ID: 1049774969

View in Genome Browser
Species Human (GRCh38)
Location 8:144399952-144399974
Sequence GGCGGTGTGGGCAGAGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 277}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049774958_1049774969 4 Left 1049774958 8:144399925-144399947 CCAGGGGACCCTACAGGACTTGT 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1049774969 8:144399952-144399974 GGCGGTGTGGGCAGAGTTCATGG 0: 1
1: 0
2: 2
3: 31
4: 277
1049774952_1049774969 24 Left 1049774952 8:144399905-144399927 CCCTGGGGGAGTGAAGGGGGCCA 0: 1
1: 0
2: 5
3: 19
4: 238
Right 1049774969 8:144399952-144399974 GGCGGTGTGGGCAGAGTTCATGG 0: 1
1: 0
2: 2
3: 31
4: 277
1049774964_1049774969 -4 Left 1049774964 8:144399933-144399955 CCCTACAGGACTTGTGGGGGGCG 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1049774969 8:144399952-144399974 GGCGGTGTGGGCAGAGTTCATGG 0: 1
1: 0
2: 2
3: 31
4: 277
1049774953_1049774969 23 Left 1049774953 8:144399906-144399928 CCTGGGGGAGTGAAGGGGGCCAG 0: 1
1: 0
2: 4
3: 43
4: 364
Right 1049774969 8:144399952-144399974 GGCGGTGTGGGCAGAGTTCATGG 0: 1
1: 0
2: 2
3: 31
4: 277
1049774965_1049774969 -5 Left 1049774965 8:144399934-144399956 CCTACAGGACTTGTGGGGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1049774969 8:144399952-144399974 GGCGGTGTGGGCAGAGTTCATGG 0: 1
1: 0
2: 2
3: 31
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049774969 Original CRISPR GGCGGTGTGGGCAGAGTTCA TGG Intronic
901201846 1:7471664-7471686 GGCGGTAGGGGCAGAGGCCAAGG - Intronic
902466938 1:16624244-16624266 GGCGGGTTGGGCAGAGCCCAAGG + Intergenic
902507662 1:16948531-16948553 GGCGGGTTGGGCAGAGCCCAAGG - Intronic
902793990 1:18788326-18788348 GGCAGGGTGAGCAGAGTTAAGGG - Intergenic
902821509 1:18946138-18946160 CGCAGTGTGGGTAGAGCTCAGGG + Intronic
903000259 1:20260417-20260439 TGAGGTGTGGGCAGGGTTAAGGG + Intergenic
904979721 1:34488434-34488456 GGAGATGTGGGAAGATTTCAGGG - Intergenic
905233640 1:36530588-36530610 AGAGGTGTGGGCAGGGTTAAAGG - Intergenic
905310205 1:37043683-37043705 GGGGATGTGGGTAGAGATCAGGG + Intergenic
905408175 1:37751509-37751531 GGTGGTGTGATCACAGTTCATGG - Intronic
906017314 1:42593392-42593414 GGTGGTGTGATCAGAGGTCATGG - Intronic
907559587 1:55376191-55376213 GGCAGTCTAGGCAGAGATCATGG + Intergenic
907592302 1:55686728-55686750 AGAGGTGTGGGCAGAGTTAAAGG - Intergenic
909943024 1:81632770-81632792 GTCATTGTGGGCAGAGTTGAGGG + Intronic
910626043 1:89308239-89308261 GCCAGTGTGTGCAGAGTACATGG - Intergenic
914429943 1:147612112-147612134 GGAGGTGCGGGGAGAGGTCAGGG - Intronic
915169950 1:153970565-153970587 GGCCGTCTGGGCAGCGTCCAAGG + Intronic
917839441 1:178965657-178965679 GGCAGAGTGGGCAGGGATCAGGG - Intergenic
918118218 1:181515157-181515179 GGCAGTGTGGGATGAGCTCAGGG + Intronic
919640541 1:200040749-200040771 GGTGTTGAGAGCAGAGTTCAGGG + Intronic
921702865 1:218287035-218287057 GGCGGTGGGGGAGGAGGTCAAGG - Intronic
