ID: 1049759096

View in Genome Browser
Species Human (GRCh38)
Location 8:144323847-144323869
Sequence AGGGCCAAGCACAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049759088_1049759096 7 Left 1049759088 8:144323817-144323839 CCACACTTGGGGCCCACACAGTG 0: 1
1: 0
2: 0
3: 20
4: 248
Right 1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG No data
1049759086_1049759096 17 Left 1049759086 8:144323807-144323829 CCAGTGAGTCCCACACTTGGGGC 0: 1
1: 0
2: 1
3: 16
4: 248
Right 1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG No data
1049759084_1049759096 18 Left 1049759084 8:144323806-144323828 CCCAGTGAGTCCCACACTTGGGG 0: 1
1: 0
2: 2
3: 10
4: 200
Right 1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG No data
1049759087_1049759096 8 Left 1049759087 8:144323816-144323838 CCCACACTTGGGGCCCACACAGT 0: 1
1: 0
2: 0
3: 6
4: 131
Right 1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG No data
1049759092_1049759096 -6 Left 1049759092 8:144323830-144323852 CCACACAGTGCAGCTCCAGGGCC 0: 1
1: 0
2: 5
3: 58
4: 401
Right 1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG No data
1049759091_1049759096 -5 Left 1049759091 8:144323829-144323851 CCCACACAGTGCAGCTCCAGGGC 0: 1
1: 0
2: 6
3: 28
4: 278
Right 1049759096 8:144323847-144323869 AGGGCCAAGCACAATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049759096 Original CRISPR AGGGCCAAGCACAATGAGGA GGG Intronic
No off target data available for this crispr