ID: 1049771956

View in Genome Browser
Species Human (GRCh38)
Location 8:144387007-144387029
Sequence TAGGCCCCTGCACTTGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 623}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049771956_1049771960 16 Left 1049771956 8:144387007-144387029 CCTGGGCCAAGTGCAGGGGCCTA 0: 1
1: 0
2: 1
3: 48
4: 623
Right 1049771960 8:144387046-144387068 ATTTGCAAATAAAGCTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049771956 Original CRISPR TAGGCCCCTGCACTTGGCCC AGG (reversed) Intronic
900202359 1:1415263-1415285 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
900647283 1:3714680-3714702 GAGGACCCTGCGCTTGGTCCCGG + Intronic
900994501 1:6113139-6113161 TGGGCCACTGCACCTGGCCGAGG - Intronic
901422204 1:9158700-9158722 TGAGCCACTGCACCTGGCCCAGG - Intergenic
901596157 1:10386829-10386851 TGGGCCACTGCGCCTGGCCCGGG + Intergenic
901730551 1:11276001-11276023 TAGGCCACTGGTCTTGGCTCTGG + Intronic
902131787 1:14267914-14267936 CATGCCACTGCACTTGGGCCTGG + Intergenic
902368344 1:15991264-15991286 CAGGGCCCTGCTCTTCGCCCAGG + Intergenic
902441811 1:16435358-16435380 TAGGCCACTGCACTCCACCCTGG - Intronic
902590002 1:17466975-17466997 TGGGCCACTGCACCTGGCCCTGG + Intergenic
904027687 1:27514830-27514852 TGAGCCACTGCGCTTGGCCCTGG - Intergenic
904095377 1:27972840-27972862 GATGCTCCTGCATTTGGCCCAGG + Exonic
904273053 1:29362962-29362984 TAAGCCACTGGGCTTGGCCCAGG + Intergenic
904483372 1:30807645-30807667 TCGGGCCCTGCGCTTGGCCCGGG + Intergenic
904670985 1:32165403-32165425 TGAGCCACTGCACCTGGCCCAGG - Intronic
905434811 1:37949005-37949027 AAACCCCCTGCACTGGGCCCTGG - Intergenic
905557729 1:38900336-38900358 TGAGCCACTGCACTCGGCCCAGG - Intronic
905750496 1:40458801-40458823 TGAGCCACTGCACTGGGCCCTGG + Intronic
906223202 1:44099494-44099516 TGAGCCACTGCACCTGGCCCAGG - Intergenic
906499193 1:46328612-46328634 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
907306043 1:53513699-53513721 GAGGCACCAGCACTGGGCCCAGG + Intronic
908785730 1:67732884-67732906 TGGGCCCCTCCATTTGGTCCAGG + Intronic
909006050 1:70277902-70277924 TGAGCCACTGCACCTGGCCCAGG - Intronic
910118448 1:83758087-83758109 TGGGCCTCTGGACTTGGACCAGG + Intergenic
910852834 1:91665490-91665512 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
910923206 1:92371741-92371763 TGAGCCACTGCACCTGGCCCAGG - Intronic
911826665 1:102495400-102495422 TAGGCCTGGGAACTTGGCCCAGG - Intergenic
913016641 1:114743434-114743456 CCGGCCCCTGCACTGCGCCCTGG + Intronic
913317724 1:117566662-117566684 CACTCCCCAGCACTTGGCCCAGG - Intergenic
913697929 1:121345932-121345954 TAAGCCACTGCACCCGGCCCTGG + Intronic
914139622 1:144934119-144934141 TAAGCCACTGCACCCGGCCCTGG - Intronic
914462724 1:147899546-147899568 TGAGCCACTGCACCTGGCCCAGG - Intergenic
914724716 1:150318081-150318103 TGAGCCCCTGCACCTGGCCATGG - Intergenic
915187871 1:154122773-154122795 TGAGCCACTGCACCTGGCCCTGG - Intronic
915252283 1:154599210-154599232 TAGGCCTCTGGACTTAGCCTAGG + Intronic
915370214 1:155343262-155343284 TGAGCCACTGCACTTGGCCGAGG + Intronic
915408783 1:155683962-155683984 TGAGCCACTGCACCTGGCCCAGG - Intronic
915939398 1:160109346-160109368 AGGCCCCCTCCACTTGGCCCAGG - Intergenic
916171657 1:162005606-162005628 TGGGCCACTGTACCTGGCCCTGG - Intronic
916471816 1:165131048-165131070 TGAGCCACTGCACTTGGCCTAGG - Intergenic
917028621 1:170666674-170666696 GAGGCCGCTGGCCTTGGCCCTGG - Intronic
917115950 1:171603747-171603769 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918647282 1:186918993-186919015 TAGGCCACTGGCCTTGGCCAGGG + Intronic
918931456 1:190860718-190860740 AAGGACCCTGGACCTGGCCCAGG + Intergenic
920194394 1:204217187-204217209 CAGGCCCCTGCAGGTGGCCAGGG + Intergenic
920450305 1:206055834-206055856 TAGGCCACTGGCCTTGGCCAGGG - Intronic
920485326 1:206364582-206364604 TAAGCCACTGCACCCGGCCCTGG + Intronic
920564703 1:206964115-206964137 TGGTCCCCTCCACTTGTCCCAGG - Intronic
920678359 1:208054385-208054407 TGGGCACCTGCACCTGGCCCTGG + Intronic
920691123 1:208147064-208147086 TGCGCCACTGCACTTGGCCTGGG - Intronic
920877837 1:209853971-209853993 TAAGCCTCTGCAGTTAGCCCTGG + Exonic
921074770 1:211691534-211691556 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
921142030 1:212317702-212317724 TAAGCCACTGAACCTGGCCCTGG - Intronic
921927281 1:220721898-220721920 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
922501880 1:226103287-226103309 TAGGCCACTGCACCCGGCCGGGG + Intergenic
922517270 1:226217169-226217191 TGAGCCACTGCACCTGGCCCAGG + Intergenic
922680628 1:227592419-227592441 TAGGCCACTGGCCTTGGCCAGGG + Intronic
922690286 1:227683684-227683706 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
922962807 1:229662806-229662828 TTAGCCCCCGCACCTGGCCCTGG + Intergenic
923769821 1:236928729-236928751 TAGACCCCTCCTCTTGGCCAAGG + Intergenic
924567492 1:245210752-245210774 TTGGTCCCTGCACTTGGAACTGG - Intronic
924858947 1:247901363-247901385 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1063039149 10:2318799-2318821 TGAGCCACTGCGCTTGGCCCTGG + Intergenic
1063879302 10:10514567-10514589 TAGGCTCCTGCTCTCGGCCAGGG - Intergenic
1064118014 10:12595479-12595501 TAGGCTCATGAACTTGGGCCTGG + Intronic
1065720445 10:28623908-28623930 TAAGCCACTGCACCTGGCCCAGG - Intergenic
1065802289 10:29363490-29363512 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1065969453 10:30794908-30794930 TGAGCCACTGCACCTGGCCCGGG + Intergenic
1066229100 10:33414570-33414592 TGAGCCACTGCACTTGGCCTGGG - Intergenic
1067147850 10:43706474-43706496 CAGCCCCCTGCCCTGGGCCCCGG - Intergenic
1067936609 10:50617854-50617876 TGAGCCACTGCACCTGGCCCTGG + Intronic
1068671670 10:59729507-59729529 TAGGCCACTGGCCTTGGCCAGGG + Intronic
1069254012 10:66309774-66309796 TGAGCCACTGCACTTGGCCAAGG - Intronic
1069387380 10:67896425-67896447 TAGGCCACTGCACCCGGCCTTGG + Intronic
1069390729 10:67931804-67931826 TATACCACTGCACTTGACCCTGG - Intronic
1069938366 10:71935623-71935645 TGAGCCACTGCACATGGCCCTGG + Intergenic
1070688831 10:78509800-78509822 CAGGCCCCTGCACTTGCTCCTGG - Intergenic
1070703332 10:78619033-78619055 GAGGCCCCTGTACAGGGCCCTGG - Intergenic
1070769054 10:79071633-79071655 CCGGCCCCTGCACTGGGGCCAGG - Intronic
1070870049 10:79743695-79743717 TGGGGCCCTGGACCTGGCCCAGG - Intergenic
1071236858 10:83658861-83658883 TGAGCCGCTGCACTTGGCCAGGG + Intergenic
1071288293 10:84169059-84169081 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1071658274 10:87472039-87472061 TGGGGCCCTGGACCTGGCCCAGG + Intergenic
1071951485 10:90708033-90708055 TGAGCCACTGCACCTGGCCCGGG - Intergenic
1072034757 10:91553516-91553538 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1072074110 10:91951107-91951129 TGAGCCACTGCACCTGGCCCAGG + Intronic
1073343741 10:102766156-102766178 TGAGCCACTGCACCTGGCCCTGG - Intronic
1073474441 10:103743652-103743674 TGAGCCACTGCACCTGGCCCAGG + Intronic
1073753428 10:106555752-106555774 CAGGCCCCTGCACTTCTTCCTGG - Intergenic
1074206612 10:111288303-111288325 TATGGCCCTGGACTAGGCCCTGG + Intergenic
1074245066 10:111681321-111681343 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1074857612 10:117485034-117485056 TATATCCCAGCACTTGGCCCAGG - Intergenic
1076137603 10:128055781-128055803 TAGGCACCTGCTCTAGGCCAGGG + Intronic
1076564571 10:131389361-131389383 TTGGCCCCTGCACTTGAGCAAGG + Intergenic
1077375160 11:2202287-2202309 AAGGCTCCTTCACCTGGCCCTGG + Intergenic
1078194069 11:9120269-9120291 TGAGCCACTGCACCTGGCCCAGG + Intronic
1078239106 11:9513991-9514013 TCTGCCACTGCACTTTGCCCTGG - Intronic
1079061900 11:17256218-17256240 TAGGCCACTGCACTCTGGCCTGG + Intronic
1079999770 11:27334076-27334098 CAGGCCACTGCACCTGGCTCTGG + Intronic
1080518067 11:33041465-33041487 TGAGCCACTGCACCTGGCCCAGG - Intronic
1081523201 11:43902878-43902900 TGAGCCACTGCACCTGGCCCAGG + Intronic
1082983466 11:59145138-59145160 TCGACCCCTGCCCTTGCCCCTGG + Exonic
1083090017 11:60190138-60190160 TAGGCCACTGTCCTTGGCCAGGG - Intergenic
1083600748 11:63946101-63946123 TTGGCGCCAGCAGTTGGCCCAGG + Intronic
1083636195 11:64122325-64122347 AATGCCCCTGCTCTTGGCTCCGG - Intronic
1083781586 11:64921237-64921259 TGAGCCCCTGCACCTGGCCTAGG + Intronic
1083874033 11:65510655-65510677 TGAGCCACTGCACCTGGCCCGGG + Intergenic
1083893557 11:65608891-65608913 CAGGCCACTGCACCTGGCCGAGG + Intronic
1084301349 11:68254603-68254625 CAGGCCCCTGCCGTGGGCCCTGG + Intergenic
1084673640 11:70622016-70622038 CAGGCCCCTCCACATGGCGCTGG - Intronic
1084684152 11:70684065-70684087 TGAGCCACTGCACCTGGCCCTGG + Intronic
1084934614 11:72580201-72580223 GAGTTCCCTGCACTTGGCACAGG - Intronic
1085455673 11:76664093-76664115 TATGCCTCTGCACTTGCCCGGGG - Intronic
1086108548 11:83173409-83173431 CAGGCCACTGCACTTAGGCCTGG + Intronic
1086639854 11:89140338-89140360 TGAGCCACTGCACCTGGCCCTGG - Intergenic
1086973327 11:93106550-93106572 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1087032636 11:93720878-93720900 TAAGCCACCGCACCTGGCCCTGG + Intronic
1087471818 11:98584892-98584914 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1087684641 11:101249245-101249267 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1087761885 11:102110887-102110909 AAGGCGGCTGCCCTTGGCCCTGG - Exonic
1088272842 11:108052543-108052565 TGAGCCACTGCACCTGGCCCAGG + Intronic
1088388844 11:109290944-109290966 TAGGGCCCTGGCCCTGGCCCAGG + Intergenic
1088766702 11:112988790-112988812 TGGGCCACTGCACTTCGGCCTGG - Intronic
1089341619 11:117761825-117761847 TATGCCCCTGCACTTCAGCCTGG + Intronic
1089961918 11:122624034-122624056 TAGTCACCTGCCCTTGGCCTAGG - Intergenic
1090445471 11:126761259-126761281 CAGGCCCCTGCACTCTGCCCAGG + Intronic
1090474035 11:127003793-127003815 CAGGACCCAGCACTTGGCACCGG - Intergenic
1091180087 11:133596440-133596462 TGGACCCCAGCACTTGGCCCAGG - Intergenic
1091552348 12:1546068-1546090 TGAGCCACTGCACTTGGCCCTGG + Intronic
1091622695 12:2101397-2101419 GAGCCTCCTGCACTTTGCCCGGG - Intronic
1091772847 12:3164534-3164556 CTGGCCCTTGCACTTGTCCCAGG + Intronic
1092614968 12:10208735-10208757 TGCGCCACTGCACCTGGCCCAGG - Intergenic
1093593986 12:20940084-20940106 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1093629127 12:21387390-21387412 GAGGGCCCTGGACCTGGCCCAGG - Intronic
1093928409 12:24931187-24931209 TGAGCCACTGCACCTGGCCCAGG + Intronic
1093969267 12:25360050-25360072 CACGCCACTGCACTTGGGCCTGG - Intergenic
1094814325 12:34168441-34168463 TAGGCCCCTGCAGTTGGGAAAGG - Intergenic
1094830513 12:34298051-34298073 GCAGCCCCTGCACTGGGCCCTGG + Intergenic
1095097024 12:38154401-38154423 TCAGCCCCTGCACTGGGCCCGGG + Intergenic
1095102598 12:38200148-38200170 TAGGCCCCTGCAGTTGGGAAAGG + Intergenic
1095944296 12:47745417-47745439 CAGACCCCTGTCCTTGGCCCAGG + Intronic
1096207853 12:49738452-49738474 TAGGCCACTGGCCTTGGCCATGG - Intronic
1096299012 12:50409475-50409497 TGAGCCACTGCACCTGGCCCTGG - Intronic
1096379490 12:51144071-51144093 TATGCCACTGCACTTGGCCTGGG - Intronic
1096729273 12:53594602-53594624 TAAGCCACCGCACTTGGCCTGGG - Intronic
1096780877 12:53991459-53991481 TATTCCCCTGCATCTGGCCCTGG - Intronic
1096917413 12:55048059-55048081 CAGGCCCCTGCACTTCAGCCTGG + Intergenic
1097028242 12:56074355-56074377 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1097955828 12:65484324-65484346 CAGGGTCCTGCACCTGGCCCAGG + Intronic
1098248518 12:68544919-68544941 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1098592347 12:72228440-72228462 GAAGGCCCTGGACTTGGCCCAGG + Intronic
1098639418 12:72821308-72821330 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1100089148 12:90949063-90949085 TCTGCCCCTGCCCTTGCCCCAGG - Intronic
1100183425 12:92109942-92109964 TAAGCCACTGCACTCAGCCCAGG + Intronic
1100770667 12:97918888-97918910 TATGCCACTGCACTCCGCCCTGG + Intergenic
1101489117 12:105195769-105195791 TGAGCCACTGCACCTGGCCCTGG - Intronic
1101811514 12:108111944-108111966 TGAGCCACTGCACCTGGCCCTGG - Intergenic
1101900921 12:108790565-108790587 TGAGCCACTGCACCTGGCCCAGG + Intronic
1102212476 12:111137554-111137576 TGGGCCACTGCACTTGTGCCTGG - Intronic
1102677277 12:114667446-114667468 TCGGCCCCTGCAATTAGCGCCGG + Intergenic
1103328430 12:120137178-120137200 CAGCCCCCTGCACGAGGCCCTGG + Intronic
1103632922 12:122277239-122277261 TGAGCCACTGCACCTGGCCCAGG + Intronic
1103741815 12:123096282-123096304 CATGCCCCAGCTCTTGGCCCTGG + Intronic
1104815879 12:131645101-131645123 CAGGCCCCTGCCCCAGGCCCAGG - Intergenic
1105423382 13:20272746-20272768 TGAGCCACTGCACTTGGCCTGGG - Intergenic
1105695730 13:22886787-22886809 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1105935131 13:25091463-25091485 TGAGCCACTGCACTTGGCCTTGG - Intergenic
1106311221 13:28556246-28556268 CAATCCACTGCACTTGGCCCAGG + Intergenic
1106379229 13:29220282-29220304 TGAGCCACTGCACCTGGCCCTGG + Intronic
1106919361 13:34547248-34547270 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1107554591 13:41506822-41506844 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1107766634 13:43742323-43742345 TAGGCCTTTGGACTTGGACCAGG - Intronic
1107955894 13:45510980-45511002 TAGGCCACTGTCCTGGGCCCTGG - Intronic
1109342504 13:61079100-61079122 TAGACCCCTCCTCTTGGCCAAGG + Intergenic
1109531860 13:63660104-63660126 CATGTCCCTGCACTTGGCCTGGG - Intergenic
1110653584 13:77971451-77971473 TAGGCCACTGGCCTTGGCCAAGG + Intergenic
1111373748 13:87352040-87352062 AAAGCCCCTGCACTTCCCCCTGG - Intergenic
1111530981 13:89537710-89537732 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1111716685 13:91887319-91887341 GGGGCACCTGCACCTGGCCCAGG + Intronic
1111883206 13:93985149-93985171 TGAGCCCCTGCGCCTGGCCCTGG - Intronic
1112445492 13:99460837-99460859 TAGGCCCTTACAATTGGCCATGG - Intergenic
1112864173 13:103872815-103872837 TGGGGCCCTGAGCTTGGCCCAGG + Intergenic
1113884740 13:113652555-113652577 GAGGCCCCTTTACCTGGCCCTGG + Intronic
1114075069 14:19157458-19157480 TCAGCCCCTGCGCTGGGCCCCGG + Intergenic
1114086783 14:19240804-19240826 TCAGCCCCTGCGCTGGGCCCCGG - Intergenic
1114087200 14:19242519-19242541 TCAGCCCCTGCGCTGGGCCCCGG - Intergenic
1114553144 14:23545784-23545806 TAGACCCATGCCCATGGCCCAGG + Intronic
1115327313 14:32154430-32154452 TGAGCCACTGCACCTGGCCCAGG + Intronic
1116812332 14:49551484-49551506 TGGGCCACTGCACTTAACCCTGG - Intergenic
1116842430 14:49832980-49833002 TGGGCCACTGCACCCGGCCCAGG - Intronic
1116922502 14:50594709-50594731 TAAGCCACTGCACCCGGCCCTGG - Intronic
1117361828 14:54982879-54982901 TGAGCCACTGCACCTGGCCCAGG - Intronic
1117975099 14:61289421-61289443 TAAGCCACTGCACCTGGCCTTGG - Intronic
1119106749 14:71932312-71932334 TGGGCCCCGGCACCTGGGCCCGG - Intergenic
1119241393 14:73063103-73063125 TGAGCCACTGCACCTGGCCCAGG + Intronic
1119632203 14:76242891-76242913 TGAGCCACTGCACTTGGCCTTGG - Intronic
1119749808 14:77069077-77069099 TGGGCACCTGCACCTGGGCCTGG - Intergenic
1120861095 14:89255679-89255701 AAGGCCCTTGCTCCTGGCCCAGG + Intronic
1122234881 14:100325863-100325885 AAGGCCCCTGCACCTGTCCACGG + Intronic
1122815062 14:104308113-104308135 TAGGCCCCTGTCCTTGGCTCAGG + Intergenic
1122992361 14:105242830-105242852 TAAGCCGCAGCACCTGGCCCCGG - Intronic
1202898314 14_GL000194v1_random:22399-22421 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1202898528 14_GL000194v1_random:23226-23248 TGAGCCCCTGCGCTGGGCCCTGG - Intergenic
1123404582 15:20012187-20012209 TGGGCACCTGCACTAGACCCTGG + Intergenic
1123513915 15:21018834-21018856 TGGGCACCTGCACTAGACCCTGG + Intergenic
1123804267 15:23854954-23854976 TGGGCCCCTGCCCTTGGTGCAGG + Intergenic
1123993941 15:25705155-25705177 TGTGCCCCTGCACCAGGCCCAGG - Intronic
1124110762 15:26783980-26784002 CATGCCACTGCACTTGGCCTGGG - Intronic
1124937869 15:34189305-34189327 TGAGCCACTGCACCTGGCCCTGG + Intronic
1125846248 15:42857230-42857252 TGAGCCACTGCACCTGGCCCTGG - Intronic
1126676050 15:51160113-51160135 TAGGCCAGTGCCCTTGGCACCGG - Intergenic
1127418765 15:58784040-58784062 TGAGCCACTGCACTCGGCCCTGG - Intronic
1127588219 15:60397833-60397855 GAGGCCCCGGCAACTGGCCCCGG - Intronic
1127628551 15:60804004-60804026 TGAGCCACTGCACCTGGCCCTGG - Intronic
1128042878 15:64591144-64591166 TGAGCCACTGCACTTGGCCTCGG - Intronic
1128055907 15:64700035-64700057 CAGGCTCCTCCACTTGGCCTGGG - Intronic
1128351123 15:66890050-66890072 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1128442842 15:67729485-67729507 TAAGCCACTGCACCTGGCCATGG - Intronic
1128705734 15:69836428-69836450 CAGACCCCTGCACTTGGCAAAGG + Intergenic
1129177223 15:73848669-73848691 TCTGCTCCTGCACTTGGCTCTGG - Intergenic
1129537583 15:76326785-76326807 CATGCCACTGCACTTGGCCTGGG - Intergenic
1130104291 15:80917989-80918011 TGAGCCACTGCACCTGGCCCAGG - Intronic
1130433568 15:83873997-83874019 TAGGACCCCGGGCTTGGCCCTGG - Intronic
1131429655 15:92376680-92376702 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1132162691 15:99557477-99557499 TGAGCCACTGCACCTGGCCCTGG - Intergenic
1132420940 15:101667875-101667897 TGAGCCACTGCACCTGGCCCTGG + Intronic
1133301389 16:4784824-4784846 TAAGCCACCGCACCTGGCCCTGG - Intronic
1133390712 16:5407830-5407852 TGAGCCACTGCACATGGCCCAGG + Intergenic
1133477067 16:6133978-6134000 TGCGCCACTGCACTTGACCCTGG - Intronic
1134114986 16:11541377-11541399 TTGACCCATGCACTTTGCCCAGG + Intergenic
1135094476 16:19554019-19554041 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1135783682 16:25328631-25328653 CAGGCCACTGCACTTGAGCCTGG + Intergenic
1135990883 16:27218028-27218050 TGAGCCACTGCACATGGCCCTGG - Intronic
1136109003 16:28052978-28053000 CAGGCAGCTCCACTTGGCCCGGG - Intronic
1136254710 16:29030260-29030282 TGGGCCACTGCACCTGGCCCTGG + Intergenic
1136275903 16:29179471-29179493 GAGGCGCCTGCAATGGGCCCAGG + Intergenic
1136448745 16:30340202-30340224 CATGCCCCTGCACCTGGGCCAGG + Intergenic
1137033123 16:35543668-35543690 CAGGCCCCGGCGCTGGGCCCCGG + Intergenic
1137248901 16:46728964-46728986 TAAGCCCCAGCACTGAGCCCTGG + Intronic
1137569726 16:49557569-49557591 CAGGCCCCTGATATTGGCCCAGG + Intronic
1137923379 16:52514726-52514748 TAAGCCACCGCACCTGGCCCTGG - Intronic
1138024900 16:53514705-53514727 TAAGCCACTGCACCTGGCCATGG - Intergenic
1139873177 16:70124077-70124099 TGAGCCACTGCACTTGGCCGAGG - Intronic
1140040331 16:71403243-71403265 TGGCCCCCAGCAATTGGCCCAGG + Intergenic
1140737496 16:77911433-77911455 CAGGCCCCTGCCCAAGGCCCTGG + Intronic
1141071672 16:80962051-80962073 TGAGCCACTGCACCTGGCCCTGG - Intergenic
1141767914 16:86070812-86070834 TAGGTCCCTCCCCTTGGACCTGG - Intergenic
1141954417 16:87360892-87360914 CAGGGCCCTGCACTGGGCCCTGG - Intronic
1141970058 16:87475266-87475288 TGAGCCACTGCACCTGGCCCTGG - Intronic
1203124254 16_KI270728v1_random:1561216-1561238 TTGGCCCCTGCTCCTGACCCTGG + Intergenic
1143207408 17:5153935-5153957 TGAGCCACTGCACCTGGCCCTGG + Intronic
1144260095 17:13510131-13510153 GAGGGGCCTGCCCTTGGCCCAGG - Intronic
1144794749 17:17883449-17883471 TAAGCCACCGCACCTGGCCCAGG - Intronic
1144827501 17:18114533-18114555 TGAGCCACTGCACCTGGCCCTGG + Intronic
1145861588 17:28215636-28215658 TAAGCCACTGCACCTGGCCAGGG + Intergenic
1145901276 17:28491881-28491903 CAGGTCCCTGCCCTTAGCCCTGG + Intronic
1146189643 17:30753510-30753532 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1146334534 17:31957826-31957848 TGAGCCACTGCACCTGGCCCTGG + Intronic
1146334541 17:31957859-31957881 TGAGCCACTGCACCTGGCCCTGG + Intronic
1146353242 17:32113240-32113262 TAAGCCACTGCACCTGGCCATGG + Intergenic
1146387208 17:32387929-32387951 TAGGCCACTGCACTCCGGCCTGG - Intergenic
1146921496 17:36715805-36715827 TGAACCACTGCACTTGGCCCAGG + Intergenic
1147810182 17:43163234-43163256 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1147987162 17:44313242-44313264 CAGGCCCCTCACCTTGGCCCGGG - Exonic
1148025374 17:44583958-44583980 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1148135728 17:45290479-45290501 TAGGCCCCTACACTCAGCCTGGG + Exonic
1148202291 17:45757197-45757219 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1148401613 17:47367405-47367427 TGGGCCACTCCCCTTGGCCCTGG + Intronic
1148599778 17:48885350-48885372 CAGGCCACTGCGCCTGGCCCGGG - Intergenic
1149872945 17:60199910-60199932 TGAGCCACTGCACCTGGCCCTGG - Intronic
1151265835 17:72954348-72954370 TAGTCCCCTGACCTTGGCCTTGG - Intronic
1151273277 17:73013369-73013391 TGAGCCTCCGCACTTGGCCCTGG + Intronic
1151289160 17:73136413-73136435 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1151469199 17:74307381-74307403 TAGCCCACTGCACCTGGCCCAGG - Intronic
1151674417 17:75590180-75590202 GAGGCTCCTGCCCTTGGCACCGG - Intergenic
1152526540 17:80891273-80891295 TTGTCCGCTGCACTCGGCCCTGG + Intronic
1152816267 17:82409976-82409998 CAGGCTCCTGAGCTTGGCCCAGG - Intronic
1203162106 17_GL000205v2_random:62556-62578 TCAGCCCCTGCACATGGCCCCGG - Intergenic
1203162276 17_GL000205v2_random:63213-63235 TCAGCCCCTGCGCATGGCCCCGG - Intergenic
1153123814 18:1765039-1765061 TAGGCCCTTGGACTTTGACCAGG + Intergenic
1153884386 18:9450392-9450414 TAGTCTCCTGCACTGGGCCCCGG + Intergenic
1154933396 18:21025434-21025456 TGAGCCACTGCACCTGGCCCTGG - Intronic
1155278135 18:24210141-24210163 TGAGCCACTGCACCTGGCCCTGG - Intronic
1159144860 18:64441612-64441634 TAAGCCACTGCACCTGGCCTAGG - Intergenic
1160223362 18:76992918-76992940 AAGGACCCTGCACAAGGCCCAGG - Intronic
1161342626 19:3751409-3751431 GAGGCCCCGGCCCCTGGCCCCGG - Intronic
1161969142 19:7566672-7566694 TGAGCCACTGCACTTGGCCTGGG - Intergenic
1162282026 19:9706509-9706531 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1162284296 19:9726761-9726783 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1162612429 19:11767061-11767083 CACGCCCCTGCACTGGGCTCCGG + Intronic
1162633193 19:11945035-11945057 TAGGCCACTGGCCTTGGCCAGGG + Intronic
1163173079 19:15546298-15546320 TGAGCCACTGCACCTGGCCCAGG - Intronic
1163263616 19:16205611-16205633 TAGGCCCATGCACTGCACCCTGG - Intronic
1163692481 19:18745205-18745227 AAGGCGCCTGTACTTGGCTCTGG + Intronic
1163694333 19:18756048-18756070 TAAGCCACTGCACCTGGCCTAGG - Intronic
1164121430 19:22268890-22268912 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1164216828 19:23157884-23157906 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1164747828 19:30628984-30629006 TGGGCCACTGCGCCTGGCCCAGG + Intronic
1165092958 19:33396269-33396291 TGGGCCCCTGCCCCTGGCGCTGG + Intronic
1165177563 19:33941346-33941368 TGGGCCCCTGCTCTTGTCACTGG + Intergenic
1165227856 19:34366778-34366800 CACGCCCCTGGACTTGGCCTAGG - Exonic
1165498953 19:36172144-36172166 TGCGCCACTGCACTTGGGCCTGG + Intergenic
1166227491 19:41405706-41405728 TCTGCCACTGCACTTGGCTCAGG + Intronic
1166368596 19:42289666-42289688 TAGGCTCCTGCACTGGGCAGTGG + Intronic
1166458857 19:42968489-42968511 CAGGCCACTGCACTTCACCCTGG - Intronic
1166475806 19:43123760-43123782 CAGGCCGCTGCACTTCACCCTGG - Intronic
1166534195 19:43561875-43561897 TGAGCCACTGCACCTGGCCCAGG - Intronic
1166771332 19:45284667-45284689 TAAGCCACTGCACTCAGCCCTGG - Intronic
1166779385 19:45332893-45332915 TAGGCCCCTTCACATGGACATGG + Intergenic
1166996894 19:46723691-46723713 AAAGCCCATGCACTTGGCCATGG - Intronic
1167315332 19:48759643-48759665 TGTGCCACTGCACTTGGGCCTGG - Intergenic
1167316549 19:48766678-48766700 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1167681659 19:50926689-50926711 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1167687344 19:50964781-50964803 TGGGCTCCTCCACTTGGCACTGG + Intronic
1168048679 19:53812330-53812352 TGAGCCACTGCACTTAGCCCAGG - Intronic
1202647933 1_KI270706v1_random:158307-158329 TCAGCCCCTGCACTGGGCCCCGG + Intergenic
926324625 2:11773764-11773786 TAAGCCTCTGCACTGGGCCAGGG - Intronic
926491320 2:13529000-13529022 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
926868938 2:17391425-17391447 TAGGGCCCTGGACCTGGCCCAGG - Intergenic
927242187 2:20928805-20928827 TGGGCCCCTGGACCTGGCCCAGG + Intergenic
928345521 2:30490472-30490494 TGAGCCACTGCACCTGGCCCGGG + Intronic
928442527 2:31303999-31304021 TGGCCCCCTGCACTGGGCTCTGG - Intergenic
929139114 2:38651784-38651806 TGAGCCACTGCACCTGGCCCTGG - Intergenic
929529008 2:42733781-42733803 TGAGCCACTGCACCTGGCCCAGG + Intronic
929536828 2:42789024-42789046 TAGGACCCTGCACTCTCCCCTGG + Intronic
929695660 2:44113152-44113174 TAAGCCACTGCACCTGGCCAGGG + Intergenic
931665978 2:64609649-64609671 TTGGCCCCAGGACTGGGCCCAGG - Intergenic
931738738 2:65222771-65222793 TAAGCCACTGCACCTGGCCTAGG - Intergenic
932563311 2:72890622-72890644 TGAGCCACTGCACTTGGCCTAGG + Intronic
932571812 2:72942230-72942252 TAGGCTCCTGCCCTTTTCCCAGG + Exonic
932744991 2:74326535-74326557 TGAGCCACTGCACGTGGCCCAGG - Intronic
932749595 2:74362938-74362960 CTGCCCCCTCCACTTGGCCCAGG - Intronic
933102796 2:78281968-78281990 CAAGGCCCTGCACCTGGCCCAGG - Intergenic
933565313 2:83943379-83943401 CAGGCCCTTGCACAAGGCCCAGG + Intergenic
934014460 2:87864333-87864355 TAGGCCTTTGCATTTGGACCGGG + Intergenic
934049077 2:88195112-88195134 TGGGCCACTGCACCTGGCCTCGG - Intergenic
934583006 2:95461814-95461836 TATGCCACTGCACTTCACCCTGG - Intergenic
934596444 2:95614900-95614922 TATGCCACTGCACTTCACCCTGG + Intergenic
934640360 2:96024037-96024059 TAGGCCCCTGCCCATGTGCCTGG - Intronic
934786325 2:97010649-97010671 TATGCCACTGCACTTCACCCTGG - Intronic
934793292 2:97081379-97081401 TAGGCCCCTGCCCATGTGCCTGG + Intergenic
935721357 2:105982141-105982163 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
935970711 2:108528417-108528439 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
936040261 2:109144676-109144698 TATGCCACTGCACTGGGTCCAGG + Intronic
936419468 2:112349468-112349490 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
936430326 2:112457104-112457126 TATGTCCATTCACTTGGCCCAGG - Intergenic
937012260 2:118573109-118573131 TAAGCCACTGCACCTGGCCGAGG - Intergenic
937650191 2:124310887-124310909 TAGGCACTTGCACAAGGCCCTGG - Intronic
937951573 2:127391951-127391973 TAGACCCCTCCTCTTGGCCAAGG - Intergenic
938489549 2:131754602-131754624 TCAGCCCCTGCGCTGGGCCCTGG + Intronic
938489606 2:131754804-131754826 TCAGCCCCTGCACTGGGACCCGG + Intronic
938489828 2:131755640-131755662 TCAGCCCCTGCACTGGGCCCCGG + Intronic
938657449 2:133448681-133448703 CATGCCACTGCACTTGGCCTGGG - Intronic
940818470 2:158324198-158324220 TGAGCCACTGCACCTGGCCCAGG + Intronic
940961230 2:159788415-159788437 TAGGCTCCAGCACGTGGCCTAGG + Intronic
945072958 2:206009262-206009284 TGCGCCACTGCACTTGGCCTGGG + Intronic
945289874 2:208116477-208116499 TAGGCCACTGACCTTGGCCAGGG - Intergenic
946410474 2:219512990-219513012 TAGGCCCCTCCCCTGGGGCCAGG + Intergenic
946954978 2:224919889-224919911 TGGGCCACTGCACTTGCTCCAGG + Intronic
947219723 2:227780774-227780796 TGAGCCACTGCACCTGGCCCAGG + Intergenic
947245546 2:228043608-228043630 TGAGCCACTGCACTTGGCCAAGG + Intronic
947820679 2:233067059-233067081 TGAGCCACTGCACCTGGCCCTGG + Intronic
948057029 2:235016176-235016198 GTGGCCACTGCACTGGGCCCAGG + Intronic
948375808 2:237519615-237519637 TGAACCCCTGCACTTGCCCCAGG - Intronic
948644063 2:239392847-239392869 AAGGCCCCTGCAGATGGGCCAGG + Intronic
948946272 2:241221645-241221667 TGAGCCACTGCACTTGGCCTAGG + Intronic
1168755091 20:310635-310657 TAGAGCCCTGCCCTCGGCCCAGG + Intergenic
1170400978 20:15982939-15982961 TAGGCCACTGGCCTTGGCCAGGG + Intronic
1171144099 20:22766710-22766732 TAGGCATGTGCTCTTGGCCCTGG + Intergenic
1171184496 20:23115289-23115311 TAAGCCACTGCACTTAGCCATGG + Intergenic
1172639345 20:36431692-36431714 AAGGCCCCTGCCCTCGGCCCGGG + Exonic
1173783763 20:45777392-45777414 TATGCCACTGCACTTTGGCCTGG - Intronic
1173859977 20:46277003-46277025 TAGGCCACTGCACCCGGCCTGGG - Intronic
1174350213 20:49962056-49962078 TGAGCCCCTGCCCCTGGCCCAGG + Intergenic
1174650831 20:52123911-52123933 AAGGCCACTGCACTTGAGCCTGG - Intronic
1175513761 20:59554609-59554631 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1175586369 20:60143800-60143822 TGGCCTCCTGCACTAGGCCCTGG - Intergenic
1176603916 21:8814422-8814444 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1176618001 21:9038392-9038414 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1176618210 21:9039216-9039238 TGAGCCCCTGCGCTGGGCCCTGG - Intergenic
1176693741 21:9949113-9949135 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1176706631 21:10123242-10123264 TCAGCCCCTGCGCTGGGCCCTGG + Intergenic
1176706931 21:10124477-10124499 TCAGCCCTTGCACTGGGCCCCGG + Intergenic
1178342152 21:31794761-31794783 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1178539517 21:33437698-33437720 TGGGCCACTGCACTAGGCCCTGG - Intronic
1179007744 21:37529920-37529942 TGGGCCCTTGCCCTTGGCCATGG - Intergenic
1179094644 21:38301744-38301766 TAGACCCCTGAATTTGGCCCGGG - Exonic
1179773376 21:43642010-43642032 TGGGCCACTGCACCTGGCCCTGG - Intronic
1180214328 21:46314966-46314988 GAGGCGCCTGTACCTGGCCCAGG - Intronic
1180290717 22:10850372-10850394 TCAGCCCCTGCGCTGGGCCCCGG + Intergenic
1180291078 22:10851930-10851952 TCAGCCCCTGCGCTGGGCCCCGG + Intergenic
1180346200 22:11705999-11706021 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1180353773 22:11823303-11823325 TCAGCCCCTGCGCTAGGCCCCGG - Intergenic
1180353969 22:11824156-11824178 TCAGGCCCTGCACTGGGCCCCGG - Intergenic
1180384276 22:12168169-12168191 TCAGGCCCTGCACTGGGCCCCGG + Intergenic
1180384472 22:12169056-12169078 TCAGCCCCTGCGCTAGGCCCCGG + Intergenic
1180493518 22:15879794-15879816 TCAGCCCCTGCGCTGGGCCCCGG + Intergenic
1180493883 22:15881352-15881374 TCAGCCCCTGCGCTGGGCCCCGG + Intergenic
1180699172 22:17772552-17772574 TCAGCCCCTCCACTTGGCACCGG + Intronic
1181135059 22:20759325-20759347 TAAGCCACTGCACCTGGCCTGGG + Intronic
1181266983 22:21636154-21636176 CAGGTCCCTGCCCTTGCCCCAGG + Intronic
1181630335 22:24147822-24147844 TAGGACACTGCTCTGGGCCCAGG + Intronic
1182214284 22:28702828-28702850 TAAGCCACTGCACCTGGCCCTGG + Intronic
1182381227 22:29890187-29890209 TGAGCCACTGCACCTGGCCCAGG + Intronic
1183554560 22:38515192-38515214 TGAGCCACTGCACCTGGCCCCGG - Intergenic
1184159749 22:42691267-42691289 TAAGCCACTGCACCTGGCCCAGG - Intergenic
1184473049 22:44706809-44706831 TGAGCCACTGCACTTGGGCCAGG + Intronic
1184718523 22:46295890-46295912 AAGGCCTCTGCCCTGGGCCCCGG + Exonic
1185292523 22:50034358-50034380 TCGGCCCCGGGACTTGGCCGCGG + Exonic
949775552 3:7628769-7628791 GAGCTCCCAGCACTTGGCCCAGG + Intronic
949845193 3:8362609-8362631 AAGGGCCCTGTACTTGGCCTAGG + Intergenic
949926392 3:9045716-9045738 CAGGCCACTGCACCAGGCCCAGG + Intronic
950712818 3:14825319-14825341 TAAGCCACTGCACTCAGCCCAGG - Intronic
951131052 3:19045286-19045308 TGAGCCACTGCACTTGGCCGGGG + Intergenic
951166095 3:19486530-19486552 TAGGCCACTGGTCTTGGCCAGGG + Intronic
952409477 3:33034334-33034356 TAGGCCCCTGCTGTTGTACCTGG + Intronic
952481281 3:33764334-33764356 TAAGCCACTGCACTTGGCCTTGG - Intergenic
953946880 3:47156982-47157004 TGAGCCACTGCACCTGGCCCTGG - Intronic
954138520 3:48593449-48593471 TTGACCCCTGCACCTGTCCCAGG - Exonic
954678611 3:52329202-52329224 TACACCCCTTCACATGGCCCTGG + Intronic
954962244 3:54576749-54576771 TGAGCCACTGCACCTGGCCCTGG - Intronic
955053705 3:55437641-55437663 TAAGCCACTGCACCTGGCCCAGG - Intergenic
956245375 3:67176579-67176601 TAGGCCTCTGTTCTTGGCTCAGG - Intergenic
956663921 3:71624519-71624541 TGAGCCACTGCACCTGGCCCTGG - Intergenic
956701291 3:71961354-71961376 AAAGCCCATGCCCTTGGCCCTGG + Intergenic
956723504 3:72138483-72138505 GAGGCCCCAGCTCTTGGCCTTGG + Intergenic
956853778 3:73256220-73256242 TAGGCCACTGCACCCAGCCCAGG - Intergenic
956922194 3:73941468-73941490 TAAGCCACTGCACCTGGCCAGGG + Intergenic
956996130 3:74828304-74828326 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
957999780 3:87736606-87736628 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
958582560 3:96045265-96045287 TGGGGCCCTGGACCTGGCCCAGG + Intergenic
959089940 3:101891017-101891039 TAGCCTCCTGCACTAGGCCCTGG - Intergenic
960107037 3:113808964-113808986 TGAGCCACTGCACCTGGCCCAGG - Intronic
960200806 3:114833813-114833835 TAAGCCACTGCACCTGGCCGAGG + Intronic
961620249 3:128218238-128218260 TAGGCCTCTTCAGTTGGCTCTGG + Intronic
961817716 3:129559814-129559836 TAGCCCTCTGCACGTGGCCCGGG - Intronic
962096618 3:132299117-132299139 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
962097501 3:132307364-132307386 TAGGCCGCTGGCCTTGGCCAGGG - Intergenic
963241644 3:143009021-143009043 TGAGCCACTGCACCTGGCCCAGG + Intronic
964086063 3:152819844-152819866 TGAGCCCCTGCAACTGGCCCTGG + Intergenic
964121551 3:153189524-153189546 TGAGCCACTGCACTCGGCCCTGG + Intergenic
966867214 3:184265443-184265465 TGAGCCACTGCACCTGGCCCTGG - Intronic
966933354 3:184690126-184690148 TGAGCCACTGCACCTGGCCCAGG + Intergenic
967020653 3:185519550-185519572 TGAGCCACTGCACCTGGCCCTGG - Intronic
967071663 3:185967731-185967753 TGAGCCACTGCACCTGGCCCTGG - Intergenic
967133504 3:186494117-186494139 TAGGGCCTTGCTCTTGCCCCTGG + Intergenic
968731291 4:2270526-2270548 TTGGCCCCTGCAGCCGGCCCGGG + Exonic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
970197321 4:13564472-13564494 TAAGCCACTGCACCCGGCCCCGG + Intergenic
970590034 4:17551786-17551808 TGAGCCACTGCTCTTGGCCCAGG + Intergenic
971027429 4:22602373-22602395 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
971299732 4:25431824-25431846 TAAGCCACTGCACCTGGCCCTGG + Intergenic
971730404 4:30371144-30371166 CATGCCACTGCACTTGGGCCTGG + Intergenic
972077397 4:35104607-35104629 TAGGCCACTGGTCTTGGCCAGGG - Intergenic
972275043 4:37549387-37549409 TAGGCCACTGGCCTTGGCCAGGG - Intronic
973374201 4:49276493-49276515 TCAGCCCCTGCGCTGGGCCCCGG + Intergenic
973374403 4:49277349-49277371 TCAGCCCCTGCGCTAGGCCCCGG + Intergenic
973383008 4:49332892-49332914 TCAGCCCCTGCGCTAGGCCCCGG - Intergenic
973383211 4:49333746-49333768 TCAGCCCCTGCGCTGGGCCCCGG - Intergenic
974199653 4:58622432-58622454 TAGGCCCCTGTACATACCCCTGG + Intergenic
975205780 4:71642931-71642953 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
975584663 4:75938791-75938813 TGGTCCCCTGCACTTTGCCTGGG + Intronic
976767224 4:88610169-88610191 TGAGCCACTGCACCTGGCCCAGG - Intronic
976798206 4:88958267-88958289 CAGGGCCCTGGACATGGCCCAGG - Intronic
976970106 4:91093638-91093660 TAGGCCACTGGTCTTGGCCAGGG + Intronic
976990211 4:91356169-91356191 TAGGCCACTGGCCTTGGCCAGGG + Intronic
977043434 4:92041444-92041466 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
977244256 4:94611932-94611954 TGAGCCACTGCACCTGGCCCAGG - Intronic
977316165 4:95450487-95450509 TAAGCCACTGCACCTGGCCTTGG + Intronic
977764833 4:100784627-100784649 TAGGCCACTGCACTCCACCCTGG + Intronic
977972511 4:103228403-103228425 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
979052577 4:115953454-115953476 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
979653403 4:123163150-123163172 TGAGCCACTGCACCTGGCCCAGG - Intronic
980780058 4:137482418-137482440 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
981979782 4:150777135-150777157 CATGCCCCTGCACTTTGCCTGGG - Intronic
982033004 4:151319331-151319353 TAAGCCACTGTACCTGGCCCAGG + Intronic
982884616 4:160763007-160763029 TAAGCCACTGCTCCTGGCCCTGG + Intergenic
982892833 4:160877418-160877440 TTGGCCTCTGACCTTGGCCCGGG - Intergenic
983311994 4:166076354-166076376 TGAGCCACTGCACTTGGCCCAGG + Intronic
983561773 4:169108820-169108842 TAGGGCCCTGCACTAGGCACTGG - Intronic
983898097 4:173103200-173103222 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
983939182 4:173523437-173523459 CAGGCCCTTGCAACTGGCCCGGG + Intergenic
984849932 4:184144382-184144404 GAGGTCCCTGCACTGGGACCTGG - Intronic
984928172 4:184825312-184825334 GTGGCCCTTGCACTTGGCCGTGG - Intronic
986015684 5:3754933-3754955 TCGGCCCCTGCGCTTTTCCCTGG - Intergenic
986043821 5:4018689-4018711 TATGGACATGCACTTGGCCCTGG + Intergenic
986172939 5:5328362-5328384 TAGTCCCCAGCACTTGGTCATGG + Intergenic
986797183 5:11223590-11223612 TGGGCCCTTGAACTTGGTCCTGG + Intronic
987812595 5:22857460-22857482 TGAGCCACTGCACCTGGCCCTGG - Intergenic
987930412 5:24393865-24393887 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
988267107 5:28966533-28966555 TGGGCCCCTGCACTCAGCCAAGG - Intergenic
988349742 5:30086458-30086480 TGAGCCACTGCACCTGGCCCAGG + Intergenic
988939515 5:36128436-36128458 TGAGCCACTGTACTTGGCCCTGG - Intronic
989557714 5:42816720-42816742 TAGGCCACTGGCCTTGGCCAGGG - Intronic
989637227 5:43549215-43549237 CAGGCCACTGCGCCTGGCCCAGG + Intronic
991306213 5:65178588-65178610 TAGGCCACTGGCCTTGGCCAGGG - Intronic
991940846 5:71850551-71850573 GGGGACCCTGGACTTGGCCCAGG + Intergenic
992175587 5:74146198-74146220 GGGGCCCCTGCCCTTGTCCCTGG - Intergenic
992432796 5:76726104-76726126 TAAGCCACTGCACCTGGCCAAGG - Intronic
992791691 5:80219763-80219785 TAAGCACCTTCATTTGGCCCTGG - Intronic
992864029 5:80939960-80939982 TGAGCCACTGCACTTGGCCCTGG + Intergenic
993722829 5:91338455-91338477 TGAGCCACTGCACCTGGCCCTGG + Intergenic
995867549 5:116707646-116707668 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
996774769 5:127121374-127121396 CAGGGACCTGCACCTGGCCCAGG + Intergenic
998839417 5:146237342-146237364 TTGGGCACTGCACTTGTCCCAGG - Exonic
999314422 5:150574941-150574963 GAGTCCCCTGCCCCTGGCCCTGG + Intergenic
999653826 5:153793700-153793722 TTGGCCCTTGCAGATGGCCCTGG + Intronic
1000604770 5:163316098-163316120 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1001083107 5:168681303-168681325 GTGGCCCCTGCACCTAGCCCAGG + Intronic
1001214119 5:169839476-169839498 TAGGCCTTTCCACTTGGCCATGG + Intronic
1001450734 5:171822398-171822420 TATGCCCCTGCCCTGGGCTCAGG - Intergenic
1002005643 5:176231959-176231981 TAAGCCACTGCACCTGACCCGGG - Intergenic
1002207464 5:177573387-177573409 TGCGCCACTGCACTTGGGCCTGG + Intergenic
1002220737 5:177678662-177678684 TAAGCCACTGCACCTGACCCGGG + Intergenic
1002421828 5:179153049-179153071 TCAGCCCTGGCACTTGGCCCTGG + Intronic
1002436889 5:179236969-179236991 TAAGCCACTGCACCTGGCCATGG - Intronic
1002599385 5:180345679-180345701 GAGTCCCCAGCACCTGGCCCAGG + Intronic
1004076366 6:12347521-12347543 TGGGCCACTGCGCCTGGCCCAGG - Intergenic
1005045501 6:21638360-21638382 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1005061386 6:21780004-21780026 TAAGCCACTGCACTTGGCCCAGG + Intergenic
1005344282 6:24874072-24874094 TGGACCACTGCACTTTGCCCTGG - Intronic
1006032048 6:31183490-31183512 TAGGCCCCTGGCCTTGACCAGGG + Intergenic
1006570740 6:35001873-35001895 TAGGCCACTGGCCTTGGCCAGGG - Intronic
1006842335 6:37037167-37037189 TAGGCCACTGCACTTCAACCTGG - Intergenic
1007092228 6:39191402-39191424 GAGGCCCCAGCCCTGGGCCCGGG + Exonic
1007609713 6:43141705-43141727 TGGGACCCTGCATTTTGCCCGGG + Exonic
1008123607 6:47645122-47645144 TAGGCCCCTGGCCTTGGCCAGGG - Intergenic
1009444451 6:63724088-63724110 TATGCCACTGCACCTGGCCTTGG + Intronic
1010211650 6:73366993-73367015 TGAGCCACTGCACCTGGCCCTGG - Intergenic
1010317887 6:74471562-74471584 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1011256139 6:85423104-85423126 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1012462663 6:99481048-99481070 TGGGCCACTGCACTTGAGCCTGG + Intronic
1012745911 6:103088448-103088470 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1013495275 6:110691494-110691516 TAAGCCACTGCACCTGGCCTAGG - Intronic
1014018666 6:116564063-116564085 TGTGCCGCTGCACTGGGCCCAGG + Intergenic
1014617212 6:123618018-123618040 TGAGCCACTGCACTGGGCCCAGG + Intronic
1015023089 6:128500823-128500845 TATGCCACTGCACTTAGCCCGGG - Intronic
1015023109 6:128500918-128500940 TATGCCACTGCACTTAGCCCGGG - Intronic
1016307521 6:142699198-142699220 TAGTCCCCTGCCCTAGGGCCAGG + Intergenic
1016956880 6:149635420-149635442 TGAGCCACTGCACTTGGCCTTGG - Intronic
1020273877 7:6613619-6613641 TAAGCCACTGCGCCTGGCCCGGG + Intergenic
1020274477 7:6615964-6615986 TCAGCCCCTTCCCTTGGCCCAGG + Exonic
1020555273 7:9663203-9663225 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1020683242 7:11262182-11262204 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1021704166 7:23350667-23350689 CAGGGCCCTGGCCTTGGCCCTGG + Intronic
1024054766 7:45652919-45652941 TGGGCTCCTGCAGATGGCCCTGG + Intronic
1024275502 7:47673789-47673811 TAAGCCACTGCACCTGGCCCGGG - Intergenic
1026333110 7:69370478-69370500 TGAGCCACTGCACTTGGCCAAGG - Intergenic
1027401364 7:77811183-77811205 TGAGCCACTGCACCTGGCCCTGG + Intronic
1028719070 7:94008454-94008476 CAGGCCCCTGAACCTGGCCCTGG + Intergenic
1029089093 7:98034137-98034159 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1029198545 7:98823464-98823486 TAAGCCACTGCACCTGGCCTAGG - Intergenic
1029527597 7:101104501-101104523 GGGGCTCCTGCACTTGGCCAGGG + Intergenic
1030051041 7:105537949-105537971 TAGGCCCCTCTACTTGGCAATGG + Intronic
1031981370 7:128127941-128127963 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1032069411 7:128794616-128794638 TGGGCCCGGGCACTGGGCCCTGG - Intronic
1032474921 7:132205057-132205079 TCGGACCCTGGCCTTGGCCCGGG - Intronic
1032782428 7:135174757-135174779 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1033152189 7:138925067-138925089 CAGGCACCTGCACCTCGCCCTGG + Intronic
1034268570 7:149792606-149792628 GGGGCCCAGGCACTTGGCCCAGG - Intergenic
1034598324 7:152220969-152220991 TGAGCCCCTGCACCTGGCCCAGG - Intronic
1035044068 7:155952629-155952651 TAAGCCCCCACACCTGGCCCAGG - Intergenic
1035220366 7:157402774-157402796 TTGGCCCCTGCACTTTTCCAGGG + Intronic
1035467943 7:159091842-159091864 TGAGCCCCTGCCCCTGGCCCAGG - Intronic
1036293021 8:7511584-7511606 TAGGTCACTGGAGTTGGCCCTGG - Intergenic
1036329540 8:7809416-7809438 TAGGTCACTGGAGTTGGCCCTGG + Intergenic
1036443063 8:8798367-8798389 TAGGCCACTGCACTTCAGCCTGG - Intronic
1037337659 8:17807318-17807340 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1037670089 8:21007520-21007542 TGGACCCCTGCTCTTGGCCAAGG + Intergenic
1037819724 8:22129882-22129904 TAGCCCCCTGCAGTTGTCCTGGG - Intronic
1038599541 8:28926013-28926035 TAAGCCACCGCACCTGGCCCAGG - Intronic
1039198828 8:35063540-35063562 TGAGCCACTGCACTTGGCCTTGG - Intergenic
1039497505 8:37992040-37992062 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1039944278 8:42116558-42116580 TAACACCCTGCACCTGGCCCTGG + Intergenic
1040277390 8:46020986-46021008 GCAGCCCCTGCACTGGGCCCGGG - Intergenic
1041181150 8:55249513-55249535 CAGCACCATGCACTTGGCCCAGG - Intronic
1041544826 8:59031329-59031351 TAGGCACCTGCAATGGGCACTGG - Intronic
1041711619 8:60899626-60899648 TAGCCCCCTGCTCCAGGCCCAGG - Intergenic
1041736275 8:61113914-61113936 TGAGCCACTGCACCTGGCCCTGG + Intronic
1042060944 8:64816998-64817020 TAGGCTCCCACACTTGGCGCTGG + Intergenic
1042161808 8:65904566-65904588 TGGGGCCCTGGACCTGGCCCAGG - Intergenic
1042260109 8:66849860-66849882 TAAGCCACTGCGCCTGGCCCAGG + Intronic
1042529090 8:69796328-69796350 TGAGCCACTGCACCTGGCCCTGG - Intronic
1043426073 8:80150066-80150088 GAGGGCCCTGGACCTGGCCCAGG - Intronic
1043437489 8:80248747-80248769 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1044133547 8:88557101-88557123 TGAGCCCCTGCACCTGGCCTTGG - Intergenic
1044941369 8:97347573-97347595 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1045329329 8:101142004-101142026 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1046134569 8:110010138-110010160 TGAGCCACTGCACCTGGCCCAGG + Intergenic
1046691820 8:117294299-117294321 CAGCACCCTGCACTTTGCCCAGG - Intergenic
1046905537 8:119568642-119568664 CAGGCCACTGCACTTCACCCTGG - Intronic
1047092670 8:121590861-121590883 TAAGCCACTGCACTCGGCCTAGG + Intergenic
1047385810 8:124408191-124408213 TGTGCCACTGCACTTGGCCTGGG + Intergenic
1047685109 8:127296987-127297009 TGAGCCACTGCTCTTGGCCCAGG + Intergenic
1047738506 8:127788031-127788053 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1048015765 8:130495965-130495987 TGAGCCTCTGCACTGGGCCCTGG - Intergenic
1049424311 8:142531326-142531348 TGTGTCCCTGCACTTGGCACAGG - Intronic
1049634010 8:143676392-143676414 TAGGCCACTGCCCTTAGCCAGGG - Intergenic
1049711573 8:144066300-144066322 TGAGCCACTGCACCTGGCCCGGG + Intergenic
1049771956 8:144387007-144387029 TAGGCCCCTGCACTTGGCCCAGG - Intronic
1050094183 9:2047130-2047152 TGGTCCCCAGCACTGGGCCCCGG + Intronic
1052035286 9:23673697-23673719 GAGGCCCCTGCTCTTGTACCTGG - Intergenic
1052508221 9:29381854-29381876 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1052749967 9:32479791-32479813 TGAGCCACTGCACTTGACCCTGG + Intronic
1053171674 9:35891438-35891460 TGTGCCCCTGCACTTAGCCTGGG + Intergenic
1053513490 9:38709491-38709513 TCTGCCTCTGCACCTGGCCCAGG + Intergenic
1053643926 9:40110362-40110384 TCAGCCCCTGCGCTGGGCCCTGG + Intergenic
1053644230 9:40111630-40111652 TCAGCCCTTGCACTGGGCCCCGG + Intergenic
1053761929 9:41353855-41353877 TCAGCCCTTGCACTGGGCCCCGG - Intergenic
1053762226 9:41355127-41355149 TCAGCCCCTGCGCTGGGCCCTGG - Intergenic
1054325080 9:63708866-63708888 TCAGCCCTTGCACTGGGCCCCGG + Intergenic
1054350730 9:64015579-64015601 TCAGCCCCTGCGCTGGGCCCCGG - Intergenic
1054540521 9:66264975-66264997 TCAGCCCTTGCACTGGGCCCCGG - Intergenic
1054540823 9:66266247-66266269 TCAGCCCCTGCGCTGGGCCCTGG - Intergenic
1056683851 9:88743552-88743574 TGAGCCACTGCACCTGGCCCTGG + Intergenic
1057773168 9:97984484-97984506 GGGGCCCCTGCCCTTGCCCCGGG + Intronic
1057801032 9:98191858-98191880 TAGGCACCAGCACCTGGCCCGGG + Intronic
1057938031 9:99257131-99257153 TGAGCCCCTGCACCTGGCCAAGG - Intergenic
1058834992 9:108853007-108853029 CAGCCCCCAGCACTGGGCCCAGG + Intergenic
1060208364 9:121695911-121695933 TTGGCCACTGCACTTCGGCCTGG - Intronic
1060923142 9:127436771-127436793 TGAGCCACTGCACCTGGCCCAGG - Intronic
1061130542 9:128705592-128705614 CTGGCCCCTGGCCTTGGCCCTGG + Intronic
1061552944 9:131348609-131348631 GAGCCCCCTACACTGGGCCCAGG + Intergenic
1061668237 9:132173010-132173032 TGAGCCACTGCACTTGGCCAGGG + Intronic
1061707468 9:132463880-132463902 AAGGGCCCTGAACTCGGCCCAGG + Intronic
1061934617 9:133850414-133850436 TATGTCCCAGCACCTGGCCCCGG + Intronic
1062235488 9:135505883-135505905 CTGGCCCCTGCACCTGGCACAGG + Intergenic
1062388655 9:136325321-136325343 TGGGCCCCTGCAGTGGGTCCTGG - Intergenic
1062402534 9:136378792-136378814 CAAGCCCCTGCCCTGGGCCCCGG - Exonic
1062622866 9:137430437-137430459 TGGGCAGCTGCACTGGGCCCAGG - Intronic
1202791676 9_KI270719v1_random:93350-93372 TCAGCCCTTGCACTGGGCCCCGG + Intergenic
1203698071 Un_GL000214v1:115257-115279 TCAGCCCCTGCGCTAGGCCCCGG + Intergenic
1203551134 Un_KI270743v1:165724-165746 TCAGCCCCTGCGCTAGGCCCCGG - Intergenic
1185758980 X:2674769-2674791 TGAGCCACCGCACTTGGCCCTGG - Intergenic
1185909872 X:3971551-3971573 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1186185422 X:7015616-7015638 CAGGCCACTGCACTTTACCCTGG - Intergenic
1186558590 X:10586795-10586817 TAGGCCACTGGCCTTGGCCAGGG + Intronic
1187364272 X:18653683-18653705 TGAGCCACTGCACCTGGCCCTGG - Intronic
1187402875 X:18977876-18977898 TGAGCCACTGCACCTGGCCCAGG - Intronic
1189319941 X:40081883-40081905 CAGGTCTCTCCACTTGGCCCTGG - Intronic
1189681997 X:43526615-43526637 TAAGCCCCTACTCTTGGCCAAGG - Intergenic
1190280592 X:48926634-48926656 TGAGCCACTGCACCTGGCCCTGG + Intronic
1190297247 X:49035025-49035047 TGAGCCACTGCACCTGGCCCTGG - Intronic
1190771357 X:53517406-53517428 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1191036118 X:56028071-56028093 TAGGCCACTGGTCTTGGCCAGGG + Intergenic
1191253388 X:58269704-58269726 GCAGCCCCTGCACTGGGCCCGGG - Intergenic
1191639359 X:63413665-63413687 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1191771701 X:64767528-64767550 TGAGCCACTGCACCTGGCCCAGG - Intergenic
1191917839 X:66221589-66221611 TAGGCCACTGGCCTTGGCCAGGG + Intronic
1192752547 X:74008974-74008996 TGTGCCACTGCACTTGGACCTGG + Intergenic
1192915335 X:75645716-75645738 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1193070136 X:77297960-77297982 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1193717463 X:84949419-84949441 TAGGCCACTGGCCTTGGCCAGGG - Intergenic
1194339845 X:92694364-92694386 TGGGTCCCTGGACCTGGCCCAGG + Intergenic
1194839912 X:98727155-98727177 TAGGCCACTGCTCTTGGGGCCGG + Intergenic
1196330023 X:114461022-114461044 TGTGACCCTGCATTTGGCCCAGG + Intergenic
1196422880 X:115540766-115540788 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1196459949 X:115919471-115919493 TAGGCCACTGGCCTTGGCCAGGG + Intergenic
1197605675 X:128582332-128582354 TTGGCCCAGGAACTTGGCCCTGG - Intergenic
1198056509 X:133001110-133001132 TAAGCCACTGCACCTGGCCTGGG - Intergenic
1198969991 X:142269306-142269328 TAGGCCACTGGTCTTGGCCAGGG - Intergenic
1199130016 X:144174139-144174161 TAGGCCTTTGCATTTGGACCGGG - Intergenic
1199900747 X:152169618-152169640 TAGGCCACTGCATTTGGCCTGGG - Intronic
1200119713 X:153784544-153784566 GTGGCCCCTGCCCTTGGCCATGG - Intronic
1200354146 X:155530406-155530428 CATGCCCCTACCCTTGGCCCTGG - Intronic
1200648229 Y:5811147-5811169 TGGGTCCCTGGACCTGGCCCAGG + Intergenic
1201151380 Y:11097227-11097249 TCAGCCCCTGCACTGGGCCCCGG - Intergenic
1201151599 Y:11098053-11098075 TGAGCCCCTGCGCTGGGCCCTGG - Intergenic
1201152403 Y:11101327-11101349 TCAGCCCCTGCACTGGGCCCAGG - Intergenic
1201270278 Y:12247365-12247387 TAGGCCACTGGTCTTGGCCAGGG - Intergenic
1201383922 Y:13417737-13417759 TATGCACCTGCACTTGGACTAGG + Intronic
1201680591 Y:16640700-16640722 TAGGCCACTGGTCTTGGCCAGGG + Intergenic