923866512 1:237945481-237945503 GGCGGTGTGTGCATGCTTCATGG + Intergenic
1067513913 10:46920544-46920566 GGTGCTGGGGGCAGGGTTCAGGG + Intronic
1067648341 10:48131288-48131310 GGTGCTGGGGGCAGGGTTCAGGG - Intergenic
1067689175 10:48490377-48490399 GAGGGAGTGGGCAGAGGTCAGGG - Intronic
1067743538 10:48914876-48914898 GGGGGTGCGGGCAAAGCTCATGG + Intronic
1069688516 10:70334696-70334718 GTGGGTGTGGGCAGAGGGCATGG - Intronic
1071336167 10:84601888-84601910 GGGTGTGTGGGGAGTGTTCACGG - Intergenic
1071439616 10:85678749-85678771 GGCGGTGGTGGCAGAGCTAAGGG - Intronic
1072429197 10:95356136-95356158 GGCAGTGGCGGCAGTGTTCATGG - Intronic
1073452955 10:103620246-103620268 GGTGGCGTGGTCAGTGTTCACGG - Intronic
1074450040 10:113551897-113551919 GGCGGGGTGGGGGGAGTTGATGG + Intronic
1074661168 10:115659239-115659261 AAAGGTGTGGGCAGAGTGCAGGG - Intronic
1075889573 10:125935042-125935064 GGGGGTGTGGGCAGAGCTGCTGG + Intronic
1075961849 10:126573642-126573664 GGAGGTGTGCGCAGCATTCAAGG - Intronic
1077269858 11:1670778-1670800 GGTGGTGTGGGCAGTGTGGATGG + Intergenic
1077333336 11:1992952-1992974 GGTGGTGGGGGCAGCGTTCAGGG - Intergenic
1078872646 11:15363318-15363340 AAGGGTGTGGGCAGAGTTTAAGG - Intergenic
1081586342 11:44386609-44386631 GGCTGTGTGGGGAGAGATCAAGG - Intergenic
1083272366 11:61578918-61578940 GGGGGTGAGGGAAGAGTTGAGGG + Intronic
1083289237 11:61680565-61680587 GGCGGGCTGGGCAGTGTCCAGGG + Intronic
1083397617 11:62402240-62402262 GGAGGTGAGGGCAGCGGTCATGG - Intergenic
1083849774 11:65358280-65358302 GGAGGTAGGGGCAGAGTACAAGG + Intergenic
1084429325 11:69102483-69102505 GGGGGCGTGGGCAGAGCTGATGG - Intergenic
1084707222 11:70822566-70822588 GGTGGCGCTGGCAGAGTTCACGG + Intronic
1084707290 11:70822845-70822867 GGTGGCGTTGGCAGAGGTCACGG + Intronic
1084707330 11:70823000-70823022 GGTGATGTTGGCAGAGTTCATGG + Intronic
1084707381 11:70823215-70823237 GGTGGCGCTGGCAGAGTTCACGG + Intronic
1084707388 11:70823246-70823268 GGTGGCGCTGGCAGAGTTCACGG + Intronic
1084707395 11:70823277-70823299 GGTGGCGCTGGCAGAGTTCATGG + Intronic
1084707410 11:70823339-70823361 GGTGGTGTTGGCAGAACTCATGG + Intronic
1084707436 11:70823461-70823483 GGTGGCGTTGGCAGAGTTCACGG + Intronic
1084707460 11:70823585-70823607 GGTGGCGTTGGCAGCGTTCACGG + Intronic
1084707488 11:70823740-70823762 GGTGGCGTTGGCAGCGTTCATGG + Intronic
1084707552 11:70824104-70824126 GGAGGTGCTGGCAGAGCTCATGG + Intronic
1085440868 11:76561247-76561269 GGAGGTGGAGGCAGAGCTCATGG + Intergenic
1086948496 11:92867459-92867481 AGGGGAGTGGGCAGAGTTGATGG - Intronic
1087149279 11:94844134-94844156 GGTGGTGGTGGCAGAGTTAAAGG - Intronic
1088073304 11:105816096-105816118 GGACGTGTGGGCAGAGATCTGGG - Intronic
1088914845 11:114219768-114219790 AGTGGTGTGGGGTGAGTTCAAGG + Intronic
1088919967 11:114253602-114253624 GGAGGTATGGGGAGAGCTCAGGG + Intergenic
1089462366 11:118660701-118660723 GGCTCTGTGGGCTGAGCTCAAGG - Exonic
