ID: 1049766210

View in Genome Browser
Species Human (GRCh38)
Location 8:144356435-144356457
Sequence TAGCCTAGAGGAGCTCTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049766210_1049766215 -7 Left 1049766210 8:144356435-144356457 CCAGGCAGAGCTCCTCTAGGCTA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1049766215 8:144356451-144356473 TAGGCTAGGGAAGCCTGGTCCGG 0: 1
1: 0
2: 1
3: 7
4: 109
1049766210_1049766219 12 Left 1049766210 8:144356435-144356457 CCAGGCAGAGCTCCTCTAGGCTA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1049766219 8:144356470-144356492 CCGGGAGCCACCCCTCGTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 134
1049766210_1049766223 21 Left 1049766210 8:144356435-144356457 CCAGGCAGAGCTCCTCTAGGCTA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1049766223 8:144356479-144356501 ACCCCTCGTCCCGGAGGCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 83
1049766210_1049766222 20 Left 1049766210 8:144356435-144356457 CCAGGCAGAGCTCCTCTAGGCTA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1049766222 8:144356478-144356500 CACCCCTCGTCCCGGAGGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 166
1049766210_1049766216 -6 Left 1049766210 8:144356435-144356457 CCAGGCAGAGCTCCTCTAGGCTA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1049766216 8:144356452-144356474 AGGCTAGGGAAGCCTGGTCCGGG 0: 1
1: 0
2: 1
3: 21
4: 228
1049766210_1049766220 15 Left 1049766210 8:144356435-144356457 CCAGGCAGAGCTCCTCTAGGCTA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1049766220 8:144356473-144356495 GGAGCCACCCCTCGTCCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049766210 Original CRISPR TAGCCTAGAGGAGCTCTGCC TGG (reversed) Exonic