ID: 1049758014

View in Genome Browser
Species Human (GRCh38)
Location 8:144319377-144319399
Sequence GATGTGAGCAGATCAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049758014_1049758019 4 Left 1049758014 8:144319377-144319399 CCAGCTGCTGATCTGCTCACATC 0: 1
1: 0
2: 3
3: 23
4: 203
Right 1049758019 8:144319404-144319426 CTGCTGAGCCGAGCCAGTGAGGG No data
1049758014_1049758018 3 Left 1049758014 8:144319377-144319399 CCAGCTGCTGATCTGCTCACATC 0: 1
1: 0
2: 3
3: 23
4: 203
Right 1049758018 8:144319403-144319425 CCTGCTGAGCCGAGCCAGTGAGG No data
1049758014_1049758021 12 Left 1049758014 8:144319377-144319399 CCAGCTGCTGATCTGCTCACATC 0: 1
1: 0
2: 3
3: 23
4: 203
Right 1049758021 8:144319412-144319434 CCGAGCCAGTGAGGGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049758014 Original CRISPR GATGTGAGCAGATCAGCAGC TGG (reversed) Intronic
900671510 1:3857539-3857561 GATCTGAGCAGCTGGGCAGCAGG + Exonic
900700805 1:4047590-4047612 GAGATGAGCAGCTCTGCAGCAGG + Intergenic
901150896 1:7100607-7100629 CATGTGTGCATGTCAGCAGCAGG - Intronic
901216041 1:7555932-7555954 GAGGCTAGCAGATCAGCAGGCGG + Intronic
901835032 1:11918646-11918668 GAGGTGAGCAGATCACCAGAGGG - Intergenic
902934260 1:19753279-19753301 GATGTGAGCTCATGAGCTGCTGG - Intronic
903333621 1:22610428-22610450 GATGTGAGTAGATGACTAGCAGG + Intergenic
903349315 1:22708795-22708817 CATGTGAAAAGATCAGCACCTGG + Intergenic
903456489 1:23490877-23490899 GATGAGAGCAGTTCAGTGGCTGG - Intergenic
903779977 1:25814867-25814889 GATGGGAGCAGTTCAGGAGCAGG + Intronic
904418572 1:30377315-30377337 GAAATGAGCAGAGCAGGAGCTGG - Intergenic
904911258 1:33936089-33936111 GAAGCGGGCAGATCAGCAGTGGG - Intronic
908377424 1:63558373-63558395 GAAGTGCATAGATCAGCAGCTGG - Intronic
908491186 1:64645765-64645787 TCAGTGAGCAGGTCAGCAGCTGG + Intronic
916183098 1:162105306-162105328 GGTGTGTGCAGAACAGCAACAGG - Intronic
916496583 1:165353331-165353353 GATGTGAAGGGATCAGGAGCGGG - Intronic
917340499 1:173972508-173972530 AAAAGGAGCAGATCAGCAGCAGG - Exonic
918077233 1:181179850-181179872 GAAGTGACCAGGACAGCAGCCGG + Intergenic
918107310 1:181425905-181425927 GATGTGAGCACAGCTGCAGAGGG - Intronic
919349290 1:196428847-196428869 TGTGTGGGCAGATCAGAAGCAGG - Intronic
919365274 1:196651789-196651811 GGTATGTGCAAATCAGCAGCTGG - Intergenic
919465817 1:197920706-197920728 GATTGGAGAAAATCAGCAGCAGG + Intronic
919524523 1:198631094-198631116 CAGGTGAGCAGAACACCAGCTGG + Intergenic
920046225 1:203134319-203134341 GAAGTCAGCAGATCAGTGGCAGG + Intronic
921195866 1:212757234-212757256 GATGAGATCAGAGAAGCAGCCGG + Intronic
921924003 1:220696895-220696917 GATGTGAGAAGCTCAGCAGATGG - Exonic
923259136 1:232250069-232250091 GATGTCAGCAGATCAGAGGCTGG - Intergenic
923473509 1:234312675-234312697 AATGAGAGCAGGCCAGCAGCTGG + Intronic