1089596793 11:119585567-119585589 TGCGGTGTGGTCAGAGTCCAAGG - Intergenic
1090598332 11:128343145-128343167 GGCCGTGAAGGCTGAGTTCAGGG - Intergenic
1090998874 11:131891594-131891616 GGTGGAGTGGGCAGAGTCCTCGG - Intronic
1202816316 11_KI270721v1_random:48133-48155 GGTGGTGGGGGCAGCGTTCAGGG - Intergenic
1093999545 12:25680324-25680346 GCAGGTGTTGGGAGAGTTCATGG + Intergenic
1094415006 12:30206904-30206926 GGAGGTGAAAGCAGAGTTCATGG - Intergenic
1096239262 12:49950863-49950885 GGCTGTGTTCGCAGAGTTCCTGG + Exonic
1096241418 12:49962053-49962075 GGCCGTGTTCGCAGAGTTCTTGG + Exonic
1096243747 12:49973248-49973270 GGCGCTGTTTGCAGAGTTCCTGG + Exonic
1096513363 12:52143956-52143978 TGTGGTGTGGGCAGAGTTCATGG + Intergenic
1097157738 12:57025338-57025360 GGCTGTGTGGGCAAAGAACATGG + Intronic
1098249023 12:68549562-68549584 GAAAGTGTGGGCAGAGTACATGG - Intergenic
1100187981 12:92158246-92158268 GGCGGTGGGGGCAGGGGGCAAGG - Intergenic
1100898512 12:99212474-99212496 AGCAGTGTTAGCAGAGTTCAGGG - Intronic
1102648856 12:114422245-114422267 GGAGGGGTGGGCATGGTTCATGG + Intergenic
1104177896 12:126350769-126350791 GGTGGGGTGGGGAGAGTTCCTGG + Intergenic
1104977886 12:132560331-132560353 GGCGGTGTGGGCAGAAGGCCCGG - Intronic
1105503390 13:20990803-20990825 GGCAGTGTGGGCAGAGCGCTGGG - Intronic
1107012775 13:35684533-35684555 AGGGCTGTGGGCAGAGTGCAGGG + Intergenic
1107082352 13:36388358-36388380 GAGGGAGTGGGCAGAGTACATGG - Intergenic
1108496937 13:51034513-51034535 GGAGGTGTTGGCAGTGTTCGTGG - Intergenic
1112764965 13:102731735-102731757 GGCGGTATGGGCACAGTTCCTGG + Exonic
1113115411 13:106869770-106869792 GGAGATGTGGGAAGAGTGCAGGG + Intergenic
1113599090 13:111555436-111555458 GGCACTGTTGGCAGAGTTCCTGG + Intergenic
1113737338 13:112688528-112688550 TGCGGTGTGGTCATGGTTCAAGG + Intergenic
1113929125 13:113957198-113957220 GGGGGTGCAGGCAGAGTGCAGGG - Intergenic
1113929185 13:113957439-113957461 GGGGGTGCAGGCAGAGTGCAGGG - Intergenic
1113929209 13:113957535-113957557 GGGGGTGCAGGCAGAGTGCAGGG - Intergenic
1113929222 13:113957584-113957606 GGGGGTGCAGGCAGAGTGCAGGG - Intergenic
1113929234 13:113957632-113957654 GGGGGTGCAGGCAGAGTGCAGGG - Intergenic
1113929266 13:113957777-113957799 GGGGGTGCAGGCAGAGTGCAGGG - Intergenic
1113929312 13:113957971-113957993 GGGGGTGCAGGCAGAGTGCAGGG - Intergenic
1113929362 13:113958166-113958188 GGGGGTGCAGGCAGAGTGCAGGG - Intergenic
1114135971 14:19851399-19851421 GGCTTTGAGGGCACAGTTCAGGG - Intergenic
1117840265 14:59853563-59853585 GAAGGTCTGGGCAGAGTTCTGGG - Intronic
1117971694 14:61257312-61257334 GGCGGCGAGGTCAGAGGTCAGGG + Intronic
1121820204 14:96959679-96959701 GGCTGTGTGGGCTGAATCCAGGG - Intergenic
1122133326 14:99618746-99618768 GCCGGTGTGGGCACAGAGCAGGG + Intergenic
1122353402 14:101110320-101110342 AGTGGTGTCGGCAGAGTGCAGGG + Intergenic
1122368928 14:101216887-101216909 GGGGGTGTTGCAAGAGTTCATGG - Intergenic
1122972995 14:105159814-105159836 GGGGGTGTGGACAGAGCTCTGGG - Intronic
