ID: 1049752425

View in Genome Browser
Species Human (GRCh38)
Location 8:144291540-144291562
Sequence GGGCCTGCGTGCTCGCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049752407_1049752425 24 Left 1049752407 8:144291493-144291515 CCAACACGCGCAGGCGCGCGGCT 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1049752425 8:144291540-144291562 GGGCCTGCGTGCTCGCGCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1049752419_1049752425 -2 Left 1049752419 8:144291519-144291541 CCGGGGACCAGGGCGGGGTCGGG 0: 1
1: 0
2: 3
3: 56
4: 443
Right 1049752425 8:144291540-144291562 GGGCCTGCGTGCTCGCGCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 98
1049752422_1049752425 -9 Left 1049752422 8:144291526-144291548 CCAGGGCGGGGTCGGGGCCTGCG 0: 1
1: 0
2: 3
3: 69
4: 518
Right 1049752425 8:144291540-144291562 GGGCCTGCGTGCTCGCGCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049752425 Original CRISPR GGGCCTGCGTGCTCGCGCCG GGG Intergenic
900184671 1:1327487-1327509 GGGCCTGCGTACCAGCCCCGAGG + Exonic
900283886 1:1890425-1890447 CGGCCTTTGTTCTCGCGCCGCGG + Intronic
900523261 1:3116296-3116318 GCGCCGGCGTGCTCACTCCGCGG + Intronic
901405015 1:9039707-9039729 GGGCGTGGGTCCTGGCGCCGAGG - Intronic
903856698 1:26342133-26342155 GGGCCTGCATGCTGGCTCCTGGG + Intronic
905889345 1:41509866-41509888 GGGCCTGCCTGCTGGGGCCTGGG + Exonic
910449213 1:87329409-87329431 CGGCCTGCGAGCTAGCGCGGAGG + Intronic
921010190 1:211133728-211133750 TGCCCTGGGTGCCCGCGCCGCGG + Intronic
921010248 1:211134010-211134032 GGGACTGCGTGCGGGCCCCGAGG - Intronic
924052368 1:240092064-240092086 TGGCCTGAGTGCCCGCGGCGCGG + Exonic
924627354 1:245706717-245706739 GGGCCTCCATGCTGCCGCCGGGG + Intronic
924778401 1:247126821-247126843 GGGGCTGCGGGCGCGGGCCGGGG - Intronic
924783257 1:247171599-247171621 GGGGCTGCGGGCGCGGGCCGGGG + Intronic
1064354379 10:14604239-14604261 GCGCCTTTGTGCGCGCGCCGAGG - Intronic
1067560215 10:47300176-47300198 GTGGCAGCGTGCGCGCGCCGGGG - Intergenic
1071579407 10:86756317-86756339 GGGCCGGCGGGCCCGCGCGGAGG + Intergenic
1072591683 10:96832902-96832924 GGGTCTGCGTGCACGCGCGGCGG + Intronic
1073689997 10:105798039-105798061 GGGCCTGTGTGCTTGCACCCTGG + Intergenic
1077339969 11:2021882-2021904 GGGCCTGCGTGCTCTCCCCTAGG - Intergenic
1077502767 11:2916797-2916819 AGGCCTGCGTGCTCCAGCCAAGG + Intronic
1077995303 11:7447393-7447415 TGGCCTGTGTGCTGGGGCCGGGG - Intronic
1078645880 11:13141101-13141123 GGGCCTGCCTGGTCGTGCTGGGG + Intergenic
1083317871 11:61827724-61827746 GGGCGTGCGCGCACGCGCCCCGG + Intronic
1089564663 11:119364298-119364320 GGGTCCGCGTGCCGGCGCCGGGG - Intronic
1202822954 11_KI270721v1_random:77071-77093 GGGCCTGCGTGCTCTCCCCTAGG - Intergenic
1097383240 12:58920202-58920224 GAGCCTCCGTGCGCGCGCCGCGG - Exonic
1103534690 12:121626581-121626603 GGGCCTGCGTGCTGGGGCAGCGG + Exonic