924581832 1:245330384-245330406 CATGTGTGAAGATGAGCAGCAGG + Intronic
1062935466 10:1382877-1382899 GATGTGAGCAGCTGAGGAGTGGG - Intronic
1063095754 10:2907477-2907499 GAAGTGGGCAGATCTGCAGAGGG - Intergenic
1064687993 10:17884272-17884294 GATGTGAGCATTTTAGCATCAGG + Intronic
1065130170 10:22612573-22612595 GAGGAGAGCAGCTCAGCAGAGGG + Intronic
1065209741 10:23391065-23391087 GATGTGAGCAGGGCAGGAGAGGG - Intergenic
1065494463 10:26314577-26314599 GGTTTGAGCACATCAGGAGCGGG + Intergenic
1069857557 10:71449988-71450010 GATGTGAACAGACCAGGAGAAGG - Intronic
1071543493 10:86509305-86509327 AATGTGAGCAGCTGAGCAGATGG - Intronic
1073345326 10:102778515-102778537 GATCTGAGAGGATCAACAGCAGG + Intronic
1074307470 10:112292348-112292370 GATGTGAGCACAGTAACAGCAGG - Intronic
1075730498 10:124632702-124632724 GAAGTGAGCAAATCACCAACTGG + Intronic
1076840953 10:133044914-133044936 GGTGGGGGCAGATCAGGAGCTGG - Intergenic
1078064171 11:8067054-8067076 AATGGGAGCAGATCAGGAGCCGG - Intronic
1079005564 11:16789221-16789243 GATGAGTGCAGAGGAGCAGCTGG - Exonic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1084369686 11:68732471-68732493 GATGGGAGCTGCTCAGCTGCTGG - Intronic
1084460572 11:69294566-69294588 GATCTGAGCAGGTAAGAAGCAGG + Exonic
1084479421 11:69410072-69410094 GATGAGATAAGCTCAGCAGCGGG - Intergenic
1085122307 11:73974978-73975000 GAGGTGATCAGGTCAGCAGCAGG + Exonic
1085383483 11:76141412-76141434 GAAGTGAGCAGGTCAACAGTAGG + Exonic
1085456349 11:76667585-76667607 GGTGAGAGCAGAGCAGCTGCAGG - Intronic
1086218241 11:84408961-84408983 GATGTGATCAGATTAGCAGCAGG - Intronic
1086898694 11:92341865-92341887 GATATGAGCAGATGAGTATCAGG - Intergenic
1087383768 11:97443482-97443504 GATGTGTCCAGATCAGCAGAAGG + Intergenic
1089209842 11:116792368-116792390 GACGTGAGCAGGTGAGCAGCTGG - Exonic
1090066739 11:123510197-123510219 GAAGGGAGAAGGTCAGCAGCTGG - Intergenic
1090429729 11:126635668-126635690 GACGTGAGCAGATATCCAGCTGG - Intronic
1091026126 11:132142707-132142729 GATGTGTTCAGAACCGCAGCTGG + Intronic
1091231279 11:133989372-133989394 AGTGTGAGCAGAACCGCAGCAGG - Intergenic
1092161982 12:6320255-6320277 GATGTGAGCAGATAAAAAGCAGG + Intronic
1092886022 12:12925051-12925073 GAAGTGAGCAGATCAAGAGTTGG - Intergenic
1093382093 12:18505538-18505560 GATGGGAGCAAGTCATCAGCAGG - Intronic
1093658609 12:21726570-21726592 GATGTTTGCAGAACAGCTGCAGG + Intronic
1095941573 12:47730700-47730722 AGGGTGAGCAGCTCAGCAGCTGG + Intergenic
1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG + Intronic
1105045619 12:133001040-133001062 GATGTGACCATATTAGAAGCTGG - Intronic
1106131957 13:26948320-26948342 GATCTGAGCTGCTGAGCAGCAGG - Intergenic
1107500003 13:40964061-40964083 CATGAGCCCAGATCAGCAGCTGG - Intronic
1107790373 13:43995889-43995911 GACATGAGCAGATCAGGAGAGGG - Intergenic
1111384617 13:87508294-87508316 GGTGTGAGCATATCAGGAACAGG - Intergenic