1122973105 14:105160125-105160147 GGTGGTGTGGACAGAGTCCTGGG - Intronic
1202828485 14_GL000009v2_random:2337-2359 GGCGGTGTGTGCATGCTTCATGG - Intergenic
1125000565 15:34765736-34765758 GCATGTGTGGGCATAGTTCATGG + Intergenic
1126452459 15:48823597-48823619 AAAGGTGTGGGCAGAGTTTAGGG - Intergenic
1126462839 15:48931597-48931619 GGGGTAGTGTGCAGAGTTCAGGG - Intronic
1126796188 15:52261969-52261991 GGGGGTGTGGGTAGAGCGCAGGG - Intronic
1128311580 15:66634300-66634322 GGCGGTGTGGGCAGAGCTGGAGG + Intronic
1128708771 15:69856713-69856735 GGTGGTGTGGTCAGACCTCAGGG + Intergenic
1129923349 15:79339575-79339597 GGTGGTGTTGGCAGTGATCATGG + Intronic
1131098630 15:89671432-89671454 GGCGGTGACGACAGAGTGCAGGG + Intronic
1131140436 15:89972716-89972738 GGCCCAGTGGGCAGAGTTCCAGG - Intergenic
1132892964 16:2213487-2213509 GGCGTTGTGGGCTGGGTTCTGGG - Exonic
1132936515 16:2483984-2484006 GGCAGTGGGGGCACAGGTCAGGG + Intronic
1133877929 16:9752304-9752326 TGAGGTTTGGCCAGAGTTCAAGG + Intergenic
1134419291 16:14071216-14071238 GGCGGGGTGGGCAGCGTCCGGGG + Intergenic
1134518451 16:14905859-14905881 GGTGGTGTGATCATAGTTCATGG - Intronic
1134555478 16:15160358-15160380 GGTGGTGTGATCATAGTTCATGG + Intergenic
1134706122 16:16304512-16304534 GGTGGTGTGATCATAGTTCATGG - Intergenic
1134961418 16:18407598-18407620 GGTGGTGTGATCATAGTTCATGG + Intergenic
1134965718 16:18490201-18490223 GGTGGTGTGATCATAGTTCATGG + Intronic
1136252153 16:29012412-29012434 GGCCATGGGGGCAGAGTTCCAGG - Intergenic
1136501211 16:30670392-30670414 GGGGGTGGGGGCAGAGTGAACGG - Exonic
1138222237 16:55261692-55261714 GGAGGAGTGGGCACAGTTCTGGG - Intergenic
1138657167 16:58498185-58498207 GGCATTGTGGGCAGAGGGCAGGG + Intronic
1139766935 16:69238405-69238427 GAAGATGTGGGCAGAGTGCAGGG - Intronic
1140054796 16:71516392-71516414 GGCGGTGTGGGGAGAGGTCACGG + Intronic
1140146593 16:72316916-72316938 AGCTGTGTGGGCAGGGTTAAAGG - Intergenic
1141645682 16:85366221-85366243 GGCAGTGGGGGCAGAGCTCTGGG - Intergenic
1142492769 17:289434-289456 GGCGGTGGCAGCAGAGATCAGGG - Intronic
1143203579 17:5128492-5128514 GGCGGGGAGGGCTGAGGTCAGGG + Intronic
1143274538 17:5700339-5700361 TGCAGTGTGAGCAGAGTTCATGG + Intergenic
1144406889 17:14960492-14960514 GGAGGTCTGGCCAGAGTTCAAGG - Intergenic
1144767586 17:17740977-17740999 GGCAGTGTGGGGAGAGGGCAGGG + Intronic
1144827717 17:18115740-18115762 GGTGGTGAGGTCAGAGTTCAGGG - Intronic
1145044155 17:19599446-19599468 GGCGGTGTGTGCATGCTTCATGG - Intergenic
1145855114 17:28148227-28148249 GGGGGTGGGGGCAGGGTACAGGG - Intronic
1147446167 17:40476493-40476515 GGCGGCGGGGGCAGAGATAAGGG - Exonic
1148105214 17:45115158-45115180 GGCGTTGGGGGCAGGGTGCAGGG + Exonic
1149071326 17:52547104-52547126 AGAGGGGTGGGTAGAGTTCAGGG - Intergenic
1149553203 17:57555226-57555248 GGCGGTGGGTGCAGAGGACAGGG - Intronic
1151107315 17:71631372-71631394 GGTGGTGTAGGCAGAGTTTGTGG - Intergenic
