ID: 1049766219

View in Genome Browser
Species Human (GRCh38)
Location 8:144356470-144356492
Sequence CCGGGAGCCACCCCTCGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049766214_1049766219 0 Left 1049766214 8:144356447-144356469 CCTCTAGGCTAGGGAAGCCTGGT 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1049766219 8:144356470-144356492 CCGGGAGCCACCCCTCGTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 134
1049766210_1049766219 12 Left 1049766210 8:144356435-144356457 CCAGGCAGAGCTCCTCTAGGCTA 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1049766219 8:144356470-144356492 CCGGGAGCCACCCCTCGTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049766219 Original CRISPR CCGGGAGCCACCCCTCGTCC CGG Exonic
903190257 1:21652114-21652136 CCGGCCGCCGCCCCCCGTCCAGG + Intronic
906295756 1:44648110-44648132 CCTGGAGCCCCACCTCCTCCTGG + Intronic
906747530 1:48232183-48232205 CAGGAAGCCACCCCACTTCCTGG - Intronic
912494993 1:110085855-110085877 CTGGGAGCCTCCCCACGACCAGG + Intergenic
912552937 1:110496153-110496175 CCAGGAGCCAGCTCTTGTCCTGG + Intergenic
915348826 1:155212192-155212214 CCGGGAGCAACTTCTCCTCCAGG - Exonic
916647099 1:166797125-166797147 TCGGGGGCCTCCCCTGGTCCTGG - Intergenic
920244720 1:204579004-204579026 CTGGGAGCCTCCCCTGATCCAGG - Intergenic
922196745 1:223365098-223365120 CCGGAAGCCTCCCCTCCTCCAGG - Intergenic
923013330 1:230106348-230106370 CCAGGAGCCATGCCTCCTCCTGG + Intronic
923151843 1:231240841-231240863 TCGGAAGTCACCCCTCGACCGGG - Intronic
924602151 1:245500686-245500708 CCGGGGCCCAGCCCTCGCCCTGG - Intronic
1065883638 10:30058932-30058954 GCGGGAGCCCCCCACCGTCCCGG + Intronic
1067407449 10:46036120-46036142 CAGGGAGCCAGCCCTGGGCCCGG + Intronic
1067639379 10:48031740-48031762 CCGGGCACCAGCCCTGGTCCCGG + Intergenic
1069599225 10:69692733-69692755 CCTGGAACCACCCCAGGTCCTGG - Intergenic
1069599412 10:69693830-69693852 CCTGGAACCACCCCAGGTCCCGG + Intergenic
1069709208 10:70478420-70478442 CTGGGCGCCACACCCCGTCCCGG - Intergenic
1077246858 11:1543913-1543935 CCGGGATCCACCACCCTTCCTGG + Intergenic
1077839670 11:5961023-5961045 CCGGCAGCCGCCCCCCGTCTGGG + Intergenic
1085049086 11:73370658-73370680 CCAGGAGCCTCCCCTGGGCCGGG - Intergenic
1085349495 11:75789527-75789549 AAGGGAGCCAGCCCTCCTCCTGG + Intronic
1092123853 12:6062624-6062646 CAGGGAGACACCCCTGCTCCCGG + Intronic
1096113147 12:49040701-49040723 CCAGGAGCCACCCCCTGCCCAGG - Exonic
1096389287 12:51217108-51217130 CCGGGTCCCACCGGTCGTCCCGG + Intronic
1096413174 12:51391626-51391648 CCGGGAGCCACCCCGCGGCGCGG - Intronic
1096472748 12:51889430-51889452 CCGTGAGCCCCCGCTGGTCCCGG - Exonic
1104284707 12:127414380-127414402 ACAGGAGCCTCCCCTCGACCTGG - Intergenic
1108589578 13:51901390-51901412 CCGGGCGCCACCCCTCTAGCAGG - Intergenic
1113775777 13:112943986-112944008 CCGGGACCCTCCCCTCACCCGGG - Intronic
1113968080 13:114165964-114165986 CCTGGATCCACACCTCCTCCTGG + Intergenic
1115502264 14:34060331-34060353 GCGGGAGCCCTCCCTCGGCCCGG - Intronic
1121109623 14:91303502-91303524 CCAGGCCCCACCCCTCCTCCAGG + Intronic
1122768165 14:104085546-104085568 CCGGGACCCACCCCGCCCCCAGG + Intergenic
1122798380 14:104217685-104217707 CAGTGAGGCAGCCCTCGTCCAGG + Intergenic
1122824313 14:104362250-104362272 CCGGGGGCCACCACACGCCCTGG - Intergenic
1124500363 15:30223068-30223090 CCGGGGGCAACGCCTCGGCCCGG - Intergenic
1124743210 15:32315598-32315620 CCGGGGGCAACGCCTCGGCCCGG + Intergenic
1126398232 15:48242212-48242234 CCTGCAGCCACACCTCCTCCTGG + Intronic
1129538660 15:76334104-76334126 CTGGGAGCCAGGCCTAGTCCAGG + Intergenic
1129605155 15:77021201-77021223 CCGGGAGCCACCCTCAGGCCTGG + Intronic
1129810701 15:78507650-78507672 CCGGCAGCGACCCGACGTCCTGG - Intronic
1130411715 15:83653784-83653806 CTGGAAGCCACTCCTCGCCCTGG - Intergenic
1132234070 15:100206077-100206099 CAGGGAGCCACCCATGGTCTGGG - Intronic
1132522221 16:397120-397142 CCGGGAGCCCCCCGCCGCCCCGG - Intronic
1132677340 16:1126230-1126252 CTGGGAGCCTCCCCTCGCCCAGG - Intergenic
1133130457 16:3673454-3673476 CCGGGACCCACACCTCATCACGG + Intronic
1133287754 16:4698437-4698459 CCGGGATGCTGCCCTCGTCCTGG - Exonic
1137980650 16:53066540-53066562 GCAGGAGCCACCTCTCCTCCAGG - Intronic
1139704681 16:68732970-68732992 CCTGGAGCCTCCCCTCCCCCAGG - Intergenic
1139853758 16:69965389-69965411 CCGGGACCCGCCCCTTGTCCGGG + Intergenic
1139882736 16:70188302-70188324 CCGGGACCCGCCCCTTGGCCGGG + Intergenic
1140369774 16:74407217-74407239 CCGGGACCCGCCCCTTGGCCGGG - Intergenic
1140476013 16:75239591-75239613 CCGGGAGCCAACCCAGGTCAGGG - Intronic
1140481516 16:75265266-75265288 GCCGGAGCCACCCCTCCCCCAGG - Intronic
1141117680 16:81324465-81324487 CCTGGTGCCACCCCTGATCCTGG - Intronic
1141622084 16:85241736-85241758 CTGGGAGCCACACCGCCTCCAGG - Intergenic
1142151767 16:88515655-88515677 CAGGCAGCCACCCCTCCTGCAGG - Intronic
1142293112 16:89201697-89201719 CCAGGAGCCCGCCCTGGTCCAGG - Intergenic
1145881716 17:28357287-28357309 CGCGGAGGCACCTCTCGTCCCGG - Exonic
1146224290 17:31052262-31052284 GAGGGAGCCAGCCCTCCTCCAGG + Intergenic
1152706527 17:81846393-81846415 CCGGGAGGCAGCCCTGGCCCGGG + Intronic
1154194222 18:12254197-12254219 CTGGGAGCCCCCGGTCGTCCTGG - Intergenic
1155130917 18:22933653-22933675 CCGGGAGCCACCCCTACCCCGGG - Intronic
1159961806 18:74560969-74560991 CCGTGAGCCACCCATCGCCCCGG - Exonic
1160719217 19:590113-590135 CCGGGGGCAACGCCTCGGCCCGG - Exonic
1160992020 19:1863907-1863929 CCGGGAGCCCCGCCCCCTCCCGG + Intergenic
1161090725 19:2358724-2358746 CGGGGAGCCACGCCTGGTGCTGG - Intergenic
1161514511 19:4689227-4689249 CAGAGGGCCACCCCTAGTCCAGG - Intronic
1161521051 19:4723673-4723695 CCGGCCGCCGCCCCACGTCCCGG - Exonic
1161967046 19:7554702-7554724 CCAGGAGCCTACCCTCGGCCAGG + Exonic
1163156090 19:15440600-15440622 CTGGGAGCACCCCCTTGTCCAGG - Intronic
1166039424 19:40192598-40192620 CCGGGTGCCACCTCACGTGCTGG + Exonic
1166360881 19:42252593-42252615 CCCTGAGCAACCCCTCCTCCAGG + Intronic
1167515852 19:49922821-49922843 CTGGGAGCCACCCCTCCCTCTGG + Intronic
1167600311 19:50451123-50451145 CCAGGAGCCACCCCTCCTCCCGG - Intronic
1168703233 19:58453734-58453756 CCAGGAGCCCCCACTCCTCCTGG - Exonic
1168705705 19:58469218-58469240 CCAGGAGCCCCCACTCCTCCTGG - Exonic
927995173 2:27480035-27480057 CCGTGAGCCATCCCGCTTCCAGG + Exonic
932731742 2:74226697-74226719 CCAGGAGCCACCCTACCTCCTGG - Intronic
935511102 2:103975236-103975258 CAGGGAGGCACCCCTCTCCCTGG + Intergenic
935518878 2:104078885-104078907 CTGGGCGCCACCCCTGCTCCCGG + Intergenic
935718273 2:105957929-105957951 CTGGGAGCCACCTCTTCTCCAGG + Intergenic
938383627 2:130850079-130850101 CCGGGAGCCTCCCCTACTGCTGG + Intronic
947750243 2:232528330-232528352 CTGGGAGCCACACCATGTCCGGG - Exonic
948630312 2:239298276-239298298 CTGGAAGCCACCGCTTGTCCAGG - Intronic
948718689 2:239882634-239882656 CCGAGAGCCTGCCCTGGTCCAGG + Intergenic
948843599 2:240672420-240672442 GCGGGACCCAGCCCTCGTCCTGG + Intergenic
1176547773 21:8208946-8208968 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176555669 21:8253151-8253173 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176566718 21:8391985-8392007 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176574599 21:8436180-8436202 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1176611212 21:8987472-8987494 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1181434131 22:22900451-22900473 CTGGCATCCACCCCACGTCCCGG - Intergenic
1181435069 22:22905817-22905839 CTGGCATCCACCCCACGTCCCGG - Intergenic
1182472053 22:30554821-30554843 CAGGGAGCCCCCCCTCACCCCGG + Exonic
1185145654 22:49134351-49134373 CCTGGAGCAGCCCCTCTTCCCGG - Intergenic
1185335833 22:50270463-50270485 CCGGGAACCCCCCCACGCCCCGG - Intronic
1203252647 22_KI270733v1_random:125231-125253 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1203260703 22_KI270733v1_random:170317-170339 CCGGGCCCCACCCCCCGACCCGG - Intergenic
949981658 3:9505915-9505937 GCGGGAGCCAGGCCTGGTCCTGG - Intronic
950043256 3:9933540-9933562 CCTGGTCCCACCCCGCGTCCCGG - Exonic
954301951 3:49704942-49704964 CCCTGAGCCAGCCCTGGTCCTGG + Intronic
956349637 3:68320630-68320652 CAGGGAGCCACCTCTGGCCCTGG - Intronic
964358448 3:155870928-155870950 CCGGGAGCCTCGCCTCCGCCGGG - Intronic
965290799 3:166876793-166876815 CCAGCAGCCACCCCACCTCCTGG - Intergenic
969116044 4:4871462-4871484 CAGGCAGCCACCCCTGGTCCCGG - Intergenic
971505132 4:27358395-27358417 CCTGGAGCCACCCCACCTCGAGG - Intergenic
972725812 4:41745925-41745947 CCGGGAGCCCAGCCTTGTCCAGG + Exonic
973855796 4:55008897-55008919 CCGGAAGCCACCCAGCCTCCTGG + Intergenic
984824992 4:183916171-183916193 CCGGCTGCCACCCCTGGCCCGGG - Intronic
985472570 5:54667-54689 CCGGGAGGCGACCCTGGTCCTGG - Intergenic
985587527 5:748667-748689 CAGGGAGGCATCCCTCGTGCTGG - Intronic
993151030 5:84162315-84162337 CCAGGAGGGACCCCTTGTCCTGG - Intronic
1001396228 5:171420947-171420969 CCTCGAGCTTCCCCTCGTCCCGG - Intronic
1002405552 5:179027511-179027533 CCAGGTGCAACCACTCGTCCTGG - Exonic
1002411001 5:179076483-179076505 CCAGGTGCAACCACTCGTCCTGG - Exonic
1005367826 6:25097088-25097110 CCGGGAGCCACCCTTGATCTGGG - Intergenic
1007702484 6:43772993-43773015 CCGGGACCCTCCACTCCTCCTGG - Intronic
1015515011 6:134074524-134074546 CCAGAAGACACCCCTCCTCCTGG + Intergenic
1019325847 7:437875-437897 CCGGCAGCCACCCAGAGTCCCGG + Intergenic
1019360592 7:602452-602474 CCGGGAGCCCCACCTGGGCCAGG - Intronic
1020035058 7:4959423-4959445 GCGCGAGCCACCCATCGCCCAGG + Intergenic
1023625784 7:42113873-42113895 CAGGGAGTCCCCCCTCCTCCTGG - Intronic
1024047693 7:45596390-45596412 CAGGGAGACACACCTGGTCCTGG + Intronic
1027108501 7:75419970-75419992 CAGGGAGCTTCCCCTTGTCCGGG - Intronic
1041029722 8:53724542-53724564 CCAGGAGCCTCCCCACGGCCTGG + Intronic
1049189974 8:141281938-141281960 GCAGGAGCCACCACGCGTCCTGG - Intronic
1049346022 8:142139097-142139119 CCCGGTTCCACCCCTCCTCCTGG - Intergenic
1049766219 8:144356470-144356492 CCGGGAGCCACCCCTCGTCCCGG + Exonic
1051170106 9:14313299-14313321 CCGGGAGCGGCCCCTCGCCACGG - Intronic
1054145808 9:61560027-61560049 CCGGGTGCCTTCCCTTGTCCTGG + Intergenic
1056228338 9:84518998-84519020 CCAGGGGCTACCCCTCATCCTGG + Intergenic
1056757510 9:89391189-89391211 TCAGGAGCCACCCATCATCCAGG + Intronic
1062013497 9:134279851-134279873 CCGGGGCTCACCCCTCCTCCTGG + Intergenic
1062186441 9:135221079-135221101 CCGGGAGCCCACCCTCGTGGTGG + Intergenic
1062512773 9:136916636-136916658 TTGGGGGCCACCCCTCATCCTGG + Intronic
1062558795 9:137129999-137130021 CCGGGCGCCTCCCCGGGTCCCGG - Intergenic
1062595103 9:137295851-137295873 CCGGGTGCGCCCCCTCGGCCCGG + Intergenic
1062606716 9:137351789-137351811 CAGGGAGGCACCCCACGTCTCGG + Intronic
1203469050 Un_GL000220v1:108382-108404 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1203476871 Un_GL000220v1:152354-152376 CCGGGCCCCACCCCCCGACCCGG - Intergenic
1189731580 X:44026475-44026497 CCGTGAGCCACCCCTGTACCAGG - Intergenic
1190114811 X:47619589-47619611 CCCGGAGCCACGCCCGGTCCCGG - Exonic