ID: 1049759712

View in Genome Browser
Species Human (GRCh38)
Location 8:144326506-144326528
Sequence GGCCCCGACGTGGGAGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049759712_1049759721 16 Left 1049759712 8:144326506-144326528 CCCGCGGCTCCCACGTCGGGGCC 0: 1
1: 0
2: 1
3: 14
4: 217
Right 1049759721 8:144326545-144326567 ACCTCCTCTTCCGCCGCCGCAGG 0: 1
1: 0
2: 5
3: 31
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049759712 Original CRISPR GGCCCCGACGTGGGAGCCGC GGG (reversed) Exonic
900109363 1:999099-999121 GGCCCCGCCCTGGGGGCGGCGGG + Exonic
900369296 1:2324265-2324287 GGCCCCGAGGTGGGGTTCGCAGG - Intronic
902032543 1:13433786-13433808 GGCCCCGGTGTGGGATCCACTGG - Intergenic
903031337 1:20466320-20466342 GGCACAGAGGTGGGAGACGCGGG - Intergenic
903624590 1:24721603-24721625 GGCCCCGCACTGGGAGCCTCCGG + Intergenic
904045182 1:27604266-27604288 GGCCGCGCCGTCGGAGCAGCCGG - Intronic
904238816 1:29131083-29131105 GGCCCCGGTGTGGGATCCACTGG - Intergenic
904612438 1:31732862-31732884 GGCCCCGACCAGGGTGCCCCAGG - Intronic
906563527 1:46778787-46778809 GGCCCCGCACTGGGAGCAGCCGG - Intronic
911001441 1:93170346-93170368 GGCCCCGCACTGGGAGCGGCCGG + Intronic
912515091 1:110212067-110212089 GGCCCCCACGAGGGAGGCGCGGG + Exonic
915313857 1:155017448-155017470 GGCCCCGGGGAGGGAGCGGCGGG - Exonic
916219846 1:162433232-162433254 GGCCCCGAACTCGGAGCAGCCGG + Intergenic
916940139 1:169668432-169668454 AGCCCCGGCGTGGGATCCACTGG + Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
921096273 1:211889627-211889649 GGCCCCGCACTGGGAGCGGCAGG + Intergenic
922155712 1:223038546-223038568 GGCACACACGTGGGAGCTGCAGG - Intergenic
922894190 1:229088073-229088095 GACCCCGGCGTGGGAGGGGCTGG - Intergenic
923623242 1:235594664-235594686 GGCCCCGCACTGGGAGCGGCCGG - Intronic
1063130291 10:3172456-3172478 GGCCCCGCCGGGAGCGCCGCGGG + Intronic
1065981584 10:30903080-30903102 GGCCCCGCACTGGGAGCGGCTGG - Intronic
1067438350 10:46294363-46294385 GGCCCAGACTGGGGAGCCCCTGG + Intronic
1067582166 10:47452692-47452714 GGCCCAGACAGGGGAGCCACTGG - Intergenic
1068978118 10:63033667-63033689 GGCCCCGCCGTCGTAGCAGCCGG + Intergenic
1069280858 10:66651745-66651767 GGCCCCGCACTCGGAGCCGCAGG - Intronic
1069711057 10:70488987-70489009 GACCCCGACTTGGCTGCCGCTGG + Intronic
1069755368 10:70771507-70771529 GGCCCCCACCTGGGAGCTGCAGG + Intronic
1070312575 10:75284349-75284371 GGCCCAGAAGAGGGAGCAGCAGG + Intergenic
1070962515 10:80509166-80509188 GGCCCCGATGTGGGACTCTCAGG + Intronic
1074296803 10:112196917-112196939 GGCCCAGAAGTGAGAGCCTCTGG - Intronic
1076372711 10:129965240-129965262 GGCCCGGCCCTCGGAGCCGCCGG + Intergenic
1076852569 10:133100197-133100219 GGCCCCGGCGGAGGAGTCGCTGG + Intronic
1077214428 11:1389478-1389500 GGACCGGACGTGGCAGCCGGCGG + Intergenic
1077556414 11:3228157-3228179 AGCCCCGGGGTGGGGGCCGCTGG + Exonic
1085035395 11:73296922-73296944 GGCACAAACGTGGGGGCCGCCGG + Exonic
1087138158 11:94740645-94740667 CGCCCGGCCGGGGGAGCCGCGGG + Intronic
1088481721 11:110301181-110301203 GGCCCCGCACTTGGAGCCGCAGG - Intergenic
1090839665 11:130477081-130477103 GGCCCAGTCCTGGGGGCCGCTGG + Intergenic
1091550429 12:1531432-1531454 GTCCCCGCCGTGGGAGAGGCGGG + Intronic
1091589725 12:1836062-1836084 GGCCCCATCCTGGGAGCCTCTGG - Exonic
1092860623 12:12716886-12716908 GACCACGAGGTGGGGGCCGCTGG + Intronic
1096204168 12:49707297-49707319 GGCCCCGTCGAGGGCGCCGGGGG + Exonic
1099190218 12:79554286-79554308 GGCCCCGCACTGGGAGCGGCGGG - Intergenic
1099191472 12:79565375-79565397 GGCCCCGGTGTGGGATCCACTGG + Intergenic
1099716251 12:86296684-86296706 GGCCCCGCACTCGGAGCCGCTGG - Intronic
1102952871 12:117041918-117041940 GGCCTGGGCGTGGGAGCCTCGGG - Intronic
1103479306 12:121240929-121240951 GGCCCAGATGTGGGAGCAGCTGG - Intronic
1103760898 12:123249601-123249623 GGCCCCGACCTAGGAGTGGCCGG - Intronic
1104609657 12:130217744-130217766 GTACCTGGCGTGGGAGCCGCTGG + Intergenic
1108995996 13:56735687-56735709 GGCCCCGCACTGGGAGCGGCTGG + Intergenic
1112226585 13:97545706-97545728 GGCCCCCATGTGGGATCCACTGG + Intergenic
1113530473 13:111020738-111020760 GTCCCCCAGGTGGGAGCTGCCGG + Intergenic
1113696088 13:112346467-112346489 AGCCCCGAGGCGGGAGCTGCCGG + Intergenic
1113724404 13:112587742-112587764 GGCCCGGACGAGGGAGCGGAGGG - Intronic
1116653760 14:47626636-47626658 GGCCCCGCACTGGGAGCGGCCGG + Intronic
1117842106 14:59870606-59870628 GGCCGCGCCGGGGGATCCGCAGG - Exonic
1118306316 14:64658258-64658280 GGCCCCGCACTTGGAGCCGCCGG + Intergenic
1118740835 14:68738143-68738165 GGCTCAGACGTGGTAGCCCCAGG + Intergenic
1119618395 14:76113384-76113406 GGCCCAGACTGGGGAGCTGCAGG + Intergenic
1121645748 14:95516408-95516430 GGCCCCGGCGTGACAGCTGCGGG - Intronic
1128269302 15:66294094-66294116 GGTCCCGAGCTGGGAGCCCCCGG + Intronic
1129322356 15:74782254-74782276 GGCCCCGACGGCGGCGCAGCCGG - Exonic
1131257492 15:90871834-90871856 GGCCCCGAGGGTGGAGCTGCCGG + Intronic
1131827054 15:96330514-96330536 GGCCCCGCCATGGCGGCCGCGGG - Intronic
1131912574 15:97224326-97224348 GGCCCCGCACTTGGAGCCGCTGG + Intergenic
1132661265 16:1062528-1062550 GGCCCGGCCGTGGGAGCCGAGGG + Intergenic
1132663584 16:1072031-1072053 GGGCCCGCCGTGAGCGCCGCTGG - Intergenic
1132732884 16:1371518-1371540 GGCCACGACCTGGGAGCAGCAGG - Intronic
1135648063 16:24180920-24180942 GCCCCCGAGGTGAGAGCTGCTGG + Exonic
1136428364 16:30183781-30183803 GGCGCGCGCGTGGGAGCCGCGGG + Intronic
1137715276 16:50594757-50594779 GGCCCCCAGGTGTGAGCTGCTGG + Intronic
1138023386 16:53503756-53503778 GGGCCCGACGTGGCGGCCTCGGG - Intronic
1140354908 16:74297176-74297198 GGCCCCGAAGTGGCGGCGGCTGG - Intronic
1140506849 16:75478985-75479007 GGACCTGGCGCGGGAGCCGCTGG - Exonic
1140514017 16:75529475-75529497 GGACCTGGCGCGGGAGCCGCTGG - Exonic
1142192176 16:88723094-88723116 GGCCCCGAGGAGGCAGCGGCAGG - Exonic
1142212891 16:88816745-88816767 GGCTGCAGCGTGGGAGCCGCTGG - Intronic
1142696213 17:1635249-1635271 GGCCACCAAGTGGGGGCCGCCGG + Exonic
1143584567 17:7844772-7844794 GGACCCTAGGTGGGAGCCGCGGG + Intronic
1143723280 17:8828540-8828562 GGCCCCGACGTGGGGGCTGGGGG - Intronic
1143747139 17:9003155-9003177 GGCCGCGACTCGGGATCCGCGGG - Intergenic
1144128068 17:12220984-12221006 GGCCCCGCCCTCGGAGCGGCCGG + Intergenic
1145094827 17:20016545-20016567 GGCCCCGCACTGGGAGCGGCCGG + Intronic
1148023445 17:44568606-44568628 GGCCCCGATGCGGGATCCACTGG + Intergenic
1150775888 17:68081036-68081058 GGCCCCCATGTGGGATCCACTGG + Intergenic
1151289447 17:73138973-73138995 GGCCCAGATGTGGCAGCTGCTGG - Intergenic
1152319593 17:79601043-79601065 GGCCCCGGGGCGGGAGCAGCGGG - Intergenic
1152363343 17:79842323-79842345 GGCCCCTCCCAGGGAGCCGCAGG + Intergenic
1155295052 18:24376861-24376883 GGCCCCGCACTGGGAGCAGCCGG - Intronic
1159656226 18:71031987-71032009 GGCCCCGCACTGGGAGCGGCCGG - Intergenic
1160443740 18:78912027-78912049 GGCCCTGAGGTGGGAGCAGGAGG - Intergenic
1160765380 19:805326-805348 GGTCCCGACGTGGGGGACACTGG - Intronic
1160790353 19:920152-920174 GGCACCGTGGTGGGAGGCGCCGG + Intronic
1161086683 19:2338724-2338746 GGCCCAGAGGAGGGAGCGGCAGG - Intronic
1161175809 19:2841672-2841694 GGCCCCGGCGAGGGCGGCGCAGG + Intronic
1161289172 19:3483582-3483604 GGCCCCGAGGTGGGGACGGCTGG - Intergenic
1162128239 19:8510874-8510896 GGCCCGGCCGCGGGGGCCGCGGG + Exonic
1162459637 19:10806889-10806911 AGCCCCTAGGTGAGAGCCGCTGG + Intronic
1163020656 19:14479432-14479454 GGCCCCGGGATCGGAGCCGCAGG + Exonic
1165923795 19:39314790-39314812 GGCCCTGCCGTGGGAGGCGGTGG - Exonic
1167152894 19:47719759-47719781 GGCCCTGGGGTGGGAGCCCCAGG - Intronic
1168288143 19:55344615-55344637 GGCCCTGTGGTGGGAGCCCCCGG + Intronic
1168335212 19:55593402-55593424 GGCCCCGAGGGGGCAGGCGCGGG - Exonic
928429558 2:31206198-31206220 GGCCTCCACGTGGGAGCTGCTGG - Intronic
931106951 2:59067007-59067029 GGCCCCGCCCTCGGAGCGGCTGG + Intergenic
932766219 2:74472170-74472192 GGCCCGGATGTGGGAGGCGAAGG + Exonic
934085196 2:88503516-88503538 GGCCCTGGTGTGGGATCCGCGGG + Intergenic
937181118 2:119997062-119997084 GGCCCCGCACTCGGAGCCGCCGG + Intergenic
938087015 2:128408415-128408437 GGGCCCCACGTGGGAGACACAGG + Intergenic
938583693 2:132669788-132669810 GGCCCCGAGGTGGGCGCCTTGGG + Intronic
938727293 2:134120145-134120167 GCCGCCGCCGCGGGAGCCGCAGG - Intronic
939275228 2:139990981-139991003 GACCCCGCCCTGGGAGCGGCCGG - Intergenic
939957642 2:148540116-148540138 GGCCCATGCGTGGGAGCCACTGG - Intergenic
943222913 2:185133024-185133046 GCCCCTGATGTGGGAGCCACTGG + Intergenic
946376572 2:219313198-219313220 GGCCCCGGTGTGGGATCCACTGG + Intergenic
947932079 2:233972749-233972771 GGCCCCGCACTGGGAGCAGCCGG - Intronic
948047168 2:234952914-234952936 GGCCCCGGGCTAGGAGCCGCGGG - Intronic
948560076 2:238846750-238846772 GGCCGCGAGGTGGGGCCCGCGGG - Intergenic
948806633 2:240455987-240456009 GGCGCCGGCCTGGGAGCCCCCGG - Intronic
948993060 2:241564436-241564458 GGCCCCCACGTGGCAGCTGAGGG + Intronic
1169044420 20:2524644-2524666 GGCCCCGCCGGGGGAGCCCAGGG + Intronic
1172118110 20:32583683-32583705 GGTCCCGGCGGGGGAGCCGCGGG + Intronic
1174467909 20:50731592-50731614 GGTCCCGCCGTGTGAGCAGCTGG + Exonic
1176705649 21:10118702-10118724 GGCATCTGCGTGGGAGCCGCAGG - Intergenic
1179909188 21:44438942-44438964 GGCCCAGCCCTGGGAGCCACAGG - Intronic
1180155124 21:45973909-45973931 GACCCCGTGGCGGGAGCCGCAGG - Intergenic
1183201477 22:36388007-36388029 CGCCCCGCCCTCGGAGCCGCGGG + Exonic
1183587524 22:38761395-38761417 GGCCCCGGGCTGGCAGCCGCAGG - Intronic
1183685193 22:39357616-39357638 GGCCCCGCCCTCGGAGCAGCCGG + Intronic
1183685218 22:39357678-39357700 GGCCCCGCCCTCGGAGCAGCCGG + Intronic
1183903355 22:41022229-41022251 GGCCCGGGCGCGGGAGCCGCGGG - Intergenic
1184246694 22:43239411-43239433 GGCCCCGGCCAGGGAGCCGAGGG + Intronic
949559372 3:5187959-5187981 GGCCCCGAGGTGGGCGACGCGGG - Exonic
950256981 3:11513524-11513546 GGCCCCGCACTGGGAGCGGCCGG - Intronic
950486035 3:13274429-13274451 GCCCCCTCCGTGGGAACCGCAGG - Intergenic
950965206 3:17141281-17141303 GGCCCCCACGTGGCAGCCAAGGG + Intergenic
956678188 3:71754298-71754320 GGCCGCGGCGGGGGCGCCGCCGG + Exonic
961464979 3:127076223-127076245 GGCCCCGGTGTGGGATCCACTGG - Intergenic
963397191 3:144749891-144749913 GGCCCCGCACTGGGAGCAGCAGG + Intergenic
965040275 3:163499102-163499124 GGCCCCGTACTGGGAGCAGCCGG + Intergenic
968235274 3:197027564-197027586 GGCCAGGAGGTGGGAGCCTCAGG - Intronic
968488421 4:876442-876464 GGGCCGGTCGTGGGAGCCCCAGG - Intronic
968501418 4:951911-951933 GGCCCCGATGAGGGAGTCACCGG + Intronic
968541876 4:1172106-1172128 GGCACCGTCGTGGCAGCCTCGGG + Intronic
968545277 4:1194935-1194957 GGCTGCGAGGTTGGAGCCGCCGG - Intronic
968815156 4:2818194-2818216 GGCCCTGGCCTGGCAGCCGCCGG - Exonic
969288407 4:6222448-6222470 GGCCCTGACCTGCGCGCCGCGGG - Intergenic
969323536 4:6427391-6427413 GGCCCCCACGTGGGAGCCTCTGG - Intronic
977206498 4:94169924-94169946 GGCCCCGCACTCGGAGCCGCCGG + Intergenic
977750984 4:100609046-100609068 GGCCCCGCACTCGGAGCCGCCGG - Intronic
978207211 4:106092673-106092695 GGCCCCGCACTGGGAGCAGCCGG - Intronic
980043401 4:127964518-127964540 GGCCCCGCACTGGGAGCAGCAGG - Intronic
980739334 4:136929417-136929439 GGCCCCGGTGTGGGATCCACTGG + Intergenic
982921248 4:161277322-161277344 GGCCCCGCACTGGGAGCGGCCGG + Intergenic
982985743 4:162203667-162203689 GGCCCCGCACTGGGAGCGGCCGG + Intergenic
985782303 5:1877787-1877809 GGCCCCGGCGTGGCAGCGCCGGG + Exonic
986121218 5:4837956-4837978 GGCCCCGGTGTGGGATCCACTGG + Intergenic
986152373 5:5139870-5139892 GGCCCGGAGGTGGGAGCCCGCGG + Intergenic
986993263 5:13578591-13578613 GGCCCCGCCCTCGGAGCGGCCGG + Intergenic
988020539 5:25614836-25614858 GGCCCCGCACTTGGAGCCGCGGG - Intergenic
994239854 5:97407258-97407280 GGCCCCGCACTCGGAGCCGCCGG + Intergenic
994605620 5:101962726-101962748 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
995679888 5:114704569-114704591 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
996442996 5:123512613-123512635 GGCCGCGCCGAGGCAGCCGCCGG - Intronic
996811151 5:127517597-127517619 GCGGCCGACGTGGCAGCCGCAGG + Intronic
1001638870 5:173231544-173231566 GGCCCCGACGTGGCATCTGGGGG + Intergenic
1002164713 5:177337161-177337183 GGCCCCGAAGTAGTAGCCGGTGG + Exonic
1002308151 5:178296483-178296505 AGCCCCTGCGTGGGATCCGCGGG - Intronic
1003170866 6:3721045-3721067 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1003643041 6:7891662-7891684 GGCTCCAACCTGGGAGCAGCTGG - Exonic
1004235559 6:13872202-13872224 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1004248441 6:14002507-14002529 GGCCCCGCAGTCGGAGCGGCCGG + Intergenic
1006434148 6:34017462-34017484 GACCCCGCACTGGGAGCCGCCGG - Intergenic
1007511848 6:42380139-42380161 GGCCCCGAGGTGGGAATCTCAGG + Intronic
1011643029 6:89433098-89433120 GGCACCGGCGTAGGAGCCGCCGG + Intergenic
1014499205 6:122165065-122165087 GGCCCCGGTGTGGGATCCACTGG - Intergenic
1019479024 7:1257544-1257566 GGTTCCAACTTGGGAGCCGCTGG - Intergenic
1019485270 7:1286299-1286321 GGCCCTGAGGTGGGAGGGGCCGG + Intergenic
1019575262 7:1734631-1734653 GGCCCCGGAGTGGGAGCCCAGGG - Intronic
1020008267 7:4793608-4793630 GGCCCCGCACTCGGAGCCGCCGG + Intronic
1021520638 7:21536526-21536548 GGCCCCGGTGTGGGATCCACTGG - Intergenic
1021761299 7:23904995-23905017 GGCCCCGCACTTGGAGCCGCCGG - Intergenic
1022449832 7:30504533-30504555 GGCCCCGGCGTGGGTAGCGCGGG + Intronic
1023243791 7:38178638-38178660 GCCCACGCCGTGGGAGCAGCGGG - Intronic
1023791677 7:43758328-43758350 GGCCCCGGCGTGGGGGGGGCAGG - Intergenic
1023881818 7:44325187-44325209 GGCCCCGACCCGCGAGCCCCCGG - Intronic
1024959201 7:54957249-54957271 GGCCCCAACTTGGGGCCCGCTGG - Intergenic
1029735720 7:102464863-102464885 GGCGCGGCCGTGGGGGCCGCTGG + Exonic
1031483460 7:122304109-122304131 GGCACCGCCGCGGGCGCCGCCGG + Exonic
1032068797 7:128791509-128791531 GGAGCCGGCGCGGGAGCCGCGGG + Intronic
1034649191 7:152676027-152676049 GGGACCGAGGTGAGAGCCGCCGG - Exonic
1035091816 7:156319156-156319178 GGCACCCATGTGGGAGCCACAGG + Intergenic
1035212375 7:157337445-157337467 GGGCCCGGCCTGGGAGCGGCCGG + Intronic
1035382479 7:158448610-158448632 GGCCCAGGAGTGGGAGCTGCAGG - Intronic
1035553440 8:545842-545864 AGCCCCAACCTGGGCGCCGCGGG - Intergenic
1036646961 8:10616951-10616973 GGCCCCGCTGTGGGAGCTGGAGG - Intronic
1037263863 8:17037098-17037120 GGCCCCGCAGTCGGAGCAGCCGG - Intronic
1037815382 8:22109201-22109223 GGCGCCGGCCGGGGAGCCGCCGG - Exonic
1038828457 8:31032880-31032902 GGGCCCGGCGTGGGGGTCGCGGG - Exonic
1039069134 8:33634113-33634135 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1039454367 8:37697554-37697576 GGAGCCGCCGCGGGAGCCGCCGG - Exonic
1042948776 8:74179797-74179819 GGCCCCGCACTCGGAGCCGCTGG - Intergenic
1045815107 8:106270069-106270091 GCCCCCGGCGTGGTAGCCTCCGG + Intergenic
1046661218 8:116950016-116950038 GGCCCCGCACTCGGAGCCGCCGG - Intergenic
1048484036 8:134831648-134831670 GGACCGGGCGTGGGGGCCGCGGG - Intergenic
1048757522 8:137755401-137755423 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1049689397 8:143952075-143952097 GATCCCGAGGTGGGAGGCGCTGG + Intronic
1049759712 8:144326506-144326528 GGCCCCGACGTGGGAGCCGCGGG - Exonic
1049767153 8:144360186-144360208 GGCCTCCAGGTGGGAGCCCCAGG + Exonic
1053547936 9:39042638-39042660 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1053624623 9:39856051-39856073 GGCCTCTCCGTGGGTGCCGCTGG + Intergenic
1053880247 9:42587177-42587199 GGCCTCTCCGTGGGTGCCGCTGG - Intergenic
1054219273 9:62394647-62394669 GGCCTCTCCGTGGGTGCCGCTGG - Intergenic
1054231441 9:62514526-62514548 GGCCTCTCCGTGGGTGCCGCTGG + Intergenic
1055654914 9:78442150-78442172 GGCCCCGCACTGGGAGCGGCTGG + Intergenic
1057047996 9:91900488-91900510 GGCCTGCACGTGGGACCCGCAGG + Intronic
1059102494 9:111483915-111483937 GGGCCCGGCGGGGGGGCCGCTGG - Intronic
1060842558 9:126805209-126805231 GGCCCCGACGCTCGCGCCGCTGG + Intronic
1061476866 9:130873423-130873445 GGCCTCTTCCTGGGAGCCGCTGG + Intronic
1061502014 9:131009398-131009420 TGTCCCCACGTGGGCGCCGCGGG + Exonic
1061614247 9:131769039-131769061 GGCCTCAAGGTGGGAGCCACGGG + Intergenic
1062001583 9:134218560-134218582 GGCACAGAGGTGGGAGCCACTGG + Intergenic
1062230592 9:135479787-135479809 GGCCGCGCCGTGGGAAGCGCGGG - Exonic
1062696195 9:137877609-137877631 AGCCCCGGGGTGGGAGGCGCGGG + Intergenic
1202790683 9_KI270719v1_random:88811-88833 GGCATCTGCGTGGGAGCCGCAGG - Intergenic
1203361293 Un_KI270442v1:220744-220766 GGCGGCGATGTGGGAGCCGCGGG - Intergenic
1187900945 X:24025863-24025885 AGCCCCGACGGCGGCGCCGCGGG - Intronic
1188881794 X:35499356-35499378 GGCCCCGCACTGGGAGCTGCCGG + Intergenic
1191053926 X:56222833-56222855 GGCCCCGCACTCGGAGCCGCCGG - Intergenic
1196319555 X:114270841-114270863 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1196781486 X:119387866-119387888 GGCCCCGCACTGGGAGCAGCCGG - Intergenic
1201077157 Y:10196816-10196838 GGCGGCGATGGGGGAGCCGCAGG + Intergenic
1201424226 Y:13831429-13831451 GGCCCCGAACTCGGAGCAGCCGG + Intergenic