1151318173 17:73336711-73336733 GGGTGGGTGAGCAGAGTTCAAGG - Exonic
1151577201 17:74958781-74958803 GGCCAAGTGGGCTGAGTTCAAGG + Intronic
1152991281 18:366004-366026 GGTGATGTGGGCAGAATTCTGGG - Intronic
1153463700 18:5365305-5365327 AGGGCTGTGGGGAGAGTTCAGGG - Intergenic
1154460359 18:14578053-14578075 GGCTTTGAGGGCACAGTTCAGGG - Intergenic
1159937148 18:74378337-74378359 GGGAGTGTGGGTAGAGATCATGG - Intergenic
1160397773 18:78584516-78584538 GCAGGTGTGGGCAGAGGCCATGG + Intergenic
1160699095 19:497639-497661 GGCGGTCGGGGCGGGGTTCAGGG + Intronic
1160832312 19:1109638-1109660 GGCGGGGTGGGCAGAGTGTGAGG + Intronic
1161236595 19:3201383-3201405 GCTGCTGTGGGCAGAGGTCATGG + Intronic
1162470640 19:10870773-10870795 GGCAATGTGGGCAGAGATGATGG + Intergenic
1162480561 19:10924647-10924669 GGCAGTGAGGGCAGAGGGCAAGG - Intronic
1163121465 19:15220738-15220760 AGTGGTGTGGGCAGAGTTTGGGG - Intergenic
1166372011 19:42307115-42307137 GGCAGGGTGGGCAGAGTGAAGGG - Intronic
1167211268 19:48135627-48135649 GGGGCTGTGGGCAGAGTGCCAGG - Intronic
1167339146 19:48904492-48904514 TGCTGGGAGGGCAGAGTTCAGGG + Intronic
1167386352 19:49166296-49166318 GGCGGAGGGGCCAGGGTTCAGGG - Intronic
1167418165 19:49388082-49388104 GGCGGTGTGGGCTGTGGCCACGG - Intergenic
1167685103 19:50951030-50951052 GGAGGTGGGGTCAGAGCTCATGG + Intronic
1168016959 19:53581591-53581613 GGTGGTGTGGTTAGAGCTCAGGG + Intergenic
1168065192 19:53915279-53915301 GGTGGTGAGAGCAGAGGTCAAGG + Intronic
1168713143 19:58513018-58513040 GGTGCTGGGGGCAAAGTTCAGGG - Intergenic
1202644211 1_KI270706v1_random:125483-125505 GGCGGTGTGTGCATGCTTCATGG + Intergenic
925051682 2:820450-820472 GGCAGTGAGGGCTGAGTGCAGGG - Intergenic
925365813 2:3311657-3311679 GGTGGTGTCTGCAGAGTACAGGG + Intronic
925395223 2:3528710-3528732 GCACGTGTGGGCAGAGTGCAGGG - Intergenic
927911277 2:26901742-26901764 GGTGTTGTGTGCAGGGTTCAGGG - Intronic
928087517 2:28355292-28355314 GGGGGTGTGGGCAGAGGGAATGG - Intergenic
929546155 2:42856357-42856379 GGAGGTGAGTGCAGAGGTCAGGG - Intergenic
931379132 2:61735938-61735960 GGTGCTGAGGCCAGAGTTCAGGG - Intergenic
932585537 2:73025767-73025789 GGCGGCATGGCCAGAGATCAGGG + Intronic
933983980 2:87575530-87575552 GGAGGTGAGGGCAGGGTCCATGG - Intergenic
934573047 2:95384223-95384245 GGCAGAGGGGACAGAGTTCAGGG + Exonic
936309874 2:111375266-111375288 GGAGGTGAGGGCAGGGTCCATGG + Intergenic
936442698 2:112568802-112568824 GGCTGTGTGGAAAGAGTTCCTGG - Exonic
936574463 2:113641725-113641747 GGTGGACTGGGCAGAGTCCAAGG + Intronic
936861150 2:117022075-117022097 GGCGGTGTGTGCGTACTTCACGG - Intergenic
942657151 2:178225981-178226003 AGTGGTGAGGGCAGAGTCCAGGG + Intronic
942760994 2:179398199-179398221 GGCAGTGTGGGGAGAATACATGG - Intergenic
945167965 2:206966498-206966520 GGAGGGGTGGGCAGGATTCAGGG - Intronic
945541699 2:211095822-211095844 AGCTGTGTGGGCATGGTTCATGG - Intergenic
947004209 2:225492004-225492026 AGGGGTGTGGGCTGAGTCCAGGG + Intronic
948469321 2:238167158-238167180 GCCAGTGTGGGCAGAGTTCCGGG - Intronic
1168847716 20:956836-956858 GGCAGTCTGGGCAGAGCCCAGGG - Intergenic
1168966738 20:1903192-1903214 GGGGGAGTGAGCAGAGGTCAGGG + Intronic
1171389031 20:24789481-24789503 GGGGGTGTGGGGAGACTTCCAGG - Intergenic
1172609159 20:36236597-36236619 GGCGAGGTGGGCCTAGTTCAAGG - Exonic
1172625829 20:36346193-36346215 GGCTCTATGGGCAGAGTCCAAGG + Intronic
1172805931 20:37611560-37611582 GGCGGGGTGGGAAGAGGTGAGGG - Intergenic
1175533473 20:59690540-59690562 GGAGGTGTGTGCAGAGTGGAAGG + Intronic
1175738914 20:61406788-61406810 GGTGGTCTGGGCAGAGCACACGG - Intronic
1175937007 20:62518539-62518561 GGCGGTGCTGGCAAAGATCAGGG + Intergenic
1176607667 21:8847165-8847187 GGCGGTGTGTGCATGCTTCATGG - Intergenic
1176813746 21:13574782-13574804 GGCTTTGAGGGCACAGTTCAGGG + Intergenic
1178359945 21:31940820-31940842 GTCGCTCTGGGCAGAATTCAGGG + Intronic
1178818727 21:35955501-35955523 GGAGGTGTGGGCAGGGATCATGG - Intronic
1179635300 21:42704755-42704777 GGGGGTGGGGGCAGGGTGCAGGG + Intronic
1179990284 21:44944665-44944687 GGCTGTGGGGGCAGAGCTCAGGG + Intronic
1180357751 22:11856956-11856978 GGCGGTGTGTGCATGCTTCATGG - Intergenic
1180380514 22:12135377-12135399 GGCGGTGTGTGCATGCTTCATGG + Intergenic
1181277835 22:21697597-21697619 GGCGGTGTGGCCAGAGGACAGGG + Exonic
1181806150 22:25375648-25375670 GGAGGTGTGTGCAGAGTGCGTGG - Intronic
1182468147 22:30530909-30530931 GGGGGTGAGGGCAGAGATCAGGG + Intronic
1182487227 22:30646808-30646830 GACGGTGAGGGCAGAGGTGAGGG - Exonic
1183493517 22:38129040-38129062 GCCTGTGTGGGCAGAGTGCATGG - Intronic
1184109664 22:42387488-42387510 GGGGGTGAAGGCAGAGGTCATGG - Intronic
1184592813 22:45496461-45496483 GGAGGGGTGGGCAGAGACCAGGG + Intergenic
1185092668 22:48784832-48784854 GGAAGTTTGGGGAGAGTTCAGGG - Intronic
1185219522 22:49622469-49622491 GGCGGTGTGGGCAGGGCTGGCGG + Intronic
1185293354 22:50040048-50040070 GCCAGTGTGGACAGAGCTCACGG + Intronic
1185425707 22:50769158-50769180 GGTGGACTGGGCAGAGTCCAAGG - Intronic
950756489 3:15177726-15177748 TGCAGTTTGGGCAGAGCTCAGGG - Intergenic
954479858 3:50788768-50788790 GGCAGGGTGGGCAGAGCGCAGGG + Intronic
954519258 3:51208833-51208855 GGCGCTGGGGGCAGAGTACTTGG - Exonic
959074384 3:101734832-101734854 GGTGATGTGGGCAGAGATAAAGG + Intronic
961465341 3:127077827-127077849 GGGGGTGTGGGCAGGCTTTAGGG + Intergenic
961551357 3:127672241-127672263 GGCGGGGTGGGGAGAGGCCATGG - Intronic
961660037 3:128463661-128463683 GGTGGTGTGGGCTGAGTCCCGGG + Exonic
962977429 3:140457834-140457856 GGAAGTGTGGGCAGAGTTGACGG - Intronic
964704777 3:159606579-159606601 AGAGGTATGGGCAGAGTTCAAGG + Intronic
965720942 3:171661619-171661641 GGCGGAGTAGGGAGAGTGCAGGG - Intronic
968644278 4:1731179-1731201 CGAGGTGCTGGCAGAGTTCAAGG - Exonic
969247105 4:5942286-5942308 GGTGGTCTGGGCACAGTCCAAGG + Intronic
971037851 4:22714571-22714593 GATGGTGTGAGCAGGGTTCAAGG - Intergenic
972716379 4:41650504-41650526 GAAGGTGTGGCCAGAGTGCACGG + Exonic
973982055 4:56315265-56315287 GGCGGTGTGGGGAACGCTCAGGG - Exonic
975782360 4:77852967-77852989 TGAGGTGTGGGCAGGGTTAAGGG + Intergenic
979741750 4:124159609-124159631 GACGGTGTGTGCAGAGTGCCTGG - Intergenic
980285630 4:130775694-130775716 GGGAGTGTGGGCAGAGGTAAGGG - Intergenic
982087771 4:151853817-151853839 GGAGGTGTGGGCAGAGTTAGAGG + Intergenic
985701320 5:1374834-1374856 GGCAGTGTGCCCAGAGTCCACGG + Intergenic
987366191 5:17151326-17151348 GGTGGTGTGATCATAGTTCACGG + Intronic
990040060 5:51369082-51369104 GGTGATCTGGGGAGAGTTCAAGG - Intergenic
991966049 5:72092265-72092287 TGCTGTGTTGGCAGATTTCAAGG + Intergenic
994134857 5:96274334-96274356 GCCGGGGTGGGCAGATTACAAGG - Intergenic
995551893 5:113289762-113289784 TGCAGTTTGGGCAGAGTTCAGGG - Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
998054694 5:139064358-139064380 GGTGGTGTGTGCAGGGATCAGGG + Intronic
999175127 5:149626776-149626798 GACGGTATGGGCAGAATTTAGGG + Intronic
1000246636 5:159453773-159453795 GAAGGTGTGGGCAGATTTAAGGG + Intergenic
1002711880 5:181200036-181200058 GAAGGTGGGGGCAGAGTTCCAGG - Exonic
1003742121 6:8952782-8952804 AGAGGTATGGGTAGAGTTCAGGG + Intergenic
1004433454 6:15567164-15567186 GGCTGAGTGGGCTGAGTGCAGGG + Intronic
1005041236 6:21602237-21602259 GGCGGTGTCGGCCAAGTTCGAGG + Intergenic
1006303561 6:33206667-33206689 GGGGGGGTGAGCAGAGTCCAGGG - Exonic
1006459785 6:34151685-34151707 GGCGGGGTGGGCAGCGCTCCAGG - Intronic
1006516141 6:34546785-34546807 GGTGGGGTGGGCAGAGACCAAGG + Intronic
1006668723 6:35716433-35716455 GGAGGGGTGGGCAGAGGTGATGG + Intronic
1006709281 6:36051519-36051541 GGCTGTGTGGGTAGAGCACAGGG - Intronic
1007644513 6:43369713-43369735 GGCGGGGCGTGCAGAGCTCAGGG - Intergenic
1008077380 6:47159282-47159304 GGCTGTGTGGGGATAGTTCAGGG + Intergenic
1011640731 6:89413728-89413750 AGGGGTGTGGACAGAGTTTAGGG + Intergenic
1012161362 6:95888957-95888979 GGTTTTGTGGGCAGAGCTCAAGG - Intergenic
1012842724 6:104350407-104350429 GGAGGAGTGGGCAGACTCCAGGG - Intergenic
1013249998 6:108324627-108324649 GGCGGTGTCGGCAGAATGCAGGG - Intronic
1013671529 6:112408664-112408686 GGAGGTATGTGCAGAGCTCAAGG - Intergenic
1015384293 6:132604813-132604835 TGTGGTGTGGGCAGTGTTTAAGG + Intergenic
1015597034 6:134875715-134875737 AGAGCTGTGGGCAGAGTTGAGGG + Intergenic
1015624927 6:135170957-135170979 GTCGGTGAGGGGAGAGTTTAGGG + Intergenic
1016134846 6:140527444-140527466 GACGGTGAAGGCAGAGATCAGGG + Intergenic
1020107734 7:5429928-5429950 GGCGGTGTCGGCACAGGTCTAGG + Intergenic
1022152150 7:27618803-27618825 GGCGGAGTGGGCATATTACATGG + Intronic
1022569061 7:31433629-31433651 AGTGGGGTGGACAGAGTTCATGG + Intergenic
1023818821 7:43969105-43969127 GGCTGTGTGATCAGAGTTCGGGG + Intergenic
1024417335 7:49121969-49121991 GGCGGGATTGGGAGAGTTCAGGG + Intergenic
1025994337 7:66518642-66518664 GGGGGTGTGGGCAGAATGCCAGG - Intergenic
1026439586 7:70432461-70432483 GTCAGTGTGGGTAGAATTCATGG - Intronic
1026547214 7:71333931-71333953 GGAGTTTTGAGCAGAGTTCAGGG + Intronic
1029743869 7:102506071-102506093 GGCTGTGTGATCAGAGTTCGGGG + Intronic
1029761858 7:102605234-102605256 GGCTGTGTGATCAGAGTTCGGGG + Intronic
1032699233 7:134364144-134364166 AGTGGTGTGGGCAGAGTATAGGG - Intergenic
1035237280 7:157506759-157506781 AGAGATCTGGGCAGAGTTCATGG + Intergenic
1037732710 8:21541711-21541733 GCTGGTGTGTGCAGAGATCATGG + Intergenic
1039074530 8:33677860-33677882 AGCAAAGTGGGCAGAGTTCAAGG - Intergenic
1040008440 8:42640759-42640781 AGAGGTGTGGGCAGAGTTAAGGG + Intergenic
1040295483 8:46146855-46146877 GGTGGAGTGGGCAGGCTTCAGGG - Intergenic
1040301870 8:46192186-46192208 GGCGGTGTGGGCAGGTCACAGGG + Intergenic
1040323880 8:46331490-46331512 GGTGGTGTGGGCAGGCTGCAGGG + Intergenic
1040551637 8:48442319-48442341 GGCGGTGTGGGGAGACTTCCTGG + Intergenic
1041686251 8:60647673-60647695 AGAAGTGTGGGCAGAGTTAAGGG + Intergenic
1042585653 8:70335213-70335235 GGCAGTGTGAGCAGAGATCATGG - Intronic
1043278899 8:78438290-78438312 GGCAGTGTGGGAAGAGCCCAGGG + Intergenic
1047681461 8:127258229-127258251 GGTGGTGTGGGCAGGGATCATGG + Intergenic
1048816486 8:138339412-138339434 GGTGGTGGGGGAGGAGTTCAGGG - Intronic
1049190107 8:141282604-141282626 GGAGGCGAGTGCAGAGTTCATGG - Intronic
1049586722 8:143435807-143435829 GGAGCCGTGGGCAGAGTCCAGGG - Intergenic
1049774969 8:144399952-144399974 GGCGGTGTGGGCAGAGTTCATGG + Intronic
1050089069 9:1998299-1998321 AAAGGTGTGGGCAGAGTTCAGGG + Intergenic
1052036670 9:23689538-23689560 TACGGGGTTGGCAGAGTTCATGG + Intergenic
1052045801 9:23792826-23792848 AGCGGTGTGGTCACAGCTCACGG + Intronic
1052901188 9:33796167-33796189 TGCAGTGAGGGCAGAGTTGAGGG - Intronic
1059526941 9:115000747-115000769 GGTGATGTGGTCAGAGTTCAGGG - Intergenic
1059780214 9:117518277-117518299 GGCGGGGTGGGGGGTGTTCAGGG - Intergenic
1061265625 9:129503268-129503290 GGCGGAGTGGCCAGAAATCAGGG - Intergenic
1061716493 9:132521565-132521587 GGCAGAGTGGGCAGAGCTAAGGG + Intronic
1062358622 9:136177042-136177064 GGGGGTGTGGGCAGAGGTACTGG - Intergenic
1062542475 9:137047751-137047773 GGGGGTGAGGGTAGAGGTCAGGG - Intergenic
1062569598 9:137179057-137179079 GGCGGGCGGGGCTGAGTTCAAGG - Intronic
1203703010 Un_KI270742v1:12053-12075 GGCGGTGTGTGCATGCTTCATGG - Intergenic
1186545247 X:10442409-10442431 GCCAGTGTGGCCAGAGTGCAGGG + Intergenic
1189300879 X:39951490-39951512 TGGGATGTGGGCAGAGTTCAGGG + Intergenic
1190324529 X:49198931-49198953 GGCTGTTGGGGCAGAGTGCAGGG - Intronic
1190740266 X:53283985-53284007 GGCGGGGTGGGAAGAGCACAGGG + Intronic
1191854087 X:65608666-65608688 TGAGGTGTTGGCAGAGTACATGG + Intronic
1193150395 X:78118629-78118651 AGAGGTGTGGGTAGGGTTCAGGG + Intronic
1199214912 X:145252451-145252473 GGTGTTGTGGGGAGAGTTGACGG + Intronic
1200022854 X:153226384-153226406 GGCGATGTGGTCAGAGGTGAAGG + Intergenic