ID: 1049766215 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:144356451-144356473 |
Sequence | TAGGCTAGGGAAGCCTGGTC CGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 118 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 7, 4: 109} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1049766210_1049766215 | -7 | Left | 1049766210 | 8:144356435-144356457 | CCAGGCAGAGCTCCTCTAGGCTA | 0: 1 1: 0 2: 1 3: 10 4: 119 |
||
Right | 1049766215 | 8:144356451-144356473 | TAGGCTAGGGAAGCCTGGTCCGG | 0: 1 1: 0 2: 1 3: 7 4: 109 |
||||
1049766206_1049766215 | 26 | Left | 1049766206 | 8:144356402-144356424 | CCTCGTTGCTCACAAAGTTGCAG | 0: 1 1: 0 2: 4 3: 6 4: 97 |
||
Right | 1049766215 | 8:144356451-144356473 | TAGGCTAGGGAAGCCTGGTCCGG | 0: 1 1: 0 2: 1 3: 7 4: 109 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1049766215 | Original CRISPR | TAGGCTAGGGAAGCCTGGTC CGG | Exonic | ||