ID: 1049759152

View in Genome Browser
Species Human (GRCh38)
Location 8:144324085-144324107
Sequence GTGTGTGCAAAGAGCCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049759142_1049759152 13 Left 1049759142 8:144324049-144324071 CCCCGACTGGGGTGCCTGTGAGC No data
Right 1049759152 8:144324085-144324107 GTGTGTGCAAAGAGCCTGGCAGG No data
1049759149_1049759152 -1 Left 1049759149 8:144324063-144324085 CCTGTGAGCAGAGGGCTGGTGGG No data
Right 1049759152 8:144324085-144324107 GTGTGTGCAAAGAGCCTGGCAGG No data
1049759141_1049759152 21 Left 1049759141 8:144324041-144324063 CCGGATGGCCCCGACTGGGGTGC No data
Right 1049759152 8:144324085-144324107 GTGTGTGCAAAGAGCCTGGCAGG No data
1049759137_1049759152 28 Left 1049759137 8:144324034-144324056 CCAGAAACCGGATGGCCCCGACT No data
Right 1049759152 8:144324085-144324107 GTGTGTGCAAAGAGCCTGGCAGG No data
1049759143_1049759152 12 Left 1049759143 8:144324050-144324072 CCCGACTGGGGTGCCTGTGAGCA No data
Right 1049759152 8:144324085-144324107 GTGTGTGCAAAGAGCCTGGCAGG No data
1049759144_1049759152 11 Left 1049759144 8:144324051-144324073 CCGACTGGGGTGCCTGTGAGCAG No data
Right 1049759152 8:144324085-144324107 GTGTGTGCAAAGAGCCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049759152 Original CRISPR GTGTGTGCAAAGAGCCTGGC AGG Intronic