ID: 1049756548

View in Genome Browser
Species Human (GRCh38)
Location 8:144313606-144313628
Sequence GGCTCCACTCACGTCCAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049756548 Original CRISPR GGCTCCACTCACGTCCAGCA GGG (reversed) Exonic
900491623 1:2952164-2952186 TGCTCCACTCCCGTCCAGGCAGG - Intergenic
900977935 1:6028724-6028746 TGCTCCACTGACCTCCAGGATGG + Intronic
901153494 1:7120403-7120425 GTCTCCACCCACAGCCAGCACGG - Intronic
908468228 1:64415930-64415952 GGCGCCCCTCACGTCCCGGACGG - Intergenic
912790055 1:112640630-112640652 GGCACCCCTCACGTCCCGGATGG - Intronic
913414404 1:118589406-118589428 GGCTGCACACAGGTTCAGCATGG + Intergenic
918677184 1:187302066-187302088 TGCTCCACTGCCCTCCAGCATGG - Intergenic
922591274 1:226779222-226779244 GGCTTCGCTCAGTTCCAGCAAGG - Intergenic
1066251582 10:33637998-33638020 GACTCCAATCACATCCAGGAGGG - Intergenic
1074588191 10:114787738-114787760 GGCTCCCCTCACCTCCCGGACGG - Intergenic
1076874159 10:133207854-133207876 GGGCCCACTCACCTCCACCAGGG + Intronic
1084153700 11:67302840-67302862 GGCACCATTCACCTCCAGCTGGG + Intergenic
1089538010 11:119172636-119172658 GGCTCCACCCACTTCCCACAGGG - Intronic
1089982199 11:122781505-122781527 GGCTCCACCCGCGTCCCACAGGG - Intronic
1090173207 11:124623119-124623141 GGCTCCGCTGCAGTCCAGCAAGG + Exonic
1090837050 11:130461481-130461503 GGCTCCACACAGGTCCTGCCGGG - Exonic
1091600323 12:1914061-1914083 GGCTCCTCTTACTTCCACCAGGG + Intronic
1092919801 12:13221348-13221370 GGCGCCACTGTCCTCCAGCATGG - Intergenic
1099163595 12:79274982-79275004 AGCTCCACCCACCACCAGCATGG + Intronic
1100995073 12:100294466-100294488 GGCGCCCCTCACCTCCAGGATGG + Intronic
1102115776 12:110402129-110402151 TGCGCCACTCAACTCCAGCATGG + Intronic
1103494622 12:121352122-121352144 GGCGCCTCTCACCTGCAGCAGGG + Exonic
1104933647 12:132353358-132353380 GGCGTCACTCACGGCCAGCTGGG - Intergenic
1109709129 13:66140968-66140990 GGCTCCACTGCATTCCAGCATGG - Intergenic
1113709548 13:112454446-112454468 CTCTCCAGGCACGTCCAGCAGGG - Intergenic
1113887213 13:113667250-113667272 GGCGTCTCTCTCGTCCAGCAAGG + Exonic
1119594887 14:75925045-75925067 GGCGCCCCTCACCTCCAGGATGG + Intronic
1121502555 14:94449852-94449874 GGCCTCCCTCACATCCAGCATGG + Intronic
1122484073 14:102066281-102066303 GGCTCCACTCACTGCCAGAGAGG + Intergenic
1123701074 15:22915172-22915194 CGCGCCACTCACCTCCAGCCTGG - Intronic
1124132524 15:27003808-27003830 GGCGCCCCTCACCTCCAGGACGG + Intronic
1127154231 15:56110172-56110194 GGCTCCCCTCACCTCCTGGACGG - Intronic
1127154541 15:56110879-56110901 GGCTCCCCTCACCTCCCGGACGG - Intronic
1127493305 15:59485156-59485178 GGCTCCACGCAGGTCCAGAGAGG - Intronic
1129451406 15:75653214-75653236 GGCTCCTCTCAGCTCCAGCCAGG - Intronic
1131163571 15:90126131-90126153 GGCTCCACTGCCCTCCAGCCTGG + Intergenic
1132507642 16:319678-319700 GGCTGCTCCCACATCCAGCATGG + Intronic
1132717858 16:1301121-1301143 GGCTCCACAGACGGCCAGCCGGG - Intergenic
1133126257 16:3648123-3648145 GGCACCACTGTCCTCCAGCATGG + Intronic
