ID: 1049763836

View in Genome Browser
Species Human (GRCh38)
Location 8:144343717-144343739
Sequence ACATTTACAAGACTGCCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049763836_1049763838 -3 Left 1049763836 8:144343717-144343739 CCCTAGGGCAGTCTTGTAAATGT No data
Right 1049763838 8:144343737-144343759 TGTCCTAGAGCTCCAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049763836 Original CRISPR ACATTTACAAGACTGCCCTA GGG (reversed) Intergenic