1114948592 14:27717451-27717473 GACGAGAGCAGATGAGAAGCAGG - Intergenic
1118285582 14:64468434-64468456 GATGAGAAGAGATCAGCAGAAGG + Exonic
1118833333 14:69456245-69456267 GCTTTGAGAAGAGCAGCAGCTGG + Intronic
1118862142 14:69672777-69672799 GATCTGAGCAGATCAGCCTTAGG + Intronic
1122816574 14:104316944-104316966 GATGTGGGCAGAGCAGAGGCAGG + Intergenic
1122953672 14:105060173-105060195 GATCTTGGCAGAGCAGCAGCTGG - Intronic
1123114459 14:105888289-105888311 GATGTGGGCAGAGCCTCAGCAGG - Intergenic
1124439958 15:29678481-29678503 CATGTAAACACATCAGCAGCAGG + Intergenic
1124708698 15:31986858-31986880 GAGGTGAGCTGATCAGCTCCCGG - Intergenic
1125095166 15:35842285-35842307 GATGTGAGTAGAGCAGGAACTGG + Intergenic
1125100368 15:35905292-35905314 GATTTGTGAAGACCAGCAGCAGG - Intergenic
1125108563 15:36003614-36003636 TATGTGAGCAGAGCAAGAGCAGG - Intergenic
1127088888 15:55447540-55447562 GAGGCGGGCAGATCAGGAGCTGG + Intronic
1127795134 15:62431332-62431354 GATGAGAGCAGCACAGCAGTAGG + Intronic
1128580340 15:68805538-68805560 GGTGTGAGCAGAGCAGTGGCCGG + Intronic
1129276693 15:74450222-74450244 GCTGGGGGCAGATCAGCAGGAGG - Intronic
1129308589 15:74687607-74687629 GAGGTGAGCAGATCACCAGAAGG - Intronic
1132860922 16:2071378-2071400 GGTGTGTGCACATCAGCAGGTGG + Intronic
1139740372 16:69030437-69030459 GAGGTGAGCATTTCAGCAGAGGG + Intronic
1142298788 16:89244186-89244208 GAGGTGAGCAGATCACCTGAGGG + Intergenic
1142684772 17:1571459-1571481 AATGTGAGCCGATATGCAGCTGG - Intronic
1144785178 17:17827460-17827482 GGTGGGAGCAGAACAGCAGGTGG - Intronic
1148903108 17:50893505-50893527 GATGGGAGCGGCTCAGCTGCGGG + Intergenic
1151163575 17:72185786-72185808 GATTACAGCAGAGCAGCAGCAGG + Intergenic
1155434073 18:25792865-25792887 GAGCTGAGCAGAACAGCTGCAGG - Intergenic
1155854783 18:30819638-30819660 GTTGTGTTCAGATCAGCTGCAGG + Intergenic
1156004291 18:32421459-32421481 GATGTGAGCAGATTGGCATTAGG - Intronic
1160220906 18:76977109-76977131 GAAGTGAGCAGAGCAGGTGCTGG - Intergenic
1160301954 18:77690041-77690063 TATGTGAACCTATCAGCAGCAGG - Intergenic
1161482721 19:4518837-4518859 GATGAGAGCAGAGAAGAAGCTGG - Intergenic
1164719169 19:30419741-30419763 GATGTGAGCACATCAGGAGACGG - Intronic
1165143298 19:33715615-33715637 GAGGTGTGCAGATCTTCAGCAGG + Intronic
1166864070 19:45825680-45825702 GAGGGCAGCAGAGCAGCAGCGGG - Intronic
1167285153 19:48595049-48595071 GAAGTGAGCAGATCACCCGAGGG + Intronic
1167502921 19:49857528-49857550 GCTGTGAGCAGATGAGGGGCAGG + Intronic
925285400 2:2712424-2712446 GATGTTGGCAGAACAGCAGCTGG - Intergenic
925316904 2:2933596-2933618 GAGGGGAGCAGCTCAGCATCTGG - Intergenic
925851156 2:8083523-8083545 GCTGTCAGTAGCTCAGCAGCAGG - Intergenic
926476632 2:13330281-13330303 GATGTGGGAATATCAGAAGCTGG - Intergenic
929280428 2:40072320-40072342 GGTGTGTTCAAATCAGCAGCAGG - Intergenic
