ID: 1049765613

View in Genome Browser
Species Human (GRCh38)
Location 8:144353953-144353975
Sequence CGCCTGGCGCTCAGCTCCGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049765613_1049765620 12 Left 1049765613 8:144353953-144353975 CCATCGGAGCTGAGCGCCAGGCG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1049765620 8:144353988-144354010 ATGCAAGGGGCCCTGGCACACGG 0: 1
1: 0
2: 1
3: 21
4: 233
1049765613_1049765616 -2 Left 1049765613 8:144353953-144353975 CCATCGGAGCTGAGCGCCAGGCG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1049765616 8:144353974-144353996 CGCACGTAGACCAGATGCAAGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1049765613_1049765615 -3 Left 1049765613 8:144353953-144353975 CCATCGGAGCTGAGCGCCAGGCG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1049765615 8:144353973-144353995 GCGCACGTAGACCAGATGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 30
1049765613_1049765618 5 Left 1049765613 8:144353953-144353975 CCATCGGAGCTGAGCGCCAGGCG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1049765618 8:144353981-144354003 AGACCAGATGCAAGGGGCCCTGG 0: 1
1: 0
2: 3
3: 28
4: 237
1049765613_1049765621 17 Left 1049765613 8:144353953-144353975 CCATCGGAGCTGAGCGCCAGGCG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1049765621 8:144353993-144354015 AGGGGCCCTGGCACACGGTGCGG 0: 1
1: 0
2: 4
3: 28
4: 279
1049765613_1049765625 27 Left 1049765613 8:144353953-144353975 CCATCGGAGCTGAGCGCCAGGCG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1049765625 8:144354003-144354025 GCACACGGTGCGGCCCTGGATGG 0: 1
1: 0
2: 0
3: 14
4: 179
1049765613_1049765624 23 Left 1049765613 8:144353953-144353975 CCATCGGAGCTGAGCGCCAGGCG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1049765624 8:144353999-144354021 CCTGGCACACGGTGCGGCCCTGG 0: 1
1: 0
2: 2
3: 21
4: 174
1049765613_1049765617 -1 Left 1049765613 8:144353953-144353975 CCATCGGAGCTGAGCGCCAGGCG 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1049765617 8:144353975-144353997 GCACGTAGACCAGATGCAAGGGG 0: 1
1: 0
2: 1
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049765613 Original CRISPR CGCCTGGCGCTCAGCTCCGA TGG (reversed) Exonic