1104961344 12:132489927-132489949 GGGCCTGCGTGAGCGGGTCGGGG + Exonic
1119484664 14:74979765-74979787 GGGCCTGTGTGCTCCCTCCACGG + Intergenic
1125970271 15:43905765-43905787 GAGCCTGCGTGCTCAGGCTGTGG + Intronic
1129302348 15:74632721-74632743 CGGCCTGCGTGCTCCCCCAGTGG + Exonic
1131257446 15:90871722-90871744 CGGCCCGGGTGCTCGGGCCGGGG + Intronic
1137677478 16:50310932-50310954 GTGCCTGCCTGCTCGCACCAAGG + Intronic
1141573472 16:84948669-84948691 GGACCTGCGTGCAGGCACCGTGG - Intergenic
1141674485 16:85510455-85510477 TGGCCTGCGTGCACCCGCCTTGG + Intergenic
1142049748 16:87950810-87950832 GGGCCTGAGTGCACGCGCGCGGG - Intronic
1142130879 16:88430962-88430984 GGGCCTGAGGGCTCCTGCCGGGG - Exonic
1142206563 16:88785604-88785626 GGCGCTGCGTGCTCGCGCCTCGG - Intergenic
1142639883 17:1279786-1279808 GGGCCTGCCTGCTGCCCCCGCGG - Exonic
1142799782 17:2337824-2337846 CGGCCCGGGTGCCCGCGCCGGGG - Intronic
1143527716 17:7482125-7482147 GGGCCTGCCTGCTGGCTTCGTGG + Exonic
1146731042 17:35194145-35194167 GGGCCTGCCTGCTGGCTTCGTGG - Exonic
1147893843 17:43737343-43737365 GGGCCTGCCTGCTCTAGCTGGGG - Intergenic
1148807911 17:50273447-50273469 GGGCCTGCTCGCCCGCGCCCCGG + Intronic
1150646162 17:66978700-66978722 GGGACAGCGTGCTCGCCCTGGGG - Intronic
1154115459 18:11609736-11609758 GGGCCTGCCTGCTGGCTTCGTGG + Intergenic
1162127120 19:8505781-8505803 GGGCCTTGGTGCGCGCGCCCTGG - Intergenic
1162445196 19:10718499-10718521 GCGCTTGCGTGCCCGCGGCGGGG + Intronic
1163804126 19:19385918-19385940 GGGTGCGCGTGCGCGCGCCGGGG - Exonic
1165446833 19:35861211-35861233 GGGCCTGCGGGGCGGCGCCGCGG + Exonic
1166782835 19:45351321-45351343 GGTCCTGGGTGCTGGCGCTGAGG - Exonic
1166861951 19:45816136-45816158 GGGCCGGGGTGCTGGGGCCGGGG + Exonic
1167383238 19:49150318-49150340 GGGCGGGGGAGCTCGCGCCGAGG + Exonic
925984837 2:9207080-9207102 GCGCCAGCGCCCTCGCGCCGAGG + Exonic
927929197 2:27033238-27033260 GTGCCTGCGAGCTCGCGCCCAGG - Intronic
927988285 2:27428874-27428896 GGCCCTGCCTGCTGGAGCCGAGG + Intronic
929778401 2:44942494-44942516 GATCCTGCGCGCGCGCGCCGTGG + Exonic
935032639 2:99337333-99337355 CGCCCTGCGTCCTCACGCCGAGG + Exonic
937751351 2:125479100-125479122 GAGCCTGCGTGCCAGGGCCGTGG + Intergenic
943658581 2:190534509-190534531 GCGCGTGCGTGCTCGCTCCCCGG - Intronic
946691427 2:222311585-222311607 GAGCCTGCGTCCTCACGCCCAGG - Intergenic
1171866430 20:30489602-30489624 GGGATTGCGTGCACGCGCAGCGG - Intergenic
1174176875 20:48650871-48650893 GTGCCTGCGTGCTCCCTCCGGGG - Intronic
1174602334 20:51734795-51734817 GGCCCTGAGTGCACACGCCGAGG + Intronic
1177038170 21:16071304-16071326 GTGCCTGCCTGCTCGGGCAGCGG - Intergenic
1179611698 21:42556168-42556190 GGACCTGCGGGCTCGCCACGTGG - Intronic
1181266003 22:21631256-21631278 AGGCCTGGGTGCTGGCCCCGAGG - Intergenic
1184453632 22:44597182-44597204 GGGTGTGCGTGCTCGGGCAGGGG + Intergenic