929537946 2:42796009-42796031 CAGGTGATGAGATCAGCAGCTGG - Intergenic
930049251 2:47201609-47201631 CATGTGAGCAGATCAGCAGAGGG - Intergenic
931231661 2:60380277-60380299 AATGTGAGGAGAACAGCAGCTGG - Intergenic
932340739 2:70961300-70961322 GAGGTGGGCAGAGCAGCAGCTGG + Intronic
932578317 2:72975172-72975194 GATGTGAGAACATCTGCAGCAGG - Intronic
933415285 2:81979443-81979465 GATGTGAGCAGAGTAGCAAAAGG + Intergenic
934169292 2:89326051-89326073 TCTGTGAGCAGATCAGCTTCAGG - Intergenic
934198002 2:89856533-89856555 TCTGTGAGCAGATCAGCTTCAGG + Intergenic
936083889 2:109453457-109453479 TGTGTGAGCACATCAGCACCAGG + Intronic
940810312 2:158235540-158235562 CATACCAGCAGATCAGCAGCTGG - Intronic
942421007 2:175807734-175807756 GAGGTGAGCAAGTCACCAGCAGG - Intergenic
945012180 2:205477232-205477254 GTTGTGAGCAGATAAGCACAAGG + Intronic
946016379 2:216607222-216607244 GAGGTGAACAGTTCAGCTGCTGG + Intergenic
946861375 2:224003019-224003041 GATGCGAGCAGATGAGGGGCCGG + Intronic
947581714 2:231323938-231323960 GTTGTGAGCAGGTCAGCTGCGGG + Intronic
948521198 2:238539255-238539277 GATGTGAGCACTGCAGCAGGAGG - Intergenic
948521708 2:238543277-238543299 GATGTGAGCACTGCACCAGCAGG - Intergenic
948522813 2:238551410-238551432 GGTGTGAGCACATCATCAGAAGG - Intergenic
1169503567 20:6184630-6184652 GAGTTGGGCAGCTCAGCAGCTGG + Intergenic
1169552313 20:6713710-6713732 GATGAGAGGTGATCAGGAGCAGG + Intergenic
1170621170 20:17997511-17997533 GACTTGAGCAGATCATCAGTGGG - Intronic
1171329810 20:24327635-24327657 GAGGTGAGCAAAACACCAGCTGG - Intergenic
1172022458 20:31924214-31924236 GAAGTGGGCAGAGCAGCGGCAGG - Intronic
1173024500 20:39295494-39295516 GATGTCAGCAGAGGGGCAGCTGG + Intergenic
1173877011 20:46379424-46379446 GAGGAGAGCAGAGCAGGAGCTGG - Intronic
1174036604 20:47672418-47672440 TAGGGGAGCAGATGAGCAGCTGG - Intronic
1175254782 20:57634655-57634677 GAAGTGAGAAGATCCCCAGCTGG + Intergenic
1178983147 21:37282092-37282114 GAGGTGAGCAGCTGAGCAGCAGG + Intergenic
1179155598 21:38848430-38848452 GATGTGAGCAGATAGGTTGCAGG - Intergenic
1180096892 21:45559970-45559992 CATGTGAACAGACCACCAGCAGG + Intergenic
1181178778 22:21053069-21053091 GGCGTGTGCAGAGCAGCAGCAGG - Intronic
1184347245 22:43921498-43921520 GATGTGGGCAGGACAGGAGCAGG - Intergenic
1184397821 22:44255081-44255103 GATGTGGGCAGACCAGCAAAGGG - Intronic
954380042 3:50214481-50214503 GACGTGAGCAGGGCAGCAACGGG + Exonic
959944064 3:112109263-112109285 GTGGTGAGAATATCAGCAGCTGG - Intronic
961008333 3:123419808-123419830 GAGGGGAGCTGAGCAGCAGCTGG - Intronic
963546385 3:146663951-146663973 GATGAGAGGAGATCAGGAGGGGG + Intergenic
965208965 3:165759878-165759900 GCTTTGAGCAGATGAGCAACAGG - Intergenic
965387991 3:168069062-168069084 GAGGTGAGCAGATCACCATCAGG - Intronic
968292264 3:197547840-197547862 GATGAGGGCAGAGCAGGAGCCGG - Intronic
