ID: 1049776230

View in Genome Browser
Species Human (GRCh38)
Location 8:144406664-144406686
Sequence CTCTGCACTGCTGCCTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049776222_1049776230 30 Left 1049776222 8:144406611-144406633 CCTCCATACCAGACCTCAATCCT 0: 1
1: 0
2: 0
3: 29
4: 327
Right 1049776230 8:144406664-144406686 CTCTGCACTGCTGCCTGATGTGG No data
1049776225_1049776230 17 Left 1049776225 8:144406624-144406646 CCTCAATCCTCAATTCTAGACTC 0: 1
1: 0
2: 2
3: 48
4: 251
Right 1049776230 8:144406664-144406686 CTCTGCACTGCTGCCTGATGTGG No data
1049776226_1049776230 10 Left 1049776226 8:144406631-144406653 CCTCAATTCTAGACTCTTGCACA 0: 1
1: 0
2: 0
3: 43
4: 347
Right 1049776230 8:144406664-144406686 CTCTGCACTGCTGCCTGATGTGG No data
1049776224_1049776230 22 Left 1049776224 8:144406619-144406641 CCAGACCTCAATCCTCAATTCTA 0: 1
1: 0
2: 2
3: 20
4: 237
Right 1049776230 8:144406664-144406686 CTCTGCACTGCTGCCTGATGTGG No data
1049776223_1049776230 27 Left 1049776223 8:144406614-144406636 CCATACCAGACCTCAATCCTCAA 0: 1
1: 0
2: 2
3: 13
4: 155
Right 1049776230 8:144406664-144406686 CTCTGCACTGCTGCCTGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049776230 Original CRISPR CTCTGCACTGCTGCCTGATG TGG Intronic
No off target data available for this crispr