1184663501 22:45976211-45976233 CGGCCTGCGCGCTCGCGGCCGGG + Intronic
1184682989 22:46081958-46081980 GGCCCTGCGTGCGCGGGCCTCGG + Intronic
1185360434 22:50403599-50403621 GGGCCTGAGAGCTGGCGCAGGGG - Intronic
954115997 3:48467137-48467159 GGGGCTGCTTGCTCGCTCCAGGG - Exonic
969629983 4:8330370-8330392 GGGCCTGGGTACTCGGGCCTGGG + Intergenic
969912194 4:10457160-10457182 GGCCCCGCGTGCCCGCGCTGAGG - Intronic
975689372 4:76949453-76949475 GGGGCTGGGAGCTCGCGCCCAGG + Intergenic
977716588 4:100190320-100190342 GGGCCTGCGCGCTCGCTGCCGGG + Exonic
994081356 5:95711540-95711562 GGGGCTGCTTCCTCCCGCCGCGG + Intergenic
997980611 5:138465580-138465602 GGGCGGGCGTGGACGCGCCGCGG - Exonic
1002055807 5:176597394-176597416 GTGCCCGCGTCCTCGCGCGGCGG + Exonic
1002639171 5:180622551-180622573 GGGCCTGGGTGCTGGCGCACTGG - Intronic
1011419066 6:87152750-87152772 GGGCATGGGTGCTCGCGGCGCGG + Intergenic
1014017238 6:116547279-116547301 GGGCCTGTGTGCTTGCTGCGAGG + Intronic
1019492318 7:1321273-1321295 GGGCCTGGGGGCTTGCGCTGAGG + Intergenic
1020125537 7:5530847-5530869 GGGGCTGGGGGCGCGCGCCGTGG + Intronic
1022141836 7:27499601-27499623 GGACCTGCCTGCTCTGGCCGTGG + Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1036737493 8:11331247-11331269 GGGCCTGCCTGCTGGCTTCGTGG + Exonic
1036789795 8:11709835-11709857 GGGCCTGAGTACACGGGCCGGGG + Intronic
1039527941 8:38232399-38232421 GGGCGTGCGTGTGCGCACCGTGG + Intronic
1048507354 8:135033578-135033600 GGCCCTGGGAGCTCGAGCCGGGG + Intergenic
1049109605 8:140635141-140635163 GGGCCCGCGGGCTGGGGCCGGGG - Intronic
1049641121 8:143716454-143716476 GGGGGTGCGTCCGCGCGCCGAGG + Intronic
1049752425 8:144291540-144291562 GGGCCTGCGTGCTCGCGCCGGGG + Intergenic
1049781067 8:144429175-144429197 GGTCCAGCGTGCACTCGCCGGGG + Exonic
1049784617 8:144444466-144444488 GGGCCTGCGTGTCGGCGGCGAGG - Intergenic
1049784626 8:144444493-144444515 GGGCCTGCGTGTCGGCGGCGAGG - Intergenic
1049784635 8:144444520-144444542 GGGCCTGCGTGTCGGCGGCGAGG - Intergenic
1049784644 8:144444547-144444569 GGGCCTGCGTGTCGGCGGCGAGG - Intergenic
1052494648 9:29212181-29212203 GGACCTGCGTCCCCGCGGCGCGG + Intergenic
1052494671 9:29212268-29212290 GAGCCAGCGTGCTCGCGGGGTGG - Intergenic
1056712011 9:88998941-88998963 GGGCCTGCCTCCTCGAGCTGTGG - Exonic
1057024667 9:91725803-91725825 GGGCCTCCGTGCAAGCCCCGGGG + Intronic
1057560801 9:96126705-96126727 GGGCCTGGCTGCTCGGGCCGCGG - Intergenic
1062120168 9:134829857-134829879 GCGCCTGCATCCTCACGCCGGGG - Intronic
1062414139 9:136439442-136439464 CTGCCTGCGGCCTCGCGCCGAGG - Exonic
1062612898 9:137382967-137382989 GGGCCTGGGTGCTCTGGCGGTGG + Intronic
1189988644 X:46574885-46574907 CGGCGTGGGTGCTCGCCCCGGGG + Exonic
1199595852 X:149505262-149505284 GGGCCTGCGGGCCCGGGCGGCGG - Intronic
1200062613 X:153490266-153490288 GGGCCTGCGTGGGGGCTCCGGGG - Intronic