ID: 1049766219

View in Genome Browser
Species Human (GRCh38)
Location 8:144356470-144356492
Sequence CCGGGAGCCACCCCTCGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049766210_1049766219 12 Left 1049766210 8:144356435-144356457 CCAGGCAGAGCTCCTCTAGGCTA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1049766219 8:144356470-144356492 CCGGGAGCCACCCCTCGTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 134
1049766214_1049766219 0 Left 1049766214 8:144356447-144356469 CCTCTAGGCTAGGGAAGCCTGGT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1049766219 8:144356470-144356492 CCGGGAGCCACCCCTCGTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049766219 Original CRISPR CCGGGAGCCACCCCTCGTCC CGG Exonic