969063474 4:4458515-4458537 GTTGTGAGCACAACAGCATCTGG + Intronic
970934598 4:21554287-21554309 CAAGTGAGCAGGCCAGCAGCAGG + Intronic
971801653 4:31300744-31300766 GAGTTGAGCAGAAGAGCAGCTGG - Intergenic
972215373 4:36891592-36891614 GATCTGAGTAGATCTGCAGGAGG - Intergenic
972878026 4:43388916-43388938 GATGTGAGCAGGGGCGCAGCTGG + Intergenic
972969833 4:44559748-44559770 GTTGTCAGCATATCAGCAGGTGG + Intergenic
973755513 4:54069604-54069626 GATGAGAGCTGATCACCAGAAGG - Intronic
974224111 4:59017027-59017049 GATGTGAGAAAAATAGCAGCAGG - Intergenic
975544586 4:75548093-75548115 GAGGTGAGCAGATGAGCCGGTGG - Intronic
981640953 4:146943267-146943289 GATCTGAGAACATTAGCAGCAGG + Intronic
982711082 4:158759417-158759439 GAGGAGGGCAGATCAGGAGCTGG - Intergenic
985649605 5:1101267-1101289 GCTGTGAGCAGAGCTGCTGCTGG - Intronic
986184179 5:5421342-5421364 GAAGTGAGCAGATCCATAGCGGG - Intronic
986185319 5:5430363-5430385 GATTTGAGCTGATATGCAGCAGG + Intronic
988567270 5:32329463-32329485 GCTTTGAGTAGATCAGCAGATGG + Intergenic
991333625 5:65521831-65521853 GATGTGGGCAGATCACCTGAGGG - Intronic
991958611 5:72020058-72020080 GATCTGAGCTGGGCAGCAGCTGG - Intergenic
996796542 5:127354115-127354137 GCTGTGGGCAGATAAGGAGCTGG + Intronic
998057195 5:139088160-139088182 ATTGTGGGCAGAACAGCAGCAGG - Intronic
1000652987 5:163840459-163840481 GAAGTGGGCAGATCACCAGTTGG + Intergenic
1001156427 5:169276270-169276292 GCTGTGAGCAGAGTCGCAGCTGG - Intronic
1001644332 5:173269098-173269120 GGTGTCAGCAGAACAGCAGGTGG - Intergenic
1002921054 6:1573751-1573773 CAGGTGAGCAGAGCAGGAGCAGG + Intergenic
1004700312 6:18072862-18072884 GATGAGAGCTCACCAGCAGCTGG - Intergenic
1005354828 6:24972366-24972388 GATGTGAACTGACCAGGAGCAGG - Intronic
1006880154 6:37332192-37332214 GAAGTGAGTAGCTGAGCAGCTGG + Exonic
1007627118 6:43252944-43252966 GAGGTGATAAGATCAGAAGCTGG + Intronic
1008052751 6:46916482-46916504 GCTCTGAGCACATCAGCAGCAGG - Intronic
1008421344 6:51303174-51303196 CAGGTGGGCAGAGCAGCAGCTGG + Intergenic
1009380364 6:63020530-63020552 GATGAGGGATGATCAGCAGCAGG + Intergenic
1009436419 6:63623309-63623331 GATTAGCGCAGAACAGCAGCTGG - Intergenic
1010374697 6:75153669-75153691 GATCTGGGCAGAGCAGGAGCAGG - Intronic
1011141910 6:84167534-84167556 ATTGTGAGCAAATCATCAGCTGG + Intronic
1011907632 6:92392148-92392170 CAAGTCAGCAGATCAGCAGATGG + Intergenic
1016690510 6:146932525-146932547 GCTGTGAGTAGCACAGCAGCAGG - Intergenic
1016986565 6:149900031-149900053 GACGTGGGCAGTTGAGCAGCTGG - Intergenic
1017031037 6:150222172-150222194 GATGTGACTAGATCAGCACCCGG - Intronic
1017857027 6:158358883-158358905 GGTGTGAGAAGACCAGCAGCTGG + Intronic
1018067233 6:160132620-160132642 GCTGTGAGCACATCAGCATGGGG - Intronic
1023927678 7:44681863-44681885 GATGTGAGCAGCAAAGCCGCAGG - Intronic
1030334232 7:108307189-108307211 CATGTGAGCGAAGCAGCAGCCGG + Intronic
