ID: 1049774681

View in Genome Browser
Species Human (GRCh38)
Location 8:144398861-144398883
Sequence ATGCTCTTCTAGAATGATGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049774671_1049774681 29 Left 1049774671 8:144398809-144398831 CCACATGTCATAGCAGCCGGGAA 0: 1
1: 1
2: 0
3: 7
4: 110
Right 1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG 0: 1
1: 0
2: 1
3: 29
4: 204
1049774673_1049774681 13 Left 1049774673 8:144398825-144398847 CCGGGAAGCTCAAAGGTTGTCAC 0: 2
1: 0
2: 1
3: 15
4: 115
Right 1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG 0: 1
1: 0
2: 1
3: 29
4: 204
1049774678_1049774681 -9 Left 1049774678 8:144398847-144398869 CCACCTGGGGCCGGATGCTCTTC 0: 1
1: 1
2: 0
3: 11
4: 141
Right 1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG 0: 1
1: 0
2: 1
3: 29
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049774681 Original CRISPR ATGCTCTTCTAGAATGATGA TGG Exonic
901218628 1:7569517-7569539 ATGATGTTGGAGAATGATGAAGG - Intronic
902292327 1:15443430-15443452 ATGCTCTGCAAGCTTGATGAGGG - Exonic
904747203 1:32718588-32718610 ATGCTCTTCTGGAATAAGGGTGG + Intergenic
907511267 1:54962469-54962491 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
907622104 1:55991992-55992014 ATGAACATCTAGAATGATGCTGG + Intergenic
909000489 1:70211813-70211835 ATGTACCTCTAGAATGATGATGG - Intronic
909414558 1:75390728-75390750 TTGCTCTTTTAGTATGATGTTGG - Intronic
909576125 1:77178295-77178317 ATGCCCTTCTAGAAGTATGAAGG - Intronic
909631382 1:77772831-77772853 ATCCTCTTTTAGAATGCTCAGGG + Intergenic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910028475 1:82687374-82687396 ATGCTTTTCTATAACAATGATGG - Intergenic
910289184 1:85583162-85583184 ATGCTCCTCAAGAATGAGCAAGG - Exonic
912052900 1:105553079-105553101 TTGCTGCTCTAGAATGATGAGGG + Intergenic
912066190 1:105746605-105746627 ATGCTCACCTACATTGATGAAGG + Intergenic
912246170 1:107964315-107964337 AAGCTCTTCTATAATAACGAAGG - Intronic
913061537 1:115212912-115212934 CTGCTCTTCTATAATGATCTTGG - Intergenic
913476294 1:119241573-119241595 ATGCTCTTTTAGTATCATAATGG - Intergenic
914823281 1:151121861-151121883 AAGCAAGTCTAGAATGATGAGGG - Exonic
915970881 1:160354313-160354335 ACTCTCTTCAAGAATGAAGAGGG - Intronic
917033904 1:170725469-170725491 CAGCACTTCTAGAATGCTGAAGG - Intronic
919033879 1:192281022-192281044 AAAGTCATCTAGAATGATGACGG + Intergenic
920826348 1:209427218-209427240 ATGCTATTCTGGAAGGAAGAGGG + Intergenic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1066352938 10:34653837-34653859 AGGGTCTTCTGGAATGATCAAGG - Intronic
1067302124 10:45021587-45021609 ATGCTCATCTACATTGGTGAGGG - Intergenic
1068286792 10:54948551-54948573 ATGCTCATCTGCATTGATGAGGG - Intronic
1068450061 10:57174742-57174764 ATTGTCATCTAGAATGCTGATGG - Intergenic
1072651829 10:97302058-97302080 ATGCTCTTCAAGACTGACCACGG + Intergenic