1133740089 16:8644821-8644843 GGCTCCACCCTAGTCCTGCAGGG + Intronic
1141075440 16:81002379-81002401 GGCACCACTGACCTCCAGCTTGG + Intronic
1141993570 16:87623336-87623358 GGCTGCTCTGATGTCCAGCAGGG + Intronic
1145291019 17:21545998-21546020 GGCTCTGCTCAGGTCCAGGAAGG - Intronic
1145684566 17:26639129-26639151 GGCGCCCCTCACCTCCCGCATGG - Intergenic
1152390392 17:80000811-80000833 AGCTCCACTCAAGACCCGCAGGG - Intronic
1160530362 18:79558898-79558920 GGCTCCACACCCCTCCAGCCTGG - Intergenic
1161264689 19:3358864-3358886 GGCTACACACACGCACAGCAGGG - Intergenic
1162279056 19:9680333-9680355 GGCTCCCCTCACCTCCCGGATGG - Intergenic
1162728825 19:12705670-12705692 GAGCCCACTCACCTCCAGCAGGG + Exonic
1163921818 19:20296623-20296645 GGCGCCCCTCACCTCCAGGACGG - Intergenic
1163991046 19:20999739-20999761 GGCTCCAGTCATCTCCAGCAAGG - Intergenic
1165906854 19:39199554-39199576 GGCACCACTGCAGTCCAGCATGG - Intronic
925303022 2:2830389-2830411 CACTCCCCTCACGCCCAGCAGGG + Intergenic
925860983 2:8174750-8174772 GCCTCCACTGATGTCAAGCATGG - Intergenic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
928309937 2:30201104-30201126 GGCTCCATTCCCTTCCCGCAGGG - Intergenic
932401316 2:71482776-71482798 GCCTCCTCTCATGCCCAGCAGGG - Intronic
933750889 2:85601709-85601731 GGCACCACTGCTGTCCAGCAGGG - Intronic
937858200 2:126687794-126687816 GACTACACACACTTCCAGCAGGG - Intronic
937929532 2:127193414-127193436 GGGTCCACTCACACCCAGGATGG + Intronic
947829049 2:233125924-233125946 GTCCCCACTCAAGTCCAGCTGGG + Intronic
948817874 2:240522442-240522464 ATCTCCACTCACTTCCACCAAGG - Intronic
948900167 2:240952671-240952693 GCTTCCACTCACGTGCAGCCTGG - Intronic
1169252983 20:4074363-4074385 GCCTCTTCTCACATCCAGCAGGG - Intronic
1169431519 20:5540366-5540388 GTCTCCACTGACTTTCAGCAAGG - Intergenic
1170539124 20:17370666-17370688 AGCTCCACTCATGTTCAGTAGGG - Intronic
1174218641 20:48935904-48935926 GGCACCCCTCACTTCCCGCATGG + Intronic
1174218695 20:48936032-48936054 GGCGCCCCTCACTTCCCGCATGG + Intronic
1176109250 20:63404087-63404109 GGCCAGACTCATGTCCAGCAAGG - Intergenic
1176377243 21:6092725-6092747 GGCCCCTCTCACTTCCAGCCTGG + Intergenic
1179746232 21:43445519-43445541 GGCCCCTCTCACTTCCAGCCTGG - Intergenic
1179816659 21:43910303-43910325 GGCTCCACTCCCCTCCTCCAGGG - Intronic
1179878789 21:44284976-44284998 GTCCCCACTCACGTCCACCTGGG + Intergenic
1179925586 21:44532356-44532378 GGCAGCATTCACGTCCAGCCAGG + Intronic
1182484505 22:30631589-30631611 GGCGCCCCTCACCTCCAGGACGG + Intergenic
1182624498 22:31635931-31635953 AGCTCCACTCCCTGCCAGCATGG + Intronic
1182644602 22:31797966-31797988 TGCTCCACTCCAGTCCAGCCTGG - Intronic
1182659760 22:31917007-31917029 GTCCCCACTCACCTCCATCAGGG - Intergenic
954056407 3:48029390-48029412 GGCGCCACTGAACTCCAGCATGG + Intronic
955784587 3:62523745-62523767 GGCTCCAGTCACTACCAACAAGG + Intronic
956346651 3:68286956-68286978 GGCTCATCGCACTTCCAGCAAGG + Intronic
956595750 3:70965278-70965300 GGTTCCATTCACATTCAGCATGG + Intronic