1030344412 7:108416114-108416136 GATGGGCTCACATCAGCAGCTGG - Intronic
1031624280 7:123974423-123974445 GATGTGAGCAGATCATCCACGGG - Intergenic
1031888154 7:127262133-127262155 GCTGTGCCCAGAACAGCAGCTGG + Intergenic
1031984570 7:128155221-128155243 GATGTTCTCACATCAGCAGCTGG + Intergenic
1032704945 7:134413530-134413552 GAGGTGGGAAGATCAGCTGCAGG + Intergenic
1033253776 7:139781533-139781555 GATGAAAGCAGAAAAGCAGCTGG + Intronic
1035024719 7:155818060-155818082 GAAGTGGGCAGAGCAGAAGCGGG - Intergenic
1035595117 8:851650-851672 GATCTGAGCAATTCGGCAGCTGG - Intergenic
1037768541 8:21786108-21786130 GGTGAGAGCAGAAGAGCAGCAGG - Intronic
1038269008 8:26060307-26060329 GATGTGAGCTGACCAGGAGAAGG + Intergenic
1039851522 8:41370089-41370111 GATGTGATCATATCAGCAAGGGG + Intergenic
1041650375 8:60296347-60296369 GGGGTGAGCACATCAGCACCAGG + Intergenic
1043563681 8:81523935-81523957 GATGTGAGCAGCTCTACTGCAGG - Intergenic
1044543938 8:93438002-93438024 AATGTGATTAGAACAGCAGCTGG - Intergenic
1045217609 8:100163722-100163744 GATGTTATCACATCAGCATCTGG - Intronic
1046941211 8:119933256-119933278 GAGGTGGGCAGATCACCAGAGGG + Intronic
1048493041 8:134912347-134912369 GAAGTGGGCAGAACAGCAGGTGG + Intergenic
1049168228 8:141140363-141140385 CGTGTGAGCAGCTCAGCACCAGG + Intronic
1049463637 8:142741324-142741346 GCTGGGAGCAGTGCAGCAGCAGG - Intronic
1049575547 8:143388192-143388214 GGGGTGAGCAGGTCACCAGCTGG + Intergenic
1049758014 8:144319377-144319399 GATGTGAGCAGATCAGCAGCTGG - Intronic
1052495660 9:29220390-29220412 TATGTGAGTTCATCAGCAGCTGG - Intergenic
1053436611 9:38079656-38079678 GATGTGGAGAGAACAGCAGCTGG - Intergenic
1055224975 9:73984726-73984748 GGTGTGTTCAGGTCAGCAGCAGG + Intergenic
1056299800 9:85229234-85229256 CATGTGAGGAGCTCTGCAGCAGG + Intergenic
1056813015 9:89778821-89778843 GATTTGAGCACAGCAGAAGCGGG + Intergenic
1060391650 9:123282733-123282755 GCTGTGAGCTTCTCAGCAGCAGG + Intergenic
1060604332 9:124900297-124900319 GATGTGAGCAGGCCAGCAGCAGG - Intronic
1060863111 9:126972620-126972642 TATGTCTGCAAATCAGCAGCTGG - Intronic
1061572747 9:131487792-131487814 GGTGGGACCAGATCCGCAGCTGG + Intronic
1062049973 9:134442231-134442253 CATGTGCGCAGATGTGCAGCAGG - Intergenic
1186019530 X:5238363-5238385 CATGTGAGAAGAACAGCATCTGG - Intergenic
1186441573 X:9591569-9591591 GGTGTGTGCAGAGCATCAGCTGG + Intronic
1189125359 X:38439708-38439730 TATGTGAGCAGAGGAGAAGCTGG + Intronic
1191075461 X:56448541-56448563 GATGGGAACAGATGAGCAGGTGG + Intergenic
1192389397 X:70709893-70709915 GAAGAGAGGAGAGCAGCAGCAGG - Intronic
1195310485 X:103627790-103627812 GATGTGAGTAGATGAGAGGCAGG + Intronic
1196121724 X:112058428-112058450 GGTGTGAGCAGATAAGCTGGGGG + Intronic
1198562976 X:137871341-137871363 GCTGTGAGCACAGCAGCAGAGGG - Intergenic
1201308836 Y:12576185-12576207 AATGTGAGGACATCAGCAGTGGG - Intergenic