1074418981 10:113292753-113292775 AGGCACTTCCAGACTGATGAAGG + Intergenic
1075270594 10:121046417-121046439 ATGCTCTTGAAGGATGCTGAAGG - Intergenic
1075583162 10:123637620-123637642 ATCCTTTTCTAAAATGAGGAAGG + Intergenic
1078510520 11:11981079-11981101 GTGCTCTGCTAGGATGAGGACGG - Intronic
1078752965 11:14182393-14182415 CTGCTCTTGTACAAAGATGAAGG - Intronic
1080369183 11:31614343-31614365 AAGTTCTTAAAGAATGATGATGG + Intronic
1080653946 11:34243922-34243944 CTGCTCTTCTAGAGTACTGAGGG - Intronic
1081938559 11:46921236-46921258 GGGCTGTTCTAGAAAGATGAAGG - Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1083231313 11:61322211-61322233 ATGCTTATCTAGAATGGGGAGGG - Intronic
1084149672 11:67282275-67282297 ATGCTCGTCCAGAAGGATGTTGG - Exonic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1086427557 11:86701473-86701495 TTGATGTTCTAGAATGATGTAGG - Intergenic
1088863170 11:113821169-113821191 ATGCTCTTCAAGATTGCTCATGG - Intronic
1089218546 11:116851445-116851467 ATGGTTTTCTATAATGATTAAGG + Intronic
1091935585 12:4432131-4432153 ATGATCCTCTAGAGAGATGAAGG + Intronic
1092145193 12:6210013-6210035 ATTATCTTCTAGGATGAGGAGGG + Intronic
1093344369 12:18023277-18023299 ATGCTCATATAGAATAATGCTGG - Intergenic
1093925813 12:24907361-24907383 ATGCTCTTCTAATTTTATGATGG + Intronic
1094693212 12:32790168-32790190 ATGGTCTTCTGGAATGAAGGGGG - Intergenic
1094868490 12:34570006-34570028 CTGTTCTTGTAGAATTATGAAGG - Intergenic
1097885799 12:64727848-64727870 ATGCTCTTAGATTATGATGATGG + Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098672624 12:73250492-73250514 ATGTTATTATATAATGATGAAGG + Intergenic
1098675279 12:73283041-73283063 ATTCTCTTCTAGAATTATTATGG + Intergenic
1100937399 12:99684963-99684985 ATTATCTTCTAGAATTTTGATGG - Intronic
1101082476 12:101202890-101202912 ATGCTTTTATAGAATAATCATGG - Intronic
1103419898 12:120771946-120771968 TGGCTCTTCCAGAATGAGGATGG - Intronic
1104717841 12:131028191-131028213 TTGCTTTTCTTGAATGATGTTGG + Intronic
1106132350 13:26950898-26950920 AAGCACTTCTAGAATGAGGTAGG + Intergenic
1108391180 13:49949241-49949263 ATTCTCTTCTAGAATTTTTATGG - Intergenic
1109631402 13:65053049-65053071 TTGTTCTTCTAGAATGTTGGTGG - Intergenic
1109904311 13:68818358-68818380 ATGCTGTTCTAAAATGATATGGG - Intergenic
1111594602 13:90395612-90395634 ATGCCCTTCTAGAAGACTGATGG - Intergenic
1111907305 13:94270408-94270430 ATGCTTTCATAGAATAATGAGGG + Intronic
1112667254 13:101589912-101589934 ATGCTCTTCTACAAACATGAGGG - Intronic
1114355648 14:21904843-21904865 ATAGTATTCTAGAATGATGGAGG + Intergenic
1114372900 14:22110054-22110076 TTGCTCTTCTTGAATGGGGAAGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1114919707 14:27311393-27311415 ATGCCCTTCTAGAATGCTGCAGG - Intergenic
1115751780 14:36500663-36500685 ACCATCTTCTAAAATGATGAGGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116925606 14:50633075-50633097 GTGCTGATATAGAATGATGAAGG + Intronic
1117207571 14:53459949-53459971 ATGCTCTCCTAGGATGGTGGAGG + Intergenic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1121395817 14:93622371-93622393 AGGGTCTTCCAGAGTGATGAGGG - Exonic
1121925979 14:97927735-97927757 TTGCTCATGTAGAATGATCATGG + Intronic
1122619275 14:103045244-103045266 ATGTTTTTAGAGAATGATGAGGG + Intronic
1124867676 15:33509271-33509293 AAACTCCTCTAGAATGAAGAGGG + Intronic
1126481980 15:49134504-49134526 TTGCTTTCCTAGACTGATGATGG - Exonic
1126654378 15:50960030-50960052 ATGTTATTATATAATGATGAAGG + Intronic
1130867295 15:87943770-87943792 AGGCTCTTCTGGGATGTTGAGGG - Intronic
1131919663 15:97310599-97310621 TGGATCTTCTAGAATGATAAAGG + Intergenic
1131988527 15:98068740-98068762 ATGCTCTGCAAAATTGATGACGG - Intergenic
1132278367 15:100590470-100590492 ATGCCCTTCTAGAAGATTGAAGG - Intronic
1133696686 16:8270764-8270786 ATTCCTTTCTAGAATGAAGAAGG - Intergenic
1134077020 16:11299185-11299207 ATGCACTTGTCTAATGATGAGGG + Intronic
1139149363 16:64362073-64362095 ATGCTCTTGAGGAATGATTATGG + Intergenic
1140637715 16:76935926-76935948 AAGCTATACTAGAATGCTGATGG + Intergenic
1140753498 16:78046920-78046942 AAGTGCTTCTAAAATGATGAAGG - Intronic
1141914886 16:87088650-87088672 ATGCTATACTAGAATCATGTTGG - Intronic
1148887676 17:50785586-50785608 ATAATTTTCTGGAATGATGATGG + Intergenic
1150560452 17:66289809-66289831 ATGTTAATCTGGAATGATGAGGG + Intergenic
1151151801 17:72094875-72094897 ATGCTCTTCAGGAGTGATCAAGG - Intergenic
1152677104 17:81647271-81647293 ATACTCTTCTAGAGTGGAGAGGG + Intronic
1153757227 18:8296559-8296581 CAGCTGTTCTAGAAGGATGAAGG - Intronic
1154376241 18:13812289-13812311 ATCCTCTTCCAGCATGAAGATGG - Intergenic
1156766226 18:40659890-40659912 ATGCTATTTCAGAATTATGAAGG - Intergenic
1157013303 18:43678854-43678876 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1158229668 18:55240036-55240058 ATACTCTTTTAGAAGGATTATGG - Intronic
1158324634 18:56301009-56301031 ATCCACTTCTAGAATGCTGCAGG + Intergenic
1158360162 18:56663396-56663418 ATGCTATTAGAGAATGATTATGG + Intronic
1159243352 18:65772791-65772813 GTTATCTTCTAGACTGATGATGG + Intronic
1163581814 19:18143933-18143955 AGGCTCCCCTAGAATGAAGACGG - Exonic
1164092274 19:21968311-21968333 TTGCTCTTTTAGTATGATGTTGG + Intronic
1164602179 19:29569547-29569569 AGGCTCTTCTTGGCTGATGAAGG - Intergenic
928275258 2:29894775-29894797 TTGCTTTTCTAGGAGGATGACGG + Intronic
928382638 2:30832928-30832950 ATGCCCTTCTAGAAGAATGAAGG - Intergenic
928732561 2:34249080-34249102 TTGCTCTTCTTGATTGTTGAAGG + Intergenic
933491775 2:82993568-82993590 AATCTCTTCTAGAAAGATGATGG - Intergenic
935387111 2:102511908-102511930 ATACTTTTCTAGAATGATCTAGG - Intronic
936125578 2:109787009-109787031 ATGCCCTTCTGGAAAGGTGAAGG + Intergenic
936219115 2:110584459-110584481 ATGCCCTTCTGGAAAGGTGAAGG - Intergenic
937047939 2:118862202-118862224 ATGCTCTTCTCAAATGGGGAGGG - Intergenic
937225188 2:120364722-120364744 ATGCTCTTTTTGAAGAATGACGG - Intergenic
938665433 2:133530638-133530660 ATGCTCTTCTAGCTTAAGGATGG + Intronic
938987276 2:136590021-136590043 ATGATTTTCTAAAATGATGAAGG + Intergenic
939063181 2:137449286-137449308 ATGTTTGTGTAGAATGATGAAGG + Intronic
939637805 2:144603917-144603939 ATGCTCCTGTAGAATGGTGGTGG + Intergenic
940014198 2:149086389-149086411 CTGCTCTTCCAGACTGAAGAAGG + Intronic
940473896 2:154135206-154135228 ATGCTCATTTACAAGGATGAAGG - Intronic
942529483 2:176894043-176894065 ATTCTGTTTTGGAATGATGAAGG - Intergenic
942612544 2:177756762-177756784 TTGATATTCTAGAATGTTGAAGG + Intronic
942979736 2:182065962-182065984 ATGGACTTCTAGAATGATACAGG - Intronic
943211128 2:184967917-184967939 ATGCTCTTCTGGAATCTTAATGG + Intergenic
943646252 2:190409570-190409592 ATGGACTTCTAGAAGGATTAGGG - Intronic
943874275 2:193043096-193043118 CTGCTCCTCTAAGATGATGAAGG + Intergenic
943969135 2:194380814-194380836 ATGCCCTTCTAGAAGAATGAAGG + Intergenic
1168916709 20:1494400-1494422 ATTCTCTCCTAGAATAATGATGG - Intergenic
1176726852 21:10443610-10443632 ATAATCTTTTAGAATGATGCTGG - Intergenic
1177326858 21:19601857-19601879 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1180287538 22:10763471-10763493 ATAATCTTTTAGAATGATGCTGG + Intergenic
1181453732 22:23041413-23041435 ATGCCCATCTAGAAGAATGAAGG + Intergenic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
950598111 3:14003665-14003687 ATGTTCTTCTAAAATGTTTAGGG + Intronic
953003798 3:38958893-38958915 ATGTTCATCTAGAATGAAGGTGG + Intergenic
953683005 3:45053434-45053456 CTGCTCTTCAGGAATGCTGAAGG - Intergenic
953686819 3:45084404-45084426 AGGCTCTTCCAGGATGATGAAGG + Exonic
957750863 3:84413533-84413555 ATGCCCTTCTAGAATAGTGAAGG - Intergenic
957825789 3:85441390-85441412 ATGTTTTTCTAGATTGATGCTGG + Intronic
959465161 3:106677121-106677143 ATGCTCATTCACAATGATGAAGG + Intergenic
959579785 3:107971616-107971638 TTCCTCTTCTGGAAGGATGATGG + Intergenic
963136975 3:141915157-141915179 ATGGTCTCCTTGAATGATAATGG + Intronic
963570891 3:146993971-146993993 CTGCTTTTCTAGAATGGTTAAGG + Intergenic
964764681 3:160168211-160168233 ATGCTCTTCCAAAAGGATGTAGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965345550 3:167544728-167544750 ATGTTCTTCTAGAATTTTTATGG - Intronic
966199169 3:177343598-177343620 ATGCTCTGGTAGAATCATCATGG - Intergenic
966705042 3:182904269-182904291 TTGCTCTTCTATGATGCTGATGG - Intronic
971035019 4:22683553-22683575 TTTCTTTTCTAGAATAATGAGGG - Intergenic
971919277 4:32915473-32915495 ATGCTCTACTAGAGTTATGATGG + Intergenic
974176056 4:58326586-58326608 ATGCTTTTCTAGAGTAACGATGG + Intergenic
974768312 4:66377619-66377641 TTGCTTGTCTAGAATGATGGAGG + Intergenic
977235362 4:94501793-94501815 ATGCCCTTGATGAATGATGATGG - Intronic
977350490 4:95879121-95879143 TTGCTCTTTTAGAATGTTGTGGG - Intergenic
977561700 4:98539497-98539519 AAGCTCCTCTAGAATGAGAAAGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979138392 4:117140441-117140463 ATACTCTTCAATAATGATGCTGG + Intergenic
981715946 4:147752186-147752208 ATGCTCTTCTATAATACTAAAGG - Intronic
982790208 4:159583058-159583080 TTGGTCTTATAGAATGATGTAGG + Intergenic
986098800 5:4586415-4586437 ATGCTGTCCTGGAATGATAAAGG - Intergenic
986766673 5:10934547-10934569 ATACTTTCCTGGAATGATGATGG + Intergenic
987531377 5:19125445-19125467 ATGCTATTCTGAAATGATGAAGG - Intergenic
987557543 5:19473649-19473671 ATCCTCTTCTGAAATGATCAAGG + Exonic
988294692 5:29341018-29341040 ATGGCCTTCAAGAAAGATGATGG - Intergenic
988639766 5:33028721-33028743 ATTATCTTCTAGAATGTTTATGG - Intergenic
988734455 5:34007117-34007139 ATGCTGTTTTAGAAGGAAGAAGG + Intronic
988780209 5:34513797-34513819 GAGCTCTTCTAGAAGGAGGAAGG + Intergenic
994262419 5:97675672-97675694 TTGCTCTTTTAGTATGATGTGGG - Intergenic
994347680 5:98706498-98706520 ATTATCTTCTAGAATGTTTATGG - Intergenic
994467662 5:100159043-100159065 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
995246615 5:109942447-109942469 CTGCTCTACGAGGATGATGAGGG + Intergenic
998302614 5:141039683-141039705 ATGCCCCTCCAGAATGAGGAGGG + Intergenic
998538399 5:142955602-142955624 ATGCTCTTCTACAATGATTGAGG - Intronic
999033092 5:148316320-148316342 CAGCTCTTCTAGAGTGCTGATGG + Intergenic
1001057706 5:168462953-168462975 ATGCTCTTCTAGGTTGAACATGG - Intronic
1004848606 6:19673127-19673149 ATTCTATTCTAGTATAATGAGGG - Intergenic
1005255998 6:24003688-24003710 ATGCTTTTCTGTAATGATAAAGG + Intergenic
1005478353 6:26231303-26231325 AGGGTCCTCTAGAATGAGGAAGG + Intergenic
1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG + Intergenic
1009405229 6:63304259-63304281 ATGCCCATCTAGAAAGGTGAAGG - Intronic
1010021593 6:71165801-71165823 ATACTCTACTACAATGATGCTGG - Intergenic
1010588824 6:77688200-77688222 ATGCTGTTCTACAATTAAGAAGG + Intergenic
1010881243 6:81175677-81175699 ATGTTCTTCTGTCATGATGAAGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1011232391 6:85177717-85177739 CTGCTCTACAAGAATGATAAAGG - Intergenic
1011945835 6:92901731-92901753 TTCCTCTTCTAGAATGATGTAGG - Intergenic
1012009744 6:93768258-93768280 CTCCTGTTCTAGAATGATAATGG - Intergenic
1012096051 6:94962752-94962774 ATGCACTTCTAGAATGGTGCAGG + Intergenic
1013345552 6:109256835-109256857 CTGCTCTCCTAGAATGTTAATGG - Intergenic
1013479235 6:110538821-110538843 TCGCTCTTCGAGAATGATGAGGG - Intergenic
1015831327 6:137372239-137372261 ATGCCCATCTAGAATACTGAAGG + Intergenic
1016493309 6:144631123-144631145 ATTCCCTTCTAGTATGAGGATGG + Intronic
1016562059 6:145407378-145407400 AGGCTCTTCTAGAATTAAGTAGG - Intergenic
1019311084 7:361192-361214 ATCCTCTTCTAAAACCATGACGG + Intergenic
1024337391 7:48223611-48223633 AGGCTCTGATGGAATGATGAGGG + Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1029523985 7:101083882-101083904 CTGCACTTCTAGAAGGACGAGGG - Intergenic
1030463382 7:109868940-109868962 ATGCTCTTATATTATGATGAAGG + Intergenic
1032791794 7:135247851-135247873 CTGCTCTTCCAGTATGAGGACGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033265551 7:139883430-139883452 ATGCTGTTATAGAAAGAGGATGG - Intronic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034603254 7:152284359-152284381 ATAGTCTTTTAGAATGATGCTGG + Intronic
1035490697 7:159274576-159274598 TTGCTCTAGTACAATGATGAGGG - Intergenic
1036220946 8:6921276-6921298 ATGGTCTTCCATAATGAGGAGGG - Intergenic
1038390181 8:27190641-27190663 ATGCTATCCTGGAATGGTGAGGG + Intergenic
1038951215 8:32416438-32416460 ATGCCCTCATAGAATGGTGAGGG - Intronic
1039332757 8:36557381-36557403 ATGCTTTTCTAGAAGGATATGGG - Intergenic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041167607 8:55104848-55104870 ATGCTCTTCAAGTATGATGAAGG + Intronic
1042587335 8:70355863-70355885 ATGATTTCCTAGAATGAGGATGG - Intronic
1044832790 8:96266679-96266701 ATGCTCATCTATAGTGATTATGG + Intronic
1045835704 8:106519050-106519072 CTGCTCTTCTTCAATGATGGGGG - Exonic
1046858717 8:119066222-119066244 ATGCTGTTCAAGAATGGAGAAGG + Intronic
1047797654 8:128274242-128274264 ATGTTCTTTTAGAATGATGCAGG + Intergenic
1048083595 8:131154385-131154407 AGGCTCTGCCAGAATGATGAGGG - Intergenic
1049774681 8:144398861-144398883 ATGCTCTTCTAGAATGATGATGG + Exonic
1051759088 9:20440592-20440614 ATTCTCTTCTAGGATGGTAAGGG - Intronic
1051982392 9:23037956-23037978 ATGTTCTTCTAGAATCACTAGGG - Intergenic
1052567598 9:30176684-30176706 ATGCTATTCTTTCATGATGACGG + Intergenic
1053290781 9:36878526-36878548 AAGCTATTCAAGAATGATGAAGG + Intronic
1055007718 9:71527595-71527617 AGGATCTTCTAGAATGAGGATGG - Intergenic
1059517588 9:114910128-114910150 AGCCTCTTCTAGAAGGATCATGG + Intronic
1186319535 X:8409456-8409478 ATGCTCTTCAAGAGACATGAGGG - Intergenic
1186612333 X:11149778-11149800 ATGCTCCCCCAGAATGAAGAAGG + Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1190434054 X:50406123-50406145 AAGCTCTTCTAGAATGTGCAAGG + Intronic
1190964153 X:55281558-55281580 ATGCTGTTAAAAAATGATGATGG + Intronic
1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG + Intergenic
1192983595 X:76372700-76372722 ATGCCCTTCTAGAATAGTGAAGG + Intergenic
1194307968 X:92271747-92271769 ATGCTCTTTTGCAATGATGCTGG + Intronic
1194860121 X:98988754-98988776 ATGCTCAGCTAAAAAGATGATGG - Intergenic
1195426325 X:104736016-104736038 GTGTGCTTCTAGAATAATGAAGG - Intronic
1195471855 X:105239392-105239414 ATGCCTTTCTAGAAGAATGAAGG + Intronic
1197673362 X:129303109-129303131 AGGCTTTTCTGGAATGAAGATGG - Intergenic
1199507212 X:148577499-148577521 CTGCTTTCCTAGACTGATGAAGG + Intronic