ID: 1049763936

View in Genome Browser
Species Human (GRCh38)
Location 8:144344182-144344204
Sequence GCCCCAGGAATTGTTCCTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049763930_1049763936 13 Left 1049763930 8:144344146-144344168 CCACGTCTCTCTGCCTATGACCA No data
Right 1049763936 8:144344182-144344204 GCCCCAGGAATTGTTCCTCCGGG No data
1049763927_1049763936 18 Left 1049763927 8:144344141-144344163 CCCCACCACGTCTCTCTGCCTAT No data
Right 1049763936 8:144344182-144344204 GCCCCAGGAATTGTTCCTCCGGG No data
1049763926_1049763936 25 Left 1049763926 8:144344134-144344156 CCTTCAGCCCCACCACGTCTCTC No data
Right 1049763936 8:144344182-144344204 GCCCCAGGAATTGTTCCTCCGGG No data
1049763928_1049763936 17 Left 1049763928 8:144344142-144344164 CCCACCACGTCTCTCTGCCTATG No data
Right 1049763936 8:144344182-144344204 GCCCCAGGAATTGTTCCTCCGGG No data
1049763932_1049763936 0 Left 1049763932 8:144344159-144344181 CCTATGACCACTGCTCTCATGGA No data
Right 1049763936 8:144344182-144344204 GCCCCAGGAATTGTTCCTCCGGG No data
1049763929_1049763936 16 Left 1049763929 8:144344143-144344165 CCACCACGTCTCTCTGCCTATGA No data
Right 1049763936 8:144344182-144344204 GCCCCAGGAATTGTTCCTCCGGG No data
1049763933_1049763936 -7 Left 1049763933 8:144344166-144344188 CCACTGCTCTCATGGAGCCCCAG No data
Right 1049763936 8:144344182-144344204 GCCCCAGGAATTGTTCCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049763936 Original CRISPR GCCCCAGGAATTGTTCCTCC GGG Intergenic
No off target data available for this crispr