961784262 3:129339446-129339468 GGCGCCCCTCACGTCCCGGACGG + Intergenic
966569369 3:181423929-181423951 GGCACCACTGAACTCCAGCATGG + Intergenic
966883650 3:184362908-184362930 GGCTCGGGTTACGTCCAGCAGGG + Intronic
968175147 3:196543168-196543190 GGCGCCCCTCACGTCCCGGACGG + Intergenic
972288409 4:37669265-37669287 GGCTCCCCTCACCTCCCGGATGG - Intronic
972408398 4:38767414-38767436 TGCTCCTCTGAAGTCCAGCAGGG - Intergenic
973559995 4:52125737-52125759 GGCTCCACTGCCCTCCAGCCTGG - Intergenic
977922200 4:102658157-102658179 GCCTCCACTCTCATCCATCATGG + Intronic
979772403 4:124544189-124544211 GGCTCAACTCTGTTCCAGCAAGG - Intergenic
981753270 4:148114092-148114114 GGCTCTACTCACGTCATGCATGG + Exonic
981817479 4:148847480-148847502 GGCGCCACTGCCGTCCAGCCTGG + Intergenic
981882857 4:149636457-149636479 GGATCCACACACGTCTATCATGG - Intergenic
983698831 4:170566456-170566478 GGCTCCACTGCAGTCCAGCATGG + Intergenic
984728073 4:183040704-183040726 GGCGCCCCTCACCTCCAGAATGG + Intergenic
984764621 4:183390293-183390315 GGCACCACTGTAGTCCAGCATGG - Intergenic
986609191 5:9549859-9549881 GCTTCCACTCAAGTCCACCAGGG + Intergenic
986610518 5:9562296-9562318 GGCCTGACTCACGCCCAGCAGGG + Intergenic
988048859 5:25997228-25997250 AGCTCCACTGAACTCCAGCATGG + Intergenic
988645710 5:33093076-33093098 GGCTGCACCCACTTGCAGCAGGG - Intergenic
990973726 5:61538688-61538710 GCCTCTACTCAAGTTCAGCAAGG - Intronic
994828754 5:104748746-104748768 GGCTCCACTGCAGTCCAGCCTGG + Intergenic
998025189 5:138810876-138810898 GGCGCCCCTCACCTCCCGCACGG + Intronic
999240009 5:150121944-150121966 GTCTCCTTTCATGTCCAGCATGG + Exonic
999705542 5:154269591-154269613 GGCCCCAGCCACGTCCAGCTGGG - Intronic
1001366643 5:171147798-171147820 GGCACCCCTCACGTCCCGGACGG - Intronic
1007817524 6:44535019-44535041 GGGTCCACTCTGCTCCAGCATGG - Intergenic
1008045647 6:46849102-46849124 GCCTCCTCTCAGGCCCAGCAGGG + Intergenic
1010239352 6:73601542-73601564 GGCTCCCCTCACCTCCCGGACGG - Intronic
1010419818 6:75660674-75660696 CGCTCCACTCAACTCCAGCCTGG - Intronic
1011148527 6:84244570-84244592 GGCGCCACTCACCTCCCGGACGG + Intergenic
1011524590 6:88250382-88250404 GGCTCCACTCATCTAGAGCAAGG - Intergenic
1011610586 6:89146551-89146573 GGCCCCCCTCACGCCCAGCGCGG - Exonic
1013077657 6:106785525-106785547 GGCTCCTCTCCCCTCCAGAAAGG + Intergenic
1014353713 6:120377192-120377214 GGCACCACTGAACTCCAGCATGG - Intergenic
1019154726 6:170031318-170031340 GGCTCCCCTCCCTTTCAGCAGGG - Intergenic
1020559657 7:9715061-9715083 GGCACCACTCATGTTCAACATGG - Intergenic
1023990816 7:45127239-45127261 GGCTGCACTCCTGTCCAGCTGGG + Intergenic
1023994677 7:45151979-45152001 GCCCCCACTGACGGCCAGCAAGG - Intergenic
1024389688 7:48794096-48794118 GGCTCAACTCAAATACAGCAAGG + Intergenic
1026759583 7:73116489-73116511 GGCACCACTCAACTCCAGCCTGG - Intergenic
1027087827 7:75276984-75277006 GGCACCACTCAACTCCAGCCTGG + Intergenic
1029393937 7:100294132-100294154 GGCACCACTCAACTCCAGCCTGG + Intergenic
