ID: 1049766220 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:144356473-144356495 |
| Sequence | GGAGCCACCCCTCGTCCCGG AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 119 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 115} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1049766210_1049766220 | 15 | Left | 1049766210 | 8:144356435-144356457 | CCAGGCAGAGCTCCTCTAGGCTA | 0: 1 1: 0 2: 1 3: 10 4: 119 |
||
| Right | 1049766220 | 8:144356473-144356495 | GGAGCCACCCCTCGTCCCGGAGG | 0: 1 1: 0 2: 0 3: 3 4: 115 |
||||
| 1049766214_1049766220 | 3 | Left | 1049766214 | 8:144356447-144356469 | CCTCTAGGCTAGGGAAGCCTGGT | 0: 1 1: 0 2: 0 3: 12 4: 155 |
||
| Right | 1049766220 | 8:144356473-144356495 | GGAGCCACCCCTCGTCCCGGAGG | 0: 1 1: 0 2: 0 3: 3 4: 115 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1049766220 | Original CRISPR | GGAGCCACCCCTCGTCCCGG AGG | Exonic | ||