ID: 1049777558

View in Genome Browser
Species Human (GRCh38)
Location 8:144413634-144413656
Sequence TCCGCCTCCCGCGGTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 48}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049777558_1049777569 1 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777569 8:144413658-144413680 CCGCAGGCCTGGGGTGGGGCTGG 0: 1
1: 0
2: 24
3: 145
4: 1055
1049777558_1049777564 -8 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777564 8:144413649-144413671 GAGGCGGAGCCGCAGGCCTGGGG 0: 1
1: 0
2: 2
3: 39
4: 382
1049777558_1049777574 15 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777574 8:144413672-144413694 TGGGGCTGGGAGTGTGGGCGTGG 0: 1
1: 2
2: 11
3: 185
4: 1539
1049777558_1049777570 2 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777570 8:144413659-144413681 CGCAGGCCTGGGGTGGGGCTGGG 0: 1
1: 0
2: 8
3: 145
4: 951
1049777558_1049777573 10 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777573 8:144413667-144413689 TGGGGTGGGGCTGGGAGTGTGGG 0: 1
1: 2
2: 20
3: 288
4: 1941
1049777558_1049777567 -3 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777567 8:144413654-144413676 GGAGCCGCAGGCCTGGGGTGGGG 0: 1
1: 0
2: 5
3: 81
4: 692
1049777558_1049777572 9 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777572 8:144413666-144413688 CTGGGGTGGGGCTGGGAGTGTGG 0: 1
1: 2
2: 65
3: 493
4: 2699
1049777558_1049777578 22 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777578 8:144413679-144413701 GGGAGTGTGGGCGTGGGAAGGGG 0: 1
1: 0
2: 7
3: 94
4: 1081
1049777558_1049777575 16 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777575 8:144413673-144413695 GGGGCTGGGAGTGTGGGCGTGGG 0: 1
1: 0
2: 20
3: 85
4: 1038
1049777558_1049777576 20 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777576 8:144413677-144413699 CTGGGAGTGTGGGCGTGGGAAGG 0: 1
1: 0
2: 9
3: 67
4: 748
1049777558_1049777565 -5 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777565 8:144413652-144413674 GCGGAGCCGCAGGCCTGGGGTGG 0: 1
1: 0
2: 2
3: 61
4: 474
1049777558_1049777579 26 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777579 8:144413683-144413705 GTGTGGGCGTGGGAAGGGGTCGG 0: 1
1: 0
2: 6
3: 112
4: 1204
1049777558_1049777580 29 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777580 8:144413686-144413708 TGGGCGTGGGAAGGGGTCGGTGG 0: 1
1: 0
2: 2
3: 50
4: 634
1049777558_1049777581 30 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777581 8:144413687-144413709 GGGCGTGGGAAGGGGTCGGTGGG 0: 1
1: 0
2: 3
3: 31
4: 401
1049777558_1049777566 -4 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777566 8:144413653-144413675 CGGAGCCGCAGGCCTGGGGTGGG 0: 1
1: 0
2: 0
3: 40
4: 377
1049777558_1049777577 21 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777577 8:144413678-144413700 TGGGAGTGTGGGCGTGGGAAGGG 0: 1
1: 0
2: 4
3: 86
4: 769
1049777558_1049777563 -9 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777563 8:144413648-144413670 GGAGGCGGAGCCGCAGGCCTGGG 0: 1
1: 0
2: 8
3: 53
4: 511
1049777558_1049777562 -10 Left 1049777558 8:144413634-144413656 CCCAGATCACCGCGGGAGGCGGA 0: 1
1: 0
2: 0
3: 7
4: 48
Right 1049777562 8:144413647-144413669 GGGAGGCGGAGCCGCAGGCCTGG 0: 1
1: 0
2: 8
3: 76
4: 714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049777558 Original CRISPR TCCGCCTCCCGCGGTGATCT GGG (reversed) Intronic
906047885 1:42846675-42846697 TCCGCCTCCCCCCGCGACCTCGG - Intronic
915600553 1:156920619-156920641 CCCGCCTCGCGCGGTTGTCTTGG + Intergenic
1069844265 10:71359748-71359770 TCTGCCTCCCTGTGTGATCTTGG - Intronic
1070635569 10:78124276-78124298 TCCCCCTCCCACCTTGATCTTGG - Intergenic
1076136226 10:128047020-128047042 TCAGCCTCCCGCGCTGTCCTAGG + Intronic
1076664273 10:132077217-132077239 TCCCCCTCTCCCGGTGACCTGGG + Intergenic
1077043815 11:535706-535728 TCCGCCTCCCGCGTTGCTCCCGG - Intronic
1083165148 11:60880173-60880195 TCCTCCTCCTGCTGTGATCAAGG - Intergenic
1083289157 11:61680320-61680342 TCCGCCGCCAGCGGTGACCATGG - Intergenic
1083389487 11:62337553-62337575 TCCGCGTCCTGCGGTGCCCTGGG + Exonic
1089623100 11:119733979-119734001 TCCTCCTCCCACTTTGATCTGGG - Intergenic
1089635770 11:119810633-119810655 TCAGCCTATCGTGGTGATCTGGG + Intergenic
1094623541 12:32102322-32102344 TCAGCCTCCCACAGTGCTCTGGG + Intergenic
1101381303 12:104216052-104216074 TCCGTCTCCCGGGGTGACCTGGG - Intronic
1109475132 13:62871026-62871048 TCCTCCTGCCTCGGTGCTCTGGG - Intergenic
1111687353 13:91517772-91517794 TTCGCCTCCTGCCATGATCTGGG - Intronic
1113201008 13:107867380-107867402 GCCGCCTCCCGCGGAGCTCCGGG + Intergenic
1117424657 14:55580938-55580960 ACCGCCTCCCGCCCTGACCTGGG - Intronic
1119668191 14:76499383-76499405 TCCTCCCCCCGGGGTGCTCTTGG - Intronic
1124501028 15:30226029-30226051 CGCGCGTCCCGCGGTGACCTTGG + Intergenