ID: 1049774423

View in Genome Browser
Species Human (GRCh38)
Location 8:144397899-144397921
Sequence CTCAGCGGCGGGCAAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049774411_1049774423 6 Left 1049774411 8:144397870-144397892 CCTTGGACTGCTGCGGGGAGAGG 0: 1
1: 0
2: 0
3: 27
4: 372
Right 1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049774423 Original CRISPR CTCAGCGGCGGGCAAGGGGC AGG Intronic
900181089 1:1311263-1311285 CTCAGCGGTGGGGAGGGTGCTGG + Intronic
900370967 1:2331983-2332005 CGCAGCGGCGGGAGAGGCGCAGG - Intronic
900393442 1:2443653-2443675 CTCCGCGGCGGGCACCGGGCTGG - Intronic
900532689 1:3162490-3162512 CTCAGCCGGGGGGAAGGGGCAGG - Intronic
901778293 1:11575598-11575620 CTCACCGGAGGCCAAGGGGAGGG + Intergenic
901930789 1:12595387-12595409 CCCAGGGGCGGGCGCGGGGCGGG + Intronic
902286312 1:15410485-15410507 CTCCGCCGCGTGCCAGGGGCCGG - Intronic
902536781 1:17123490-17123512 CTCAGAGGCGGGGAAGGGCTGGG + Intergenic
902885234 1:19400140-19400162 CTCGGAGGCAGGCAAGGGGTGGG - Intronic
903652993 1:24932422-24932444 CTCCGCGGCTGGCAGGGCGCGGG - Intronic
904918307 1:33986085-33986107 CTCTGCGGCAGGCATTGGGCTGG - Intronic
905369231 1:37474493-37474515 CGCGGAAGCGGGCAAGGGGCGGG - Intergenic
905862548 1:41361203-41361225 CTCCGCGCCGAGCAGGGGGCGGG + Intergenic
911180050 1:94852425-94852447 CACAGAGGCTGGCAAGAGGCTGG + Intronic
911498800 1:98661603-98661625 CTGCGCAGCGGGCGAGGGGCTGG + Intergenic
912246343 1:107965161-107965183 CTCAGTGGCGGGCCGGGCGCTGG - Intergenic
913323293 1:117605818-117605840 CTCAGCGGCGGGAAGGGGCGGGG - Intergenic
914004202 1:143718175-143718197 CCCTGGGGCGGGCAACGGGCAGG + Intergenic
914845901 1:151283271-151283293 CGCAGAGGAGGGCGAGGGGCTGG - Intronic
915338924 1:155165938-155165960 CTCTGCAGGGGGCCAGGGGCAGG - Intergenic
915798742 1:158765974-158765996 CTCAGCTGCCGGCAAGAGGAAGG - Exonic
916588345 1:166166775-166166797 CCCAGCGGCGGGCGAGCGGGCGG + Intronic
917797430 1:178542239-178542261 CTGGGCGGCAGGCAAGGGGCGGG + Intronic
921060445 1:211579662-211579684 CTCGGCGGCGGGGGAGGGGCCGG + Intergenic
923656054 1:235918138-235918160 CTCAGCGTTGGGCATGGGGGCGG - Intergenic
1062847241 10:717604-717626 CCCAGGGCCGGGCAAGGGACGGG + Intergenic
1063418128 10:5889940-5889962 AGCAGCGGCGGTCGAGGGGCGGG - Intergenic
1063442772 10:6086490-6086512 CTCAGCGCCTGGCAGGAGGCTGG - Intergenic
1063711147 10:8480024-8480046 CTCAGGGGAGGGCAGGGGGTTGG - Intergenic
1064028794 10:11869976-11869998 CCCCGCGGCGGGGAAGGCGCCGG - Exonic
1064060124 10:12129918-12129940 CTCAGCGGAGGGCACGGGCCGGG + Intronic
1065732416 10:28721694-28721716 CTCAGCGGTGGGCAAGGCTGAGG + Intergenic
1066746017 10:38604627-38604649 CTTGGGGGCGGGGAAGGGGCTGG - Intergenic
1067666646 10:48284994-48285016 CTCAGCATCGGGCAAGGAGAAGG - Intergenic
1070659456 10:78294054-78294076 CTCAGGGGTGGGCTTGGGGCTGG + Intergenic
1070828388 10:79404197-79404219 CTCAGGGCCGGGCACAGGGCTGG - Intronic
1070877243 10:79825975-79825997 CCCAGCGGAGGGCAGGGGGTCGG - Intergenic
1071643740 10:87342019-87342041 CCCAGCGGAGGGCAGGGGGTCGG - Intergenic
1073049193 10:100656702-100656724 CGCAGCGGCGGGCGAAGGGGCGG + Intergenic
1073147404 10:101289843-101289865 GTCAGCTGTGGGCAGGGGGCAGG - Intergenic
1075764352 10:124880644-124880666 CTCAGCGGGGGGGAAAGGCCTGG - Intergenic
1075873602 10:125788867-125788889 CTCAGCAGCAGCCATGGGGCTGG + Exonic
1075997517 10:126890612-126890634 CAGAACGGCAGGCAAGGGGCGGG - Intergenic
1076611014 10:131725927-131725949 CTCAGCGGTGGACACGGGGATGG + Intergenic
1077015515 11:397435-397457 CTCAGCAGCGGGTGAGCGGCTGG + Exonic
1077095062 11:795735-795757 GGAAGGGGCGGGCAAGGGGCTGG - Intronic
1077107974 11:850073-850095 CTCTCCGGAGGGCAAGGAGCCGG + Intronic
1077232057 11:1462200-1462222 CACGGCGGCGGGCACTGGGCAGG - Intronic
1077556983 11:3230623-3230645 CTCAGGGGTGGGCATGGGGGTGG + Intronic
1078741856 11:14073968-14073990 CTCTGTGGAGGGGAAGGGGCAGG - Intronic
1079006358 11:16794048-16794070 CTCAGCGGCGGGTGAAGGGAAGG + Intronic
1080119867 11:28664715-28664737 CTCGGGGGCTGGCATGGGGCAGG + Intergenic
1082025113 11:47565823-47565845 CGGAGCGGCGGGGACGGGGCAGG - Intronic
1083897495 11:65627387-65627409 GGCAGCTGTGGGCAAGGGGCAGG - Exonic
1084171287 11:67401994-67402016 CTCGGCGGCGGGCTGGGGGCGGG + Intronic
1089285785 11:117407184-117407206 GTCAGCAGAGAGCAAGGGGCTGG + Intronic
1089442788 11:118530895-118530917 CTCAGCGGCTGTCACGGGGGCGG - Exonic
1091211329 11:133864018-133864040 CACAGTGGCGGGGGAGGGGCGGG + Intergenic
1092004433 12:5057293-5057315 CTCAGGAGTGGGCAAGGGTCAGG + Intergenic
1092046146 12:5432903-5432925 CTCAGCGGCCGGCAGAGTGCAGG - Intronic
1096105414 12:48994795-48994817 AGCAGAGGCGGGCAGGGGGCCGG + Intergenic
1096977259 12:55706712-55706734 CTCAGCAGCTGGGAAGGGCCAGG - Intronic
1100611152 12:96193364-96193386 CTCAGCCTAGGGCAATGGGCAGG + Intergenic
1101939435 12:109089138-109089160 CTCAGCAGTGGGCAGGGGCCGGG - Intronic
1103308867 12:119989141-119989163 GTCAGGCGCCGGCAAGGGGCGGG + Intergenic
1103970319 12:124666777-124666799 CTCAGCCCTGGGCAAGGGGAGGG - Intergenic
1104944658 12:132410220-132410242 CTCAGCTGCGTGCACGTGGCGGG + Intergenic
1105793909 13:23831829-23831851 CACAGCAGAGGTCAAGGGGCAGG + Intronic
1106720010 13:32427554-32427576 CACGGCGGCGGGGAAGGGGCCGG + Intronic
1110010324 13:70325228-70325250 CTCAGCAGCTGGCAAGAGCCAGG + Intergenic
1110480943 13:75975407-75975429 CACAGAGGGAGGCAAGGGGCAGG + Intergenic
1113436075 13:110292092-110292114 CTCAGCGGCAGGCAGGATGCAGG - Intronic
1119750861 14:77076469-77076491 GTCAGGGGCGGGGGAGGGGCGGG - Intergenic
1120251087 14:82062543-82062565 CTAAGAGGCGGGCTAGTGGCTGG + Intergenic
1122137853 14:99645124-99645146 CGCGGCGGCAGGGAAGGGGCGGG - Exonic
1123694676 15:22870027-22870049 CTCAGCTGCTGGCGAGGGACTGG + Exonic
1123783676 15:23647926-23647948 GTCGGGGGCGGGGAAGGGGCGGG - Intergenic
1125103127 15:35939121-35939143 TTCAGTGGCGTGCTAGGGGCTGG - Intergenic
1125429502 15:39581066-39581088 CGCAGCGGCTGGCAAGGCGGAGG - Intronic
1125688047 15:41575284-41575306 CTCAGGGCATGGCAAGGGGCAGG + Intronic
1126113378 15:45187979-45188001 CGCAGCGGCGGGTGGGGGGCGGG + Intronic
1127846878 15:62877916-62877938 CTCAGGAGTGGGCAAGGGTCAGG - Intergenic
1129252384 15:74316085-74316107 ATAAGGGGTGGGCAAGGGGCAGG + Intronic
1129853997 15:78811398-78811420 CTCTGCAGCGGCCAAGGGGGCGG - Exonic
1130274176 15:82468052-82468074 CTCTGCTGTGGACAAGGGGCAGG - Intergenic
1130466521 15:84195426-84195448 CTCTGCTGTGGACAAGGGGCAGG - Intergenic
1130497743 15:84478110-84478132 CTCTGCTGTGGACAAGGGGCAGG + Intergenic
1130588818 15:85200019-85200041 CTCTGCTGTGGACAAGGGGCAGG - Intergenic
1131199965 15:90388144-90388166 CTGAGCGGCCGGAAAGAGGCGGG - Intergenic
1131517576 15:93089241-93089263 CTCGGCGGCGGGCGGGGGCCGGG - Intergenic
1132371796 15:101304776-101304798 CTCAGTGGCAGGCAACGAGCAGG + Exonic
1132617379 16:848385-848407 CTCTGTGGCGTGCATGGGGCTGG - Intergenic
1133039412 16:3052457-3052479 TTCAGCGGGGGGCAGGGGGTAGG + Intronic
1133041785 16:3064856-3064878 CTCAGCTGGGGGAAGGGGGCTGG + Intergenic
1137521007 16:49195448-49195470 CTCAGCTGCAGGGGAGGGGCAGG - Intergenic
1138483114 16:57317222-57317244 CTCAGCAGGGGGCAAGGCCCTGG + Intergenic
1138562228 16:57808317-57808339 CTGAGAGGCGGGCCGGGGGCGGG - Intronic
1138594997 16:58025216-58025238 CGTTGCGGCGGACAAGGGGCAGG - Intergenic
1138595905 16:58028828-58028850 CTCAGTGGTGGGCTAGGGCCTGG - Intronic
1140205151 16:72927595-72927617 CCCAGCGGCCCGCGAGGGGCTGG + Intronic
1141156775 16:81602576-81602598 CGCTGGGGCGGGCGAGGGGCAGG - Intronic
1141410560 16:83830064-83830086 CTCAACCGCAGGCAACGGGCTGG + Intergenic
1141840873 16:86573315-86573337 CTCACTGGGAGGCAAGGGGCGGG - Intergenic
1141896905 16:86964116-86964138 CTCAGCAGCAGGCCAGGGGCGGG + Intergenic
1142194303 16:88732534-88732556 TTCTGCGGAGGGCAAGGGTCAGG + Exonic
1142811775 17:2398979-2399001 AGCGGCAGCGGGCAAGGGGCGGG - Intronic
1143554265 17:7650994-7651016 CTCAGCCGCGGGGGTGGGGCGGG - Intronic
1143629004 17:8126539-8126561 CAAAGCGGCCGGGAAGGGGCGGG - Intergenic
1145915424 17:28571236-28571258 CTCCGCGTCGGGGATGGGGCCGG - Intronic
1147000592 17:37359307-37359329 CTCAGCGGCAGCCAATGGGAGGG + Intronic
1148206971 17:45785033-45785055 CGCCGCGGAGGGGAAGGGGCAGG - Intronic
1148699729 17:49580184-49580206 CTCAGCAGCGGGCACGGGTGGGG + Exonic
1150135290 17:62692094-62692116 CTCAGCTGTGGGCAAGAGGAGGG - Exonic
1151767898 17:76141447-76141469 CTTAGCGGCGGGTAGGGGGTTGG - Intergenic
1152502195 17:80719614-80719636 CTCAGAGGAGGGCAAAGGACAGG + Intronic
1152638596 17:81440231-81440253 GTCAGGGGCGGGCAGGTGGCGGG + Intronic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1152690190 17:81714436-81714458 CTCAGCAGCAGACAAGGGGACGG - Intronic
1152751719 17:82065442-82065464 CTCCGCGCCGGGCCAGGGGAAGG + Exonic
1158454366 18:57593446-57593468 AGCAGCGGGAGGCAAGGGGCAGG + Intergenic
1160393904 18:78558342-78558364 CTCAGAGGGAGGCAAGGGCCTGG - Intergenic
1160948111 19:1652655-1652677 CTCGGGGGCGGGGCAGGGGCGGG - Intergenic
1161400081 19:4063405-4063427 CTCAGAGGCGGGCAGGGCTCTGG - Intronic
1161555738 19:4941657-4941679 TTCCGCGGTGGGCACGGGGCGGG + Intronic
1161664094 19:5564514-5564536 GTCAGGGATGGGCAAGGGGCAGG + Intergenic
1161707608 19:5829408-5829430 CTGAGGGGCGGGGAAGGGGCGGG + Intergenic
1162462041 19:10819025-10819047 CTCGGCCAGGGGCAAGGGGCTGG - Intronic
1162925965 19:13930651-13930673 CTCCGGGGCGGGCCAGAGGCCGG - Exonic
1163513489 19:17749225-17749247 CCCAGTGGTGGGCATGGGGCTGG + Intronic
1163579844 19:18131846-18131868 CTAAGGGGCGGGCGGGGGGCGGG + Intronic
1163586922 19:18169273-18169295 CTCAGCGGGCGGCAGGCGGCGGG - Exonic
1165072062 19:33261393-33261415 CTTAGCAGAGGGGAAGGGGCAGG - Intergenic
1165757963 19:38305051-38305073 CCCAGCGCTGGGCAGGGGGCAGG - Intergenic
1165922659 19:39308366-39308388 CTCAGCGGGCGGCAGGGCGCCGG + Exonic
1165928502 19:39342142-39342164 CTGGGGGGCGGGGAAGGGGCGGG - Intronic
1166077261 19:40421044-40421066 CCCAGGGGCCGGGAAGGGGCGGG - Intergenic
1166304090 19:41927996-41928018 CGCAGGGGCGGGGAGGGGGCGGG - Intronic
1166306901 19:41940407-41940429 CGCGGCGGCGGGGGAGGGGCGGG - Intergenic
1166853404 19:45770899-45770921 CTAAGCGGGTGGCAAGGGGCGGG + Intronic
1167260360 19:48454552-48454574 CCCAGCGGAGGGCATGGGGGTGG + Exonic
1167428906 19:49443197-49443219 CTCAGCGCCGGGAGATGGGCTGG - Intergenic
1167650034 19:50724050-50724072 CTCAGGGGTGGGAGAGGGGCTGG - Exonic
1167765323 19:51478753-51478775 CAAAGCGGCGGGGAGGGGGCTGG + Intronic
1167943092 19:52963017-52963039 CGCGGGGGCGGGAAAGGGGCGGG + Intergenic
1168316982 19:55488800-55488822 CTGGGGGGCGGGCAGGGGGCAGG - Intronic
925959539 2:9003092-9003114 CTCAGAGGCGCGCGCGGGGCAGG + Intronic
926220293 2:10931744-10931766 CTCAGCAGCGGCTATGGGGCCGG + Intergenic
926246143 2:11123564-11123586 CTCACCGGAGGGCCAGGGCCAGG + Intergenic
926474704 2:13308284-13308306 CGCAGCGGCGGGGAACTGGCAGG - Intergenic
930808872 2:55519962-55519984 ACCAGCGGCGGGCAGGGGGTTGG + Intronic
931042886 2:58317740-58317762 CTAAGAGGCGGGCTAGTGGCTGG - Intergenic
933684603 2:85133400-85133422 CTCCCCGGCGGGCCAGGGGCTGG + Exonic
935056232 2:99570065-99570087 CTCAGAGGGGGGCATGGGGATGG - Intronic
935082144 2:99808547-99808569 CTCAGAGGAGGGGGAGGGGCAGG - Intronic
935446899 2:103166611-103166633 CTCTGCGGAGGGGAAGGGCCTGG + Intergenic
935698107 2:105787209-105787231 CTCAGCGCCGTGGAAGGGGCAGG + Intronic
936104593 2:109613949-109613971 CTCCGCGACGGGGAAGGGACAGG + Exonic
937222700 2:120350924-120350946 CTCAGCGGAGGCCAAGGGAGGGG + Exonic
938018249 2:127885587-127885609 CCCAGCGGAGGGCAGGGGGTCGG - Intronic
938077386 2:128346937-128346959 AGCAGCGGCGGGCGGGGGGCGGG + Intergenic
944875844 2:203963585-203963607 CTAAGAGGCGGGCTAGTGGCTGG + Intergenic
946127253 2:217573862-217573884 GACAGCTGCAGGCAAGGGGCTGG + Intronic
947740558 2:232482976-232482998 CTCAGCGGCAGGCCAGGGCAGGG + Intronic
1168773856 20:432728-432750 CTCAGGGGCAGGACAGGGGCAGG + Intergenic
1171386412 20:24772061-24772083 CTCAGGGCAGGGCAAGGGGGAGG + Intergenic
1173998487 20:47357596-47357618 CTCGGCCGCGGGGGAGGGGCCGG - Intergenic
1175992011 20:62794413-62794435 CTCGGGGGCGGGTCAGGGGCGGG - Intergenic
1176221197 20:63970003-63970025 CTCCGCGACGGGGAGGGGGCGGG + Intronic
1176379804 21:6106565-6106587 CCCGGCGGGGGGCATGGGGCAGG - Intergenic
1179164416 21:38924615-38924637 CTCGGCTGCAGGCAAGGGGCTGG - Intergenic
1179674833 21:42974442-42974464 CGCGGCGGCGGGCGCGGGGCGGG - Intergenic
1179743670 21:43431672-43431694 CCCGGCGGGGGGCATGGGGCAGG + Intergenic
1179878311 21:44282535-44282557 GTCACCTGCGGGCAAGGGGCTGG + Intergenic
1179911949 21:44455406-44455428 CGCGGGGGCGGGGAAGGGGCGGG - Intergenic
1181439473 22:22928350-22928372 CTCAGCTGTGGGCCAGGGGCTGG + Intergenic
1182123211 22:27799963-27799985 TCCAGCGGCAGGCATGGGGCCGG + Exonic
1182445507 22:30387285-30387307 CTCAGCGCGGGGCGAGCGGCGGG + Exonic
1183464761 22:37973935-37973957 CTCAGCAGCCGGCTATGGGCTGG - Exonic
1184143283 22:42592274-42592296 GTCAGCAGTGGGAAAGGGGCTGG + Intronic
1184244871 22:43230861-43230883 CTCAGGGGCTGGCACGGGGCAGG - Intronic
1184497432 22:44850077-44850099 CTCTGGGGAGGGCATGGGGCTGG + Intronic
1184779670 22:46640819-46640841 CTCGGCGGGGGGCGGGGGGCCGG - Intronic
1185259281 22:49852962-49852984 CACAGCCGCGGGGCAGGGGCGGG + Intergenic
1185319728 22:50195044-50195066 CGCAGCCGCGGGCAAGGGTCAGG + Intronic
1185343704 22:50302411-50302433 CTCCGCGTGGAGCAAGGGGCTGG - Intronic
950703834 3:14768108-14768130 TTCTGAGGTGGGCAAGGGGCAGG - Intronic
950704098 3:14769498-14769520 TTCTGAGGTGGGCAAGGGGCAGG - Intronic
954713694 3:52516937-52516959 CTCAGGAGCAGGCACGGGGCCGG - Intronic
957287141 3:78231543-78231565 TTCAGCGGCTGGCTTGGGGCAGG - Intergenic
957287152 3:78231594-78231616 TTCAGCGGCTGGCTTGGGGCAGG - Intergenic
960973670 3:123156396-123156418 CTCAGTGCAGGGAAAGGGGCAGG - Intronic
961380934 3:126496193-126496215 CTCAGTGGTGGGCTCGGGGCAGG - Intronic
962740998 3:138362468-138362490 CTCAGAGGAGGGGAAGGGGATGG - Intronic
963806664 3:149729344-149729366 CTCAGCTGGGGGCAGGGGGCAGG + Intronic
965775364 3:172224584-172224606 CTCAGCAGGGGGAAAGGGACAGG - Intronic
966819172 3:183911302-183911324 CTCAGGGAGGGACAAGGGGCAGG + Intergenic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968606410 4:1537746-1537768 CTCAGAGGCAGTGAAGGGGCAGG + Intergenic
968642502 4:1721614-1721636 CTCAGAGCCCGGCAACGGGCGGG + Exonic
968727744 4:2256130-2256152 TTCAGCGGCTGTCAAGGGCCAGG + Intronic
979831913 4:125315098-125315120 CTGTGCGGCGGGGAAGGGGCGGG + Intergenic
981885566 4:149668509-149668531 GGCAGCGGGGGGCAAGGGGAGGG + Intergenic
982314529 4:154018779-154018801 CTCAGGGGAGGGAAAGGGGAGGG + Intergenic
982554636 4:156843493-156843515 CTCAGCCGCTGGCAAGGGGAAGG - Intronic
985524918 5:396879-396901 CTCTGAGGTGGGCAAGGAGCCGG - Intronic
985552805 5:541828-541850 CTCAGCTGCAGGCAAGGGACGGG + Intergenic
985790930 5:1926502-1926524 CTCAGGGGCGGGGCAGGGGCAGG - Intergenic
985790952 5:1926566-1926588 CTCAGGGGCGGGGCAGGGGCAGG - Intergenic
986307434 5:6525949-6525971 CACAGCAGCTGGCCAGGGGCAGG + Intergenic
992529210 5:77638997-77639019 CGCAGCGCCGGCCAAGGGGAAGG - Exonic
997596954 5:135113470-135113492 GGCAGAGGCGGGCAGGGGGCTGG - Intronic
997884717 5:137619897-137619919 CTCAGTGGTGGGGGAGGGGCAGG + Exonic
998019026 5:138753993-138754015 CTCAGCGGCCGGGAAGGGGGAGG - Intronic
998134890 5:139669378-139669400 CTCAGTGATGGGCACGGGGCTGG - Intronic
998182293 5:139954031-139954053 CTCACTGGGAGGCAAGGGGCAGG + Intronic
1001920541 5:175596366-175596388 CTCAGCATCGGGCACTGGGCCGG + Intergenic
1002368162 5:178729414-178729436 CGCAGCGGCGTGAACGGGGCAGG - Intronic
1002385163 5:178860634-178860656 CGCAGCGGCGTGAACGGGGCAGG + Intronic
1004660633 6:17706411-17706433 CTCCGGGGCGGGTAAGGGGGCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006030390 6:31173149-31173171 CTCAGAGGAGGGGGAGGGGCAGG + Intronic
1006319754 6:33313510-33313532 GTCACCGCCGGGAAAGGGGCTGG + Intronic
1006830721 6:36966645-36966667 CTCAGCTGCTGGCAAAGGGAGGG - Intergenic
1006851633 6:37102777-37102799 CTGGGCGGAGGGCGAGGGGCCGG - Intergenic
1015031994 6:128606406-128606428 GACAGCAGCGGGTAAGGGGCAGG - Intergenic
1018170376 6:161139399-161139421 GTGAGTGGAGGGCAAGGGGCTGG - Intronic
1019475251 7:1241330-1241352 CGCAGCGGCGGGCAGGGTTCCGG - Intergenic
1019520865 7:1459917-1459939 CTCAGCGGCGGGGCGGGGCCTGG - Intergenic
1019593342 7:1846640-1846662 CTGAGCCACGGGCACGGGGCCGG - Intronic
1029268682 7:99362720-99362742 CCCAGCGTCGGGGAAGAGGCGGG + Intronic
1029469499 7:100745292-100745314 CTGAGCGGCGGCGAAGAGGCTGG - Intronic
1030661148 7:112221055-112221077 GTCAGCGGCGGGTCAGCGGCGGG - Intronic
1032082968 7:128869318-128869340 CTCGGCGGGGCGCGAGGGGCAGG - Intronic
1032263135 7:130352277-130352299 CTGTGCATCGGGCAAGGGGCTGG + Intronic
1034262618 7:149766124-149766146 GTCAGGCGCGGGAAAGGGGCTGG + Exonic
1034421112 7:150991420-150991442 CACAGCAGCGGCCCAGGGGCAGG + Intronic
1034518344 7:151599747-151599769 CACAGCAGGAGGCAAGGGGCGGG - Intronic
1035062470 7:156079718-156079740 CTCAGAAGAGGGGAAGGGGCAGG - Intergenic
1035179166 7:157076919-157076941 CTCAGGAGCGAGCATGGGGCTGG + Intergenic
1035282285 7:157785693-157785715 CTCAGAGATGGGCATGGGGCCGG + Intronic
1035546198 8:483914-483936 CTCAGCAGCAGGCAAGGGTTGGG + Intergenic
1035731979 8:1860020-1860042 CTCAGCGCTGGGCACGGGGGTGG - Exonic
1036221168 8:6922765-6922787 CACAGCGGCCTGCAAGGGCCAGG - Intergenic
1036770404 8:11574984-11575006 CTCCGCGGCGGGCACAGGGAAGG - Intergenic
1036788657 8:11703850-11703872 CGCAGCGGCGGGCGAGGGGCGGG - Intronic
1038486597 8:27939716-27939738 CTCAGTGCCAGGCAATGGGCTGG + Intronic
1041292256 8:56319163-56319185 CTCTGCGGGGTGCAAGGGGTTGG + Intronic
1044038032 8:87331207-87331229 GTCAGCGGGGTGCAAGGGGTGGG - Intronic
1045243329 8:100421589-100421611 CTCAGTGCCTGGCATGGGGCTGG + Intergenic
1045475836 8:102551395-102551417 CTCATCGGGGTGCATGGGGCTGG - Intergenic
1049277057 8:141725208-141725230 CTTGGAGGCTGGCAAGGGGCAGG - Intergenic
1049283150 8:141760749-141760771 CTCTGCGGCAGCCCAGGGGCCGG - Intergenic
1049418072 8:142504528-142504550 CACAGCGGTGGGGAAGGGTCTGG + Intronic
1049718959 8:144106853-144106875 CTCAGAGGCAGGCAACGAGCTGG + Exonic
1049774423 8:144397899-144397921 CTCAGCGGCGGGCAAGGGGCAGG + Intronic
1051418783 9:16870714-16870736 GCCAGCGGCGGCCGAGGGGCTGG - Intronic
1053240089 9:36487893-36487915 CTCAGGGGCGGGCCTGGGGCGGG - Intergenic
1056992573 9:91424471-91424493 CGCTGCGGCGGGGAAGGGGTTGG + Intergenic
1057501870 9:95602558-95602580 CTCAGCAGCGGGAAGGGGACTGG + Intergenic
1061325758 9:129863175-129863197 GTCAGCGGCGGGCTGGGTGCAGG - Exonic
1061852302 9:133423428-133423450 CTCAGCAGAGGCCATGGGGCAGG - Intronic
1062637585 9:137499700-137499722 CCCCGAGCCGGGCAAGGGGCAGG - Intronic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1186515607 X:10164357-10164379 CTCAGAGGGGCGCAGGGGGCAGG + Intronic
1187154664 X:16712171-16712193 CTCAGCGCTGGGCAGGGAGCCGG + Exonic
1188009814 X:25043670-25043692 CTCAGGGGCAGCCAAGGGGCTGG + Intergenic
1190542972 X:51496873-51496895 CGCGGCGGAGGGCGAGGGGCGGG + Intergenic
1190736138 X:53256833-53256855 CTCAGCTGGGGGAAGGGGGCAGG + Intronic
1196616169 X:117769304-117769326 CACAGCGGGGGGCAGGGGGGGGG - Intergenic
1199862708 X:151816221-151816243 CTCAGCAGCAGGCAGGTGGCTGG - Intergenic
1199975412 X:152892341-152892363 CTCAGCATGGGGGAAGGGGCTGG - Intergenic