGGGG + Intronic
952431782 3:33230756-33230778 GGTAGTTACGCCGATGGCAGTGG + Intergenic
952601089 3:35084184-35084206 GGAGGTTACAGCGTTGGCTGGGG - Intergenic
957052618 3:75421892-75421914 GGGAGTTAGGGACTTGGGAGGGG + Intergenic
957689832 3:83553572-83553594 GGAAGTTACAGTGTTGGCTGGGG - Intergenic
958842498 3:99224641-99224663 GAATGTTATGGCCTTGACAGAGG + Intergenic
959226555 3:103595597-103595619 GGAAGTTACAGTGTTGGCTGGGG - Intergenic
961418762 3:126782736-126782758 GCAAGTCACACCCTTGGCAGTGG + Intronic
962346002 3:134619447-134619469 GGAAGAGCAGGCCTTGGCAGAGG + Intronic
963568871 3:146966461-146966483 CGAACATACAGCCTTGGCAGTGG + Intergenic
964564249 3:158032377-158032399 AGAAGTTCCAGCCTTGACAGAGG - Intergenic
964679000 3:159317224-159317246 GGAAGTTACAGTGTTGGCTGGGG - Intronic
965034770 3:163424248-163424270 GGAAGTTACTGTGTTGGCTGGGG - Intergenic
968480077 4:829375-829397 GGCAGTGGAGGCCTTGGCAGGGG - Intergenic
968890871 4:3367734-3367756 GGGAGTTACTGGCTAGGCAGGGG + Intronic
969194254 4:5547878-5547900 GGAAGTCACAGCCTTGGCTCAGG - Intronic
969758569 4:9166526-9166548 GGGAGTTAGGGACTTGGGAGGGG - Intergenic
969818533 4:9703976-9703998 GGGAGTTAGGGGCTTGGGAGGGG - Intergenic
970363374 4:15333106-15333128 GGCAGTTATGGTCTTGGCTGAGG - Intergenic
971222946 4:24725725-24725747 GGAAGTTGAGGCCTCGACAGTGG + Intergenic
982708889 4:158739818-158739840 GGGTGTTTGGGCCTTGGCAGTGG - Intergenic
987991672 5:25220174-25220196 GGAAATTAAGGGATTGGCAGTGG - Intergenic
990909722 5:60841936-60841958 GGAAGTTACGGAGTTTGCATTGG - Intronic
997067235 5:130575774-130575796 GGAAGCTAGAGCCATGGCAGGGG - Intergenic
998290094 5:140906860-140906882 GGAAGTTACAGTGTTGGCTGGGG - Intronic
1000199109 5:158989913-158989935 GGAACTTGCAGTCTTGGCAGGGG + Intronic
1000635246 5:163636716-163636738 GGAACTGACTGCCTTAGCAGTGG + Intergenic
1002028891 5:176413979-176414001 GCAAGTTCTGTCCTTGGCAGGGG - Intronic
1006840502 6:37025522-37025544 AGAAGTTACGGCCCTCGCGGTGG + Intronic
1007368067 6:41408363-41408385 GGAGTTTGCAGCCTTGGCAGAGG + Intergenic
1008340488 6:50357965-50357987 GGGAGTTACAGCGTTGGCTGGGG + Intergenic
1011853036 6:91654229-91654251 GGAAGTCACAGCCGAGGCAGAGG - Intergenic
1013412990 6:109898153-109898175 GGAAGTGAGGACCTTGGCAGAGG + Intergenic
1013495160 6:110690458-110690480 AGAAGTCACAGCCTTGTCAGAGG - Intronic
1014378644 6:120711098-120711120 AGAATCTAAGGCCTTGGCAGTGG + Intergenic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1016845306 6:148563246-148563268 GGAAGTTAGGGACTTTGCACTGG + Intergenic
1017028919 6:150203990-150204012 GGAAGCTACAGGCTTGGCACTGG - Intronic
1018311362 6:162513133-162513155 GGAAATTATATCCTTGGCAGAGG + Intronic
1019056074 6:169224498-169224520 GGAAGCCACGTCCTTGACAGAGG - Intronic
1019119131 6:169789523-169789545 GGAGGCCACGGACTTGGCAGTGG + Intergenic
1019452027 7:1103955-1103977 GGAACTTACTCCCTGGGCAGGGG - Intronic
1019892687 7:3959306-3959328 TGAAGTCAGGGCCTTGGAAGGGG - Intronic
1020121282 7:5505156-5505178 GGAACCTAGGGCCTTGGGAGTGG - Intronic
1020567538 7:9817167-9817189 GGGAGTTACAGCGTTGGCTGGGG - Intergenic
1021203623 7:17753500-17753522 GGAAGCTAGGGCCTGGGAAGGGG + Intergenic
1022876236 7:34533573-34533595 GGAAGTGGCTGCCTTTGCAGAGG - Intergenic
1031784179 7:126007915-126007937 GGAAGATACGGCATTGGGAATGG - Intergenic
1033134627 7:138774116-138774138 GGAACTTAAGGTCATGGCAGAGG - Intronic
1036847954 8:12182468-12182490 GGGAGTTAGGGACTTGGGAGGGG + Exonic
1036869315 8:12424751-12424773 GGGAGTTAGGGACTTGGGAGGGG + Intergenic
1040034123 8:42852021-42852043 CAAAGTAAAGGCCTTGGCAGGGG + Intronic
1044245358 8:89937914-89937936 GGAATTAACTTCCTTGGCAGAGG - Intronic
1044331008 8:90920374-90920396 GGAAGATATAGCCTTGGGAGAGG - Intronic
1049232046 8:141489536-141489558 GGAAGTGCCGGCCTGGACAGTGG - Intergenic
1049751733 8:144287890-144287912 GGAAGTTACGGCCTTGGCAGAGG - Intronic
1050902064 9:10961600-10961622 GGAAGTTACAGTGTTGGCTGGGG + Intergenic
1052213767 9:25939622-25939644 GGAAGTTAAGGCTTTGGCATGGG + Intergenic
1052375954 9:27717788-27717810 GGAAGTGACAGTCTTGGCAAAGG + Intergenic
1056314007 9:85371248-85371270 GGGAGTTACAGCATTGGCTGTGG - Intergenic
1191939462 X:66462787-66462809 GGAACTTTCTGGCTTGGCAGAGG - Intergenic
1192138959 X:68631233-68631255 GGAAGTTCCAGCCCTGGCTGAGG - Intergenic
1192146828 X:68688060-68688082 GGAAGTTCCAGCCCTGGCTGAGG + Intronic
1197409110 X:126094780-126094802 GGGAGTTACAGTCTTGGCTGGGG - Intergenic
1200065448 X:153502334-153502356 GGAGGTAGCGGCTTTGGCAGGGG + Intronic
1200088779 X:153624769-153624791 GGAAGGGAAGGCCATGGCAGAGG + Intergenic