ID: 1049759147

View in Genome Browser
Species Human (GRCh38)
Location 8:144324059-144324081
Sequence GGTGCCTGTGAGCAGAGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049759137_1049759147 2 Left 1049759137 8:144324034-144324056 CCAGAAACCGGATGGCCCCGACT No data
Right 1049759147 8:144324059-144324081 GGTGCCTGTGAGCAGAGGGCTGG No data
1049759141_1049759147 -5 Left 1049759141 8:144324041-144324063 CCGGATGGCCCCGACTGGGGTGC No data
Right 1049759147 8:144324059-144324081 GGTGCCTGTGAGCAGAGGGCTGG No data
1049759135_1049759147 13 Left 1049759135 8:144324023-144324045 CCTGGGAGAAGCCAGAAACCGGA No data
Right 1049759147 8:144324059-144324081 GGTGCCTGTGAGCAGAGGGCTGG No data
1049759133_1049759147 14 Left 1049759133 8:144324022-144324044 CCCTGGGAGAAGCCAGAAACCGG No data
Right 1049759147 8:144324059-144324081 GGTGCCTGTGAGCAGAGGGCTGG No data
1049759131_1049759147 30 Left 1049759131 8:144324006-144324028 CCTCAGGGACAAAACACCCTGGG No data
Right 1049759147 8:144324059-144324081 GGTGCCTGTGAGCAGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049759147 Original CRISPR GGTGCCTGTGAGCAGAGGGC TGG Intronic