1029403546 7:100359637-100359659 GGCTCCCCTCAAGCCCACCAAGG + Intronic
1029608645 7:101614928-101614950 GGCCACCCTCAGGTCCAGCAAGG + Intronic
1031080045 7:117249413-117249435 GGCTCCACTCACAACCTCCAGGG - Intergenic
1032508164 7:132451544-132451566 GCCTGCACTGATGTCCAGCAAGG + Intronic
1034458987 7:151187618-151187640 GGCCCCACTCCCGCCCAGCCTGG - Intronic
1035397996 7:158547637-158547659 GGCTCCAGTCTCCACCAGCAGGG - Intronic
1037323185 8:17663206-17663228 GGCTCCACTCCAGTTCTGCAGGG - Intronic
1038421284 8:27435645-27435667 GGCTCCACTGGCCTCCAGCAGGG + Intronic
1038610896 8:29059554-29059576 GGCAGCACACATGTCCAGCACGG - Intronic
1040413901 8:47180975-47180997 GGCTCCTCTCCCCTCCAGCAGGG + Intergenic
1043382928 8:79722444-79722466 GGCACCACTGATGTCCAGCTTGG + Intergenic
1043400011 8:79875178-79875200 GGCTCCACTGTCTTCCAGCCTGG + Intergenic
1046422909 8:114008097-114008119 TGCTCCACTGACTTCCAGCCTGG - Intergenic
1046827394 8:118706460-118706482 GGCTCCATTCACTTCCTTCATGG - Intergenic
1047377702 8:124318249-124318271 GGCTGCAATCATGTCCAGCTAGG - Intronic
1049154849 8:141060197-141060219 GGACCCACTCTCATCCAGCATGG + Intergenic
1049756548 8:144313606-144313628 GGCTCCACTCACGTCCAGCAGGG - Exonic
1051150603 9:14074897-14074919 GGCACCACTGCCGTCCAGCCTGG + Intergenic
1052995940 9:34551751-34551773 GGCTCCCCTCACGTCCCCCAAGG + Exonic
1053282170 9:36827449-36827471 GGCTCCAGTCACCTCCTGCAGGG - Intergenic
1053902314 9:42806915-42806937 GCCTCCTCTCACGCCCACCAGGG - Intergenic
1054532662 9:66198604-66198626 GCCTCCTCTCACGCCCACCAGGG + Intergenic
1057227234 9:93298842-93298864 TGCTCAACACAAGTCCAGCACGG + Intronic
1057638674 9:96796229-96796251 GACTCCACTCATGACCAGAAAGG - Intergenic
1057910357 9:99015521-99015543 GGCTCCCCTCACAGCCACCATGG + Exonic
1058723034 9:107777335-107777357 GGCTCCCCTCACCTCCCGGACGG - Intergenic
1062303894 9:135891069-135891091 GGCTGCCCTCAGGTCCAGCCAGG - Intronic
1062525107 9:136975044-136975066 GGCTCCACTAAGGTCCTGCCTGG + Intergenic
1203405814 Un_KI270539v1:885-907 GGCGCCCCTCACCTCCCGCATGG - Intergenic
1185445074 X:253624-253646 GGCTCCACTCACATCCAGGAGGG + Intergenic
1189349556 X:40266611-40266633 GGCTCCACTCCAGCCCATCAGGG + Intergenic
1189793236 X:44623289-44623311 GGCACCACTGAAGTCCAGCCTGG - Intergenic
1190024564 X:46912194-46912216 GGCTCCCCTCCCGTCCAGCTGGG - Intergenic
1190328298 X:49220119-49220141 GGCACCACTGAAGTCCAGCCTGG - Intronic
1191871751 X:65751996-65752018 GGTTCCACTCACGTCCACTGAGG - Intergenic
1192248090 X:69389472-69389494 GGCTGCACTCTCCTCCAGCCTGG + Intergenic
1192969683 X:76217918-76217940 GGCTCCCCTCACCTCCCGGACGG + Intergenic
1193202008 X:78702702-78702724 TTCTCCACTCACTTCCTGCAAGG - Intergenic
1193524072 X:82566942-82566964 GGCTGCAGTCACGTTCAGGATGG - Intergenic
1193979914 X:88169275-88169297 GGCTGCACCCACTTGCAGCATGG - Intergenic
1194057385 X:89152058-89152080 GGTTCCAATCACAACCAGCAGGG + Intergenic
1195016359 X:100785557-100785579 GTTTCCACTCACTTCCATCAAGG + Intergenic