ID: 1049766214

View in Genome Browser
Species Human (GRCh38)
Location 8:144356447-144356469
Sequence ACCAGGCTTCCCTAGCCTAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049766214_1049766229 22 Left 1049766214 8:144356447-144356469 CCTCTAGGCTAGGGAAGCCTGGT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1049766229 8:144356492-144356514 GAGGCTTGGGCAGCCACATCAGG 0: 1
1: 0
2: 3
3: 32
4: 438
1049766214_1049766220 3 Left 1049766214 8:144356447-144356469 CCTCTAGGCTAGGGAAGCCTGGT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1049766220 8:144356473-144356495 GGAGCCACCCCTCGTCCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 115
1049766214_1049766222 8 Left 1049766214 8:144356447-144356469 CCTCTAGGCTAGGGAAGCCTGGT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1049766222 8:144356478-144356500 CACCCCTCGTCCCGGAGGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 166
1049766214_1049766219 0 Left 1049766214 8:144356447-144356469 CCTCTAGGCTAGGGAAGCCTGGT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1049766219 8:144356470-144356492 CCGGGAGCCACCCCTCGTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 134
1049766214_1049766223 9 Left 1049766214 8:144356447-144356469 CCTCTAGGCTAGGGAAGCCTGGT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1049766223 8:144356479-144356501 ACCCCTCGTCCCGGAGGCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049766214 Original CRISPR ACCAGGCTTCCCTAGCCTAG AGG (reversed) Exonic