ID: 1049766634

View in Genome Browser
Species Human (GRCh38)
Location 8:144358202-144358224
Sequence CTTGGGCTTGGCCGCGGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049766624_1049766634 -1 Left 1049766624 8:144358180-144358202 CCGCCTCGGACCTGAGCCCGGCC 0: 1
1: 0
2: 1
3: 13
4: 190
Right 1049766634 8:144358202-144358224 CTTGGGCTTGGCCGCGGCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 139
1049766622_1049766634 2 Left 1049766622 8:144358177-144358199 CCGCCGCCTCGGACCTGAGCCCG 0: 1
1: 0
2: 0
3: 13
4: 166
Right 1049766634 8:144358202-144358224 CTTGGGCTTGGCCGCGGCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 139
1049766620_1049766634 23 Left 1049766620 8:144358156-144358178 CCGGTGCGGGTGCGGGCGCGGCC 0: 1
1: 0
2: 2
3: 18
4: 141
Right 1049766634 8:144358202-144358224 CTTGGGCTTGGCCGCGGCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 139
1049766625_1049766634 -4 Left 1049766625 8:144358183-144358205 CCTCGGACCTGAGCCCGGCCTTG 0: 1
1: 0
2: 1
3: 9
4: 154
Right 1049766634 8:144358202-144358224 CTTGGGCTTGGCCGCGGCGCTGG 0: 1
1: 0
2: 2
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049766634 Original CRISPR CTTGGGCTTGGCCGCGGCGC TGG Exonic
900206921 1:1435600-1435622 CGTGGGCGTGGCCTCGGCGTGGG + Intronic
901207301 1:7504376-7504398 CCTGGGCTTGGCCTGGGCACAGG + Intronic
901294955 1:8154088-8154110 CTTGGCCTTGGCCTAGGTGCTGG + Intergenic
912532919 1:110339427-110339449 CTTGGACTCCGCCGCGGCACAGG - Exonic
915564323 1:156705438-156705460 GTTGGGCATGGTGGCGGCGCGGG + Exonic
915937759 1:160098917-160098939 CTGGGGCTGGGCCGAGGCCCGGG - Intronic
919822247 1:201480821-201480843 GTTGGGCTTGGAGGCGGGGCCGG + Intergenic
921029705 1:211326772-211326794 CTGGGGCGGGGCCGGGGCGCGGG - Intronic
922814888 1:228441572-228441594 CCTGGGCTTGGCCCAGGCACTGG - Intergenic
923400800 1:233614144-233614166 GTTGGCCTTGGCGGCGGCGGTGG + Exonic
923506351 1:234609479-234609501 CTCGGACATGGCCGCGGCGGTGG - Exonic
924624571 1:245688139-245688161 CTTGGGCGAGGCCCCGGAGCTGG - Exonic
924732413 1:246724252-246724274 CGTGGGCGTGGGCGCGGCCCTGG + Exonic
924801525 1:247332024-247332046 CCTGGGCCTGGCCGCCGGGCCGG + Intergenic
924816699 1:247448207-247448229 CTTGGTCTCGGCGGCGGCGACGG + Intronic
1065214902 10:23439582-23439604 CTCGGGCTCGGGCGCGGCGCCGG - Exonic
1065637010 10:27743565-27743587 CTTGAACTTGGCCGGGTCGCCGG + Intronic
1067694201 10:48523733-48523755 CCCGGGGCTGGCCGCGGCGCCGG - Intronic
1067752106 10:48978369-48978391 CTTGGGCTTGGAGGCTGAGCCGG - Exonic
1073088539 10:100912719-100912741 CTCGGCCTTGGCCGGCGCGCGGG - Intronic
1077047972 11:554604-554626 ATTGGGCATGGCCGAGGGGCAGG + Exonic
1077528457 11:3083445-3083467 CTTGGGCTAGGCCGGGGGGCAGG - Intergenic
1079076230 11:17386949-17386971 CTTGGGCTTGGCCTTGGCCATGG + Exonic
1084085032 11:66851072-66851094 CATGGGCTTGGCCGAAGAGCTGG - Exonic
1084237575 11:67797896-67797918 CTAGAGCTTGGCAGTGGCGCCGG - Intergenic
1088172963 11:107018270-107018292 CCCGGGCTCGGCGGCGGCGCCGG + Exonic
1090178107 11:124669820-124669842 CTTGGGCTTGGCCCTAACGCTGG + Intronic
1102310666 12:111842295-111842317 CTTCGGCTTCGCGGCGGTGCAGG + Intronic
1104989722 12:132618815-132618837 CTTGGGCTGGGCGGCGGCCATGG - Exonic
1108615752 13:52129972-52129994 ATTGGGGGTGGCCGCGGCGGGGG + Intergenic
1117941589 14:60972458-60972480 CTTGGGCATGGCGGCGGCGGCGG + Exonic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1119435552 14:74595596-74595618 CCTGGGCCTGGGCGCGGGGCTGG - Intronic
1122065973 14:99174797-99174819 CCGGGGCTGGGCAGCGGCGCGGG + Exonic
1122552226 14:102556271-102556293 CTTGGGCTGGGCAGTGGGGCAGG + Intergenic
1122885452 14:104708520-104708542 CTTGGGCTTGGCTGCAGGGAAGG - Exonic
1122895168 14:104753188-104753210 CTTGGGCATGGCCGCGGGGCCGG - Exonic
1124652504 15:31483999-31484021 CTTGGCCGTGGCGGCGGCGGCGG + Exonic
1128999355 15:72319859-72319881 CGGGGACATGGCCGCGGCGCCGG - Exonic
1130099857 15:80885075-80885097 CTGGGGCTTGGCAGGGGCGAGGG - Intronic
1132414845 15:101612748-101612770 CTGGGGCTTGGCTGAGGCCCTGG + Intergenic
1138180122 16:54935504-54935526 TTCGGGCTTGGCTGCGGTGCTGG + Intergenic
1140505991 16:75473163-75473185 CTTCGACTTGGCCGCAGTGCTGG + Exonic
1142136210 16:88453137-88453159 CGGGGGCGTGGCCGCGGCGCTGG + Intergenic
1142837004 17:2594301-2594323 CTTGGGGAGGGCCGCGGGGCGGG - Intronic
1142855097 17:2724684-2724706 CCTGGGCTCGGCGGTGGCGCCGG + Intergenic
1143496592 17:7315996-7316018 CTGGAGCTTGGCAGCCGCGCAGG - Exonic
1143503129 17:7350368-7350390 CTCGAGCCTGGCCCCGGCGCTGG - Intronic
1144870022 17:18363542-18363564 CTTGGGCTTGGCCCCGCCCCCGG + Intronic
1146062735 17:29615622-29615644 CTTGGGCTGGGCCCGGGGGCGGG - Exonic
1147766358 17:42839022-42839044 CTTGGGCTTGGCCGAGGCGTTGG + Intronic
1147806475 17:43135299-43135321 CTTGGGCTTGAACGCTGGGCCGG - Intergenic
1147921096 17:43917586-43917608 CTTGGGCTTGAACGCTGGGCCGG - Exonic
1148625894 17:49068726-49068748 CTTGGGCATGGCCTGGGCTCTGG - Intergenic
1149007940 17:51824912-51824934 CGTGGCCTTGGCAGCGGTGCTGG + Intronic
1150624895 17:66835321-66835343 CCGGTGCTGGGCCGCGGCGCCGG + Intronic
1152594775 17:81232796-81232818 CTTGGGCTTGGCCTTGGCTCAGG + Intronic
1152876200 17:82787558-82787580 CTTGGGCTTGGCAGAGCTGCAGG + Intronic
1155502401 18:26500028-26500050 CTTGGCCTTGGCCAAAGCGCTGG - Intronic
1158953809 18:62522380-62522402 CCTGGGCGTGGGCGCGGCCCGGG + Intergenic
1160668608 19:345016-345038 CTTGGCCTTGGCCTTGGCGGAGG + Intergenic
1160919539 19:1513249-1513271 CTCGGGCGGGGGCGCGGCGCGGG + Intronic
1160983540 19:1827407-1827429 GTGGGGCTCGGCCGCCGCGCTGG + Exonic
1161207181 19:3047194-3047216 ATTAGGCGCGGCCGCGGCGCGGG + Intronic
1161357108 19:3825312-3825334 CGTGGGCTTGGCCTCTGCCCCGG + Exonic
1162523947 19:11197020-11197042 CCTGGGCTTGGCGGCTGGGCCGG - Intronic
1162523976 19:11197080-11197102 CTGGGGCATGGCCGCGGAGGAGG + Intronic
1162741374 19:12775589-12775611 CCTGGGCTTGGGGGCGGGGCGGG - Intronic
1163767225 19:19170382-19170404 CTTGGGCGTGGCCCCGACCCGGG + Intronic
1165417655 19:35704655-35704677 CTTGGGCTTGGGCCCGGCCCAGG + Intronic
1165454704 19:35903881-35903903 CTTGGGCGGGGCTGCGGCGTGGG - Exonic
1166368237 19:42287874-42287896 CGTGGGCTTGGCCTCTGAGCTGG - Exonic
1166856908 19:45786737-45786759 CTGGGGCGGGGCCGAGGCGCAGG + Exonic
1167145954 19:47680939-47680961 GTTGAGCATGGCCACGGCGCTGG - Exonic
925008998 2:468044-468066 CTTGGGCTGGGCAGCTCCGCCGG + Intergenic
928518324 2:32064131-32064153 CTCGGCCTCGGCCCCGGCGCCGG + Exonic
930692367 2:54377731-54377753 CTTGGGCTTGGCGTCGGGGCTGG + Intronic
932755722 2:74407931-74407953 CTTGAGCTTGGCAGAGGAGCCGG - Intergenic
933741471 2:85538000-85538022 CTGGGGCTGGGCCTCGGTGCAGG - Intergenic
935046640 2:99489527-99489549 CATGGGGCTGGCGGCGGCGCGGG + Intronic
936144772 2:109973312-109973334 CTTGGGCCTGGCCTTGGCCCTGG + Intergenic
936181458 2:110271275-110271297 CTTGGGCCTGGCCTTGGCCCTGG + Intergenic
936199914 2:110398157-110398179 CTTGGGCCTGGCCTTGGCCCTGG - Intergenic
937160895 2:119760050-119760072 CTTGGCTTTGGCCGCGGGGTCGG + Exonic
937973387 2:127566561-127566583 CTTGGCCTTGGCCTTGGCTCTGG - Intronic
941772767 2:169362199-169362221 CTAGGGCCGGGCGGCGGCGCGGG - Intronic
947729297 2:232419292-232419314 CTTGCACTGGGCCGCGCCGCCGG + Intergenic
948502848 2:238407648-238407670 CCTGGGCTTCCCAGCGGCGCAGG + Intergenic
1172533512 20:35652828-35652850 TTTGGGCCTGGCCCCGGCCCCGG - Exonic
1172771340 20:37384317-37384339 CTTGGGCTCGGCGGCCGCGGGGG - Exonic
1176146784 20:63569040-63569062 CGTGGACTTGGCAGCGGGGCTGG - Intronic
1176195684 20:63835567-63835589 TTGGGGCTTGGCAGGGGCGCAGG - Intergenic
1178493874 21:33071023-33071045 CCTGGGCCTGGCCGCCGTGCAGG + Exonic
1179028563 21:37700646-37700668 CAGGGGCTTGGCCGCTGCCCTGG - Intronic
1180064419 21:45405384-45405406 CCTGGCCATGGCCGCGGCGGCGG + Intronic
1180960708 22:19761109-19761131 CTCGGGCTCGGCGGCGGCGCTGG - Exonic
1181319632 22:21994623-21994645 CTTGGGCCTGGCCGTGGCCTGGG + Intergenic
1183437853 22:37805564-37805586 CTTGGGCTTGGCCGCAGGGGCGG - Exonic
1183715520 22:39531128-39531150 CTTGGGCTTGTCCGCAGCCTTGG - Intronic
1183845091 22:40536379-40536401 CTCAGTCTTTGCCGCGGCGCCGG + Intronic
950509952 3:13420140-13420162 GTTGAGCTTGGCCGCAGCGGCGG + Exonic
952451775 3:33440106-33440128 CGGGGGCTGGGCGGCGGCGCCGG - Exonic
954265923 3:49470316-49470338 CTTAGGCTTGGCGGTGGCGGCGG + Exonic
954852829 3:53617936-53617958 CCTGGGCTTGGCCTGGGTGCTGG - Intronic
955894824 3:63687876-63687898 CTTTGGCTTGGCTGAGGGGCTGG + Intergenic
956978971 3:74614602-74614624 CTGGCGCTTGGCGGCGGCGGCGG - Intergenic
960971255 3:123141647-123141669 CTTGGGGTTGCCCCCGGGGCAGG + Intronic
961887180 3:130103977-130103999 CTAGAGCTTGGCAGTGGCGCCGG - Intronic
963131820 3:141865271-141865293 CTTGGGCATGGTGGCAGCGCTGG + Intergenic
964801794 3:160565579-160565601 GATGGGCGTGGCCGCAGCGCCGG - Exonic
966927637 3:184655823-184655845 CTTGGGTTTGGCAGGGGCTCAGG - Intronic
968432907 4:569172-569194 CATGGGCTTGGCAGCGGCTTTGG - Intergenic
969214566 4:5711510-5711532 CTTTGGCTTGGCTGCCGCGCGGG + Exonic
969405107 4:6986565-6986587 CTTGGGCTAGGCCCCGTCACGGG + Intronic
969757666 4:9160713-9160735 CTAGAGCTTGGCAGTGGCGCTGG + Intergenic
980130106 4:128810212-128810234 CTTGGGCATTGCCGGGGCGGGGG + Intronic
984184630 4:176528747-176528769 CTTGGCCTTGGCCACGGAGCAGG - Intergenic
984639354 4:182144802-182144824 CTAGTGCCGGGCCGCGGCGCCGG + Intronic
990982029 5:61610679-61610701 CTCGGGCTTGTCAGCTGCGCCGG - Intergenic
992042367 5:72848539-72848561 CGGGGGCTGGGCCGCAGCGCGGG - Intronic
1001186948 5:169583598-169583620 CGTGGGCTTGGCGCAGGCGCAGG - Intergenic
1006443877 6:34068211-34068233 CTTGGGCTGGGCCACGCAGCTGG + Intronic
1010032899 6:71288847-71288869 CCCGGGCATGGCCGCGGCGAGGG - Exonic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1019531090 7:1503904-1503926 TGAGGGTTTGGCCGCGGCGCTGG + Exonic
1020320601 7:6936389-6936411 CTAGAGCTTGGCAGTGGCGCCGG - Intergenic
1022091464 7:27110452-27110474 CTTGGGGTGGCCCCCGGCGCTGG + Exonic
1023221115 7:37920903-37920925 CTTGGGCTTGCCCTCGGGCCGGG + Exonic
1027188839 7:75986568-75986590 CTTGGCCTTGGCATGGGCGCAGG + Exonic
1031454024 7:121957311-121957333 CTTGGGCATGGTGGCGGCGATGG + Intronic
1037865864 8:22441504-22441526 CTTCGGCTGGGCGGCGGCTCGGG + Intronic
1038808039 8:30812584-30812606 GCTGGGCTTGGGCGGGGCGCGGG - Exonic
1038883503 8:31639658-31639680 CTCGGGCGCGGCGGCGGCGCGGG + Intronic
1042865524 8:73353583-73353605 CTTGGGCTTGAGCGTGGCCCAGG + Intergenic
1043428404 8:80171350-80171372 CTCGGGCTTTGGCTCGGCGCGGG - Intronic
1043954313 8:86342993-86343015 CTGAGCCTTGGCCGCGGTGCTGG + Intronic
1048579646 8:135720335-135720357 CTTGGGCTTGGCTGTGTGGCTGG + Intergenic
1049599173 8:143499094-143499116 CTTGGGCTTGGCAGTGGTCCTGG - Intronic
1049766634 8:144358202-144358224 CTTGGGCTTGGCCGCGGCGCTGG + Exonic
1049873818 8:145002636-145002658 CTTTGTGTTGGCCGAGGCGCGGG - Intergenic
1051897721 9:22006034-22006056 CGTGGACTTGGCCGAGGAGCGGG - Exonic
1057308849 9:93928776-93928798 CTTGGGCTTTGCTGGGGCTCTGG + Intergenic
1060220104 9:121759997-121760019 CTTGAGCTTGCCCGTGGTGCGGG - Exonic
1061365906 9:130172435-130172457 CCTGGGCTGGGCGCCGGCGCCGG - Intergenic
1061537912 9:131260900-131260922 ATTGGGCTTGACCAGGGCGCTGG + Exonic
1062106266 9:134756646-134756668 CTTGGGGGTGGGCGCGGCTCTGG + Intronic
1062402635 9:136379154-136379176 CTTGGGCTTGGGCCGGGGGCCGG + Exonic
1062595980 9:137299470-137299492 GTTGGGCTTGGCCGTTGCGTGGG + Intergenic
1187067296 X:15854204-15854226 AATGGGCTCAGCCGCGGCGCGGG + Intronic
1187445261 X:19355526-19355548 CTTGGCCTTGGCCTTGGCCCCGG - Intronic
1189900225 X:45699050-45699072 CTTGGGCTTGGCAGAGCCGTTGG - Intergenic
1200134010 X:153865863-153865885 CTTGGGCCTGGCCTCAGGGCTGG - Intronic
1201939410 Y:19443772-19443794 CTTGGGCTGGGCGGTGGCTCTGG + Intergenic
1202048359 Y:20756358-20756380 CTTGTGCTCGGCCTGGGCGCCGG + Intronic