ID: 1049759144

View in Genome Browser
Species Human (GRCh38)
Location 8:144324051-144324073
Sequence CTGCTCACAGGCACCCCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 216}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049759144_1049759151 7 Left 1049759144 8:144324051-144324073 CCGACTGGGGTGCCTGTGAGCAG 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1049759151 8:144324081-144324103 GTGGGTGTGTGCAAAGAGCCTGG No data
1049759144_1049759152 11 Left 1049759144 8:144324051-144324073 CCGACTGGGGTGCCTGTGAGCAG 0: 1
1: 0
2: 0
3: 19
4: 216
Right 1049759152 8:144324085-144324107 GTGTGTGCAAAGAGCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049759144 Original CRISPR CTGCTCACAGGCACCCCAGT CGG (reversed) Intronic
900241450 1:1619457-1619479 CTGCACACTGGCACCGCAGAAGG + Intronic
900618763 1:3577439-3577461 CAGCTCACAAGCAGCCTAGTTGG - Intronic
902508355 1:16952559-16952581 CTGCCCTCAGGCTCCCCAGGTGG + Intronic
903926358 1:26833571-26833593 GTGCTCCCAGGCAGCCCAGGTGG + Intronic
904607424 1:31705368-31705390 CTCCTCACTGGGACCACAGTGGG - Intergenic
904708918 1:32413749-32413771 CTGCTTCCAACCACCCCAGTGGG + Intergenic
905459351 1:38112276-38112298 CTGCTCTCGGGCACTGCAGTTGG - Intergenic
905468669 1:38175481-38175503 CCGCTCACAGCCTGCCCAGTGGG + Intergenic
906349583 1:45046541-45046563 CTGTTAACAGGCATCTCAGTAGG - Intronic
907098043 1:51799779-51799801 CTGCTCACAGGCAACCCCCTTGG - Intronic
908326560 1:63029110-63029132 CTGCTCACCTGCACCCCAGCTGG - Intergenic
913170822 1:116230627-116230649 GTACTTACAGGCACTCCAGTTGG - Intergenic
915585976 1:156844229-156844251 CTCCTCACTGCCACCCCTGTGGG - Exonic
915594546 1:156888623-156888645 CTGCACACACTCACCCCAGCAGG - Intergenic
916215290 1:162388551-162388573 ATGCTGGCAGGGACCCCAGTTGG + Intergenic
916824473 1:168430646-168430668 CTCCTCTCTGCCACCCCAGTTGG - Intergenic
920949158 1:210556470-210556492 CTGCTCACCTGAACCCCAGGGGG + Intronic
923040910 1:230319205-230319227 CTCCTCACAGGGATCCCTGTGGG - Intergenic
924623969 1:245685282-245685304 CTACTGACAGCCACCCCCGTTGG - Intronic
1065682464 10:28250835-28250857 TTGCTCACAGGCTCCTCATTAGG - Intronic
1066708232 10:38203920-38203942 CTCCTCACAGCCACCACAGCTGG - Intergenic
1066981271 10:42418663-42418685 CTCCTCACAGCCACCACAGCTGG + Intergenic
1067090278 10:43262855-43262877 CTGCTCACTGCCACCTCTGTGGG - Intronic
1067275303 10:44828498-44828520 CTGCTCACAGTCTCCACAGGAGG + Intergenic
1067527910 10:47049406-47049428 CTCCACTCAGGCAACCCAGTTGG - Intergenic
1068724984 10:60290760-60290782 CTGTGCACAGACACCCCAGCAGG - Intronic
1071347564 10:84707271-84707293 CTGGTCACAGCCACCAGAGTGGG - Intergenic
1071404567 10:85317786-85317808 ATGATCACAGTCACCTCAGTTGG + Intergenic
1071693242 10:87844531-87844553 GTTCTCCCAGGAACCCCAGTTGG + Intergenic
1071699254 10:87912030-87912052 CTGGTCTCAGCCTCCCCAGTAGG + Intronic
1072133723 10:92522791-92522813 ATTCTCACAGTAACCCCAGTAGG - Intronic
1073420283 10:103418884-103418906 GTGCTCCCAAGCACCCCACTGGG - Intronic
1073471693 10:103726430-103726452 CTGCCCACAGGCACCCACGGAGG + Intronic
1074475879 10:113773810-113773832 ATGCTCACAGGCAGCCCAAGTGG - Intronic
1076495560 10:130895345-130895367 CTGCTCACAGGTCCTCCAGGAGG - Intergenic
1076945732 10:133648516-133648538 CTGCTCACAAGCAGGCCAGGTGG + Intergenic
1077463590 11:2722972-2722994 CTGCCCCGAGGCACCCCAGGTGG - Intronic
1083002239 11:59303221-59303243 CTGCCCAGATGCACCCCAGATGG + Intergenic
1084032232 11:66487778-66487800 CTGCTCCCAGCCAACCCAGAAGG + Intronic
1084470542 11:69356726-69356748 CTGCCCAGGAGCACCCCAGTGGG + Intronic
1084870779 11:72097425-72097447 GTGCTCACATGCACCTCACTAGG - Exonic
1084946047 11:72639113-72639135 CTGCTGGGAGGCAGCCCAGTAGG + Intronic
1086158444 11:83694302-83694324 CTGAACACAGGCAGCCCTGTAGG - Intronic
1088326799 11:108609129-108609151 CTCTTCACACCCACCCCAGTGGG + Intergenic
1089280383 11:117370195-117370217 CTTCTCAGAGGGACCCAAGTCGG + Intronic
1089295562 11:117465170-117465192 ATGCTCACAGGCACCCAAGAAGG - Exonic
1089508189 11:118979072-118979094 CTCCTCTCAGCCACCCCAGAAGG + Exonic
1089715413 11:120354123-120354145 CTTCTCACAGGCATCTCTGTGGG - Intronic
1091001180 11:131911557-131911579 CTGCGCACGGGCACTCCTGTGGG - Exonic
1091108267 11:132942995-132943017 CTGCGCACGGGCACTCCTGTGGG + Exonic
1091552561 12:1547563-1547585 TGGCTAACAGTCACCCCAGTGGG - Intronic
1091589840 12:1836532-1836554 CTGCTTACTGGGACCCCAGGCGG + Exonic
1094348510 12:29497771-29497793 CTGCCCATAGGCACCGCAGGAGG - Intergenic
1096260627 12:50088036-50088058 CTGCTCGCAGGCAAGCTAGTTGG + Intronic
1099113063 12:78586947-78586969 CTGTCCTCAGGCCCCCCAGTGGG + Intergenic
1100474794 12:94925321-94925343 CTGTTCCCAGTGACCCCAGTGGG + Intronic
1104025022 12:125019429-125019451 ATGCTCAGAGGAACCCCAGGAGG + Intronic
1104478779 12:129089733-129089755 GTGTTCACAGCCACCCCAGCAGG + Intronic
1104864293 12:131943601-131943623 CTGCTCAGAGGCACTCTGGTGGG - Exonic
1106084256 13:26526221-26526243 CTCCTCACAGGGACAGCAGTGGG - Intergenic
1109228114 13:59721832-59721854 CTGGACACAAGCAACCCAGTGGG - Intronic
1113362895 13:109647513-109647535 GTGCACATAGTCACCCCAGTAGG + Intergenic
1113765264 13:112877183-112877205 CTGCACAGAGGCCCCTCAGTGGG - Intronic
1119621320 14:76134123-76134145 CTGGGCAGGGGCACCCCAGTGGG - Intergenic
1120019082 14:79507902-79507924 CTGGGCCCAGGCATCCCAGTAGG - Intronic
1122698335 14:103569533-103569555 CTGCTCACAGGCTCCCCATCAGG - Intronic
1122909131 14:104818196-104818218 ATTCTCAGAGGCTCCCCAGTAGG + Intergenic
1202919837 14_KI270723v1_random:21109-21131 CTGCTCACAAGCAGGCCAGGTGG + Intergenic
1202925080 14_KI270724v1_random:16529-16551 CTGCTCACAAGCAGGCCAGGTGG - Intergenic
1124142342 15:27088441-27088463 CGGCACACAGCCTCCCCAGTTGG - Intronic
1126665818 15:51075593-51075615 CTGCTAACAAGGACACCAGTAGG + Intronic
1129221690 15:74135027-74135049 CTGCTCCCAGGCACCCTAGGTGG - Exonic
1129244223 15:74269969-74269991 TTGCTCACAGGCTCCCCAGCAGG - Intronic
1129376684 15:75138161-75138183 CTCCGCATAGGCACCCCAGAAGG - Intergenic
1129656559 15:77528700-77528722 CTTCTCACAGTCTCCCCAGCAGG - Intergenic
1132670476 16:1100427-1100449 CAGCTCACAGGTGTCCCAGTGGG + Intergenic
1132739358 16:1403785-1403807 CTGCTTTCAGGGACCCCAGGAGG + Intronic
1132828703 16:1917423-1917445 CTGCGCACAGGAACCCTTGTTGG - Intronic
1133297674 16:4762831-4762853 CTCATCTCAGGCACCCCAGCCGG + Intronic
1134221207 16:12355733-12355755 CTGCCCACATGCAACCCATTTGG - Intronic
1136074462 16:27807281-27807303 CTCCCCACAGGCTTCCCAGTCGG - Intronic
1136427660 16:30180031-30180053 CTCCTCACAGGCACTCCATGAGG - Intergenic
1138139523 16:54556387-54556409 ATGCTCACAACCACCCCAGGAGG - Intergenic
1138857586 16:60713053-60713075 CTCGTGACAGGCTCCCCAGTAGG - Intergenic
1139548399 16:67660372-67660394 CTGCACACAGGCCCCCGAGCAGG - Exonic
1140133861 16:72187913-72187935 CTGCTCACAGCCACATCTGTGGG - Intergenic
1140378913 16:74468906-74468928 CTGCTCCCAGAAACCACAGTGGG - Intronic
1140770024 16:78195047-78195069 CTGCTAACTGGGACCCCAGTGGG + Intronic
1142065481 16:88059936-88059958 CTGCACACACACACCCCAGGAGG + Intronic
1142260806 16:89041752-89041774 GTGCTCACAGGCACCCACGGGGG - Intergenic
1142385156 16:89759382-89759404 CTACTCACAGGCCCACCAGAAGG + Intronic
1143376415 17:6470214-6470236 CTGCCCACAGCCACCCCAAGGGG - Intronic
1143377663 17:6476963-6476985 CTGGTCACAGCCCTCCCAGTTGG + Intronic
1146273618 17:31500306-31500328 CTGCTCAGAGGGACGCCAGCTGG - Intronic
1147325033 17:39666026-39666048 TTGCTGACAGGCACCACAGGGGG - Exonic
1150848958 17:68686709-68686731 CTCCCCACAGCCACCCCACTGGG + Intergenic
1152650507 17:81490382-81490404 CTGGTCAGGGGCCCCCCAGTTGG + Intergenic
1153620812 18:6975743-6975765 CTTCTCACAGGCATTCCATTTGG + Intronic
1154073782 18:11179288-11179310 CAGCTCACAGGAATCCCAGGAGG + Intergenic
1155114475 18:22751190-22751212 CTACTCAGAGGCACCCCTTTGGG + Intergenic
1156473656 18:37392789-37392811 CAGCTCAAAGTCACCTCAGTAGG + Intronic
1157077642 18:44482999-44483021 CTGCTCACAGGCACATCCCTTGG - Intergenic
1159190524 18:65036110-65036132 TTTCTCACATGCATCCCAGTGGG + Intergenic
1160622783 18:80182207-80182229 CTCGTCAAAGGCAGCCCAGTTGG - Intronic
1161071090 19:2261520-2261542 ATGCTCACAAGGACCCCAGGAGG - Intronic
1163153723 19:15429074-15429096 GTGCCCACAGGCAGCCCAGGAGG + Intronic
1163850274 19:19659065-19659087 CTGCTGGCAGGAACCCCAGAGGG - Intronic
1164607770 19:29612408-29612430 CTCCACACAGGGACCCCTGTTGG + Intronic
1164831078 19:31321316-31321338 CTGCTCACTGGCCCGCCAATCGG + Intronic
1165895969 19:39141132-39141154 CTGCTGACAGGGACCCCAGGAGG - Intronic
1166756734 19:45197031-45197053 CTGGGCACAGGGACCCAAGTGGG + Intronic
927199048 2:20567357-20567379 CTGGCCTCAGGCAGCCCAGTAGG - Intronic
927857573 2:26537015-26537037 CTGCTCCTGGGCACCCCTGTGGG + Intronic
927949773 2:27159515-27159537 CAGCTGACAGGCAGCCCTGTGGG - Intergenic
929364437 2:41135871-41135893 CTGCTCACAGGAACAGTAGTTGG - Intergenic
933665277 2:84959857-84959879 CTGCCCAAGGGCAGCCCAGTGGG + Intergenic
934563487 2:95325167-95325189 CAGCTCTCAGCCACCCGAGTTGG - Intronic
934575903 2:95401508-95401530 CTGATCACAGCCACCCCCATAGG + Intergenic
934638025 2:96009065-96009087 CTGATCACAGCCACCCCCATAGG + Intergenic
934795629 2:97096348-97096370 CTGATCACAGCCACCCCCATAGG - Intergenic
935480494 2:103582082-103582104 ATGCACACATGCACACCAGTGGG - Intergenic
936151863 2:110026099-110026121 ATGCCCACAGGGATCCCAGTTGG - Intergenic
936192811 2:110345270-110345292 ATGCCCACAGGGATCCCAGTTGG + Intergenic
937223928 2:120357418-120357440 CTCCTCACAGGAACCACAGAAGG + Intergenic
937909869 2:127070252-127070274 ATCCTCACAGTCACCCCAATAGG - Intronic
937984819 2:127633665-127633687 CTGCTCTCCTGCACCCCAGATGG - Intronic
940792206 2:158041055-158041077 CTGCTCACAGCCACCCTGTTAGG - Intronic
941520098 2:166531518-166531540 CTGTTGACAGGCACGCAAGTTGG - Intergenic
942319772 2:174726149-174726171 CTGCCCACAGGCTGGCCAGTTGG - Intergenic
945684591 2:212953707-212953729 CAACTCACAGGCTCCCCTGTGGG - Intergenic
947511572 2:230759296-230759318 CTCCTCCTAAGCACCCCAGTGGG - Intronic
947613373 2:231537890-231537912 CTGCTCCCAGACCCTCCAGTGGG + Intergenic
948423492 2:237874481-237874503 CTGCTCACACCAGCCCCAGTTGG + Intronic
948588717 2:239036450-239036472 AGGCTCACAGGCACCACAGTGGG + Intergenic
1170574433 20:17651956-17651978 CTGCTGACAGGTGCCCCAGAGGG - Intronic
1170737659 20:19025603-19025625 CTGCTCACATGGACCACATTTGG - Intergenic
1174114481 20:48217670-48217692 CTGCCCAGAGACACCCAAGTAGG + Intergenic
1175888113 20:62303480-62303502 CTGCTCGCAAACACCCCAGGGGG + Intronic
1176097960 20:63352908-63352930 CTCCTCAAAGGCTCCCCAGAGGG - Intronic
1176382714 21:6121183-6121205 CTGCTCCCAGGCCCCCCAGCCGG + Exonic
1178922988 21:36751549-36751571 CTGTGCACCCGCACCCCAGTCGG + Exonic
1179085005 21:38208139-38208161 CAGCTCACATGGACCCAAGTTGG + Intronic
1179740755 21:43417056-43417078 CTGCTCCCAGGCCCCCCAGCCGG - Exonic
1179896688 21:44367118-44367140 CAGCCCACAGGCAAGCCAGTGGG - Intronic
1179904764 21:44416812-44416834 CTGCTCTCTGGCATCACAGTGGG + Intronic
1179904780 21:44416930-44416952 CTGCTCTCTGGCATCACAGTGGG + Intronic
1179904790 21:44417008-44417030 CTGCTCTCTGGCATCACAGTGGG + Intronic
1179904808 21:44417126-44417148 CTGCTCTCTGGCATCACAGTGGG + Intronic
1179904820 21:44417204-44417226 CTGCTCTCTGGCATCACAGTGGG + Intronic
1179904830 21:44417282-44417304 CTGCTCTCTGGCATCACAGTGGG + Intronic
1179904836 21:44417320-44417342 CTGCTCTCTGGCATCACAGTGGG + Intronic
1179904842 21:44417358-44417380 CTGCTCTCTGGCATCACAGTGGG + Intronic
1179904858 21:44417474-44417496 CTGCTCTCTGGCATCACAGTGGG + Intronic
1179904870 21:44417552-44417574 CTGCTCTCTGGCATCACAGTGGG + Intronic
1179904882 21:44417630-44417652 CTGCTCTCTGGCATCACAGTGGG + Intronic
1181958796 22:26608003-26608025 CTGCTCAAAGGCGACCCAGCTGG + Exonic
1182009433 22:26988002-26988024 CTTCTCAAATGCACACCAGTAGG - Intergenic
1183498334 22:38163196-38163218 CTGCCCACAGGCTCCCCACAGGG + Intronic
1184552720 22:45213123-45213145 GCGCTCACAGGCAGGCCAGTGGG + Intronic
1185154089 22:49182893-49182915 CTGCTCAGAGGCACGCCCCTTGG - Intergenic
949437728 3:4047537-4047559 ATGCCCTCAGGCAGCCCAGTGGG + Intronic
950295354 3:11824956-11824978 CTCCCCACACCCACCCCAGTGGG - Intronic
950630646 3:14279556-14279578 CAGCTCACAGGCTCCCCCATGGG - Intergenic
952971389 3:38652478-38652500 CTCCACACAGGCACCCCTCTAGG + Intergenic
954840722 3:53509135-53509157 CAGCCCACAGGAACCCCAGCTGG - Intronic
957081748 3:75641954-75641976 CTGCTCACAAGCAGGCCAGGTGG - Intergenic
959691934 3:109207094-109207116 CTGCTGACTGGCAGCTCAGTTGG - Intergenic
961068698 3:123899677-123899699 CTGATGACAGGAAGCCCAGTTGG - Intronic
961257819 3:125571881-125571903 CTACTCAGTGGTACCCCAGTAGG - Intronic
961397817 3:126609376-126609398 CTGCTGACGGGCACTCCAGAGGG + Intronic
961543459 3:127616458-127616480 CTGCGCACAGGCACAGCACTGGG - Intronic
964057361 3:152477707-152477729 CTGCTCTCATGCACCCCTCTAGG + Intergenic
965603468 3:170477132-170477154 CTGCTCAGAGGCACCCTGGTGGG + Intronic
966433872 3:179861498-179861520 CTGACCACAGACACCCCTGTAGG - Intronic
968191394 3:196670408-196670430 CTGCACACTGCTACCCCAGTGGG + Intronic
968503970 4:963555-963577 CTGTTCACACGCAGCTCAGTGGG - Intronic
968730931 4:2268872-2268894 CTCCTCACAGGCACCCACGGTGG - Intergenic
969931835 4:10638151-10638173 GTTCTCACAGGCACCCCTGTGGG - Intronic
973169579 4:47122771-47122793 AGGCTCACAGGAACCACAGTGGG + Intronic
981562950 4:146067021-146067043 CTACTAAGAGGCACCCAAGTAGG - Intergenic
982562113 4:156942212-156942234 GTGCTCACAGGCGCTCCAGAAGG + Intronic
985449121 4:190049027-190049049 CTGCTCACAAGCAGGCCAGGTGG + Intergenic
985636434 5:1038035-1038057 CTGCTGGCTGGCACCCCAGGCGG - Exonic
985667166 5:1187233-1187255 CTGCTCACAGCCAGCCAAGGCGG - Intergenic
989459595 5:41682248-41682270 ATTCTCACAGCCACCACAGTAGG + Intergenic
993525575 5:88961646-88961668 CTGCTCCCAGCCAACCAAGTAGG - Intergenic
997476361 5:134144774-134144796 CTGCTCACAGCCATGCCAGAGGG - Intronic
1001045147 5:168365675-168365697 CAGCACACAGGCACACCTGTCGG - Intronic
1002419488 5:179138182-179138204 CTCCCCACAGGAACCCCAGGAGG - Intronic
1003073207 6:2960653-2960675 CTCCTCACAGGGCCTCCAGTAGG - Exonic
1004165598 6:13253935-13253957 CTGCACCCAGCCACCCCAGTTGG - Intronic
1005738868 6:28773015-28773037 CTGCTGACAGTCATCCCAGGTGG + Intergenic
1006575912 6:35045751-35045773 CTCCTCACAAGCACCCTGGTGGG - Intronic
1006628316 6:35413181-35413203 CTGCTCCCAGGCACCTCACCTGG - Intronic
1007323895 6:41045880-41045902 CAGGTCACAGGCACCCCAGGAGG + Intronic
1008644547 6:53500627-53500649 CTGCTCAAATGCTTCCCAGTGGG + Intronic
1011366141 6:86584683-86584705 CAGCTCTCAGGCAGCCCAGAAGG + Intergenic
1017294364 6:152776872-152776894 CTGCCCACCAGCACCCCAGTGGG - Intergenic
1017750680 6:157488025-157488047 CTACTCACATGCAGCCCAGGTGG + Intronic
1019995667 7:4722880-4722902 CTGCCCACAGGCACCTCACCTGG - Intronic
1023665982 7:42523931-42523953 CTGCTTGCATGCACACCAGTGGG + Intergenic
1024928308 7:54641576-54641598 CAGCTCTCAGGAACACCAGTGGG - Intergenic
1027220277 7:76209557-76209579 CTGATAATAGGCAGCCCAGTGGG + Intronic
1028284612 7:88981075-88981097 CTTCTCATAGCCACCACAGTAGG + Intronic
1029571237 7:101371016-101371038 CTGCTCAGAGCCACTCCTGTAGG - Intronic
1030324461 7:108204670-108204692 CTGCTCTGAGGCACACCAGAGGG + Intronic
1032854469 7:135822851-135822873 CTGCTCATAGGCCCCACTGTGGG + Intergenic
1034337667 7:150333849-150333871 CTGCAAACAGGTAGCCCAGTAGG - Intronic
1034452439 7:151144182-151144204 CTCCTCACAGGCACCTCCGAAGG - Exonic
1036273889 8:7333625-7333647 CTGCCTCCAGGCACCCGAGTTGG + Intergenic
1036347457 8:7976725-7976747 CTGCCTCCAGGCACCCGAGTTGG - Intergenic
1036842763 8:12137500-12137522 CTGCCTCCAGGCACCCGAGTTGG - Exonic
1037832040 8:22195483-22195505 CTGCTCACAGCCCCCGCGGTTGG - Exonic
1041230096 8:55741600-55741622 CTGCTCACTGCCTACCCAGTGGG - Intronic
1043442215 8:80286247-80286269 CTGCTCACAAACACTCCAGCTGG + Intergenic
1043590002 8:81820099-81820121 ATGCTAACAGGCATCCCAGCAGG + Intronic
1045254463 8:100508147-100508169 CTGCCCACATGAACCTCAGTGGG - Intergenic
1045696354 8:104812986-104813008 GTGCTCCACGGCACCCCAGTGGG - Intronic
1047585620 8:126268894-126268916 AACCTCACAGGCATCCCAGTGGG + Intergenic
1049070138 8:140349583-140349605 CTGCACACAGGGAAGCCAGTGGG + Intronic
1049196716 8:141319920-141319942 CATCTCCCAGGCAGCCCAGTTGG + Intergenic
1049759144 8:144324051-144324073 CTGCTCACAGGCACCCCAGTCGG - Intronic
1057644437 9:96859693-96859715 CTCCTCACAGACACCACAGCTGG - Intronic
1059309377 9:113377500-113377522 CTGGTCTCAGGGTCCCCAGTTGG + Intergenic
1059343738 9:113614703-113614725 CTGGATCCAGGCACCCCAGTGGG + Intergenic
1059426999 9:114227522-114227544 CTGCTCACAGTAACCCCAGGAGG - Intronic
1059670351 9:116485204-116485226 TGGCTCACAGGGACCCCAGGAGG - Intronic
1060786075 9:126452427-126452449 CAGCTCCCAGGCAACCCCGTGGG - Intronic
1060992480 9:127856952-127856974 ATCCTCACAGCCACCCCAGGAGG + Intergenic
1062125410 9:134858090-134858112 CTGCTCACTGCCACCCCACTTGG + Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1187396630 X:18924874-18924896 CTGCTCACAGTGCCCCCACTTGG - Intronic
1190681609 X:52831093-52831115 CTGCTCACAGTCCCCCCAAGAGG - Intergenic
1200216966 X:154372169-154372191 ATGCCCACGGGCACGCCAGTGGG + Intronic
1201057551 Y:10011078-10011100 CAGCCCACAGCCACCACAGTGGG - Intergenic
1201283223 Y:12358788-12358810 CTGCTGACAGTCATCCCAGGTGG + Intergenic