ID: 1049762408

View in Genome Browser
Species Human (GRCh38)
Location 8:144337263-144337285
Sequence GCAGCATTGTCGGGCGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049762400_1049762408 -6 Left 1049762400 8:144337246-144337268 CCGCGGCCCGGCAGCCAGCAGCA No data
Right 1049762408 8:144337263-144337285 GCAGCATTGTCGGGCGTGTGGGG No data
1049762396_1049762408 12 Left 1049762396 8:144337228-144337250 CCCGCGCGGCTCGGGGAACCGCG No data
Right 1049762408 8:144337263-144337285 GCAGCATTGTCGGGCGTGTGGGG No data
1049762395_1049762408 13 Left 1049762395 8:144337227-144337249 CCCCGCGCGGCTCGGGGAACCGC No data
Right 1049762408 8:144337263-144337285 GCAGCATTGTCGGGCGTGTGGGG No data
1049762394_1049762408 14 Left 1049762394 8:144337226-144337248 CCCCCGCGCGGCTCGGGGAACCG No data
Right 1049762408 8:144337263-144337285 GCAGCATTGTCGGGCGTGTGGGG No data
1049762397_1049762408 11 Left 1049762397 8:144337229-144337251 CCGCGCGGCTCGGGGAACCGCGG No data
Right 1049762408 8:144337263-144337285 GCAGCATTGTCGGGCGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049762408 Original CRISPR GCAGCATTGTCGGGCGTGTG GGG Intergenic
No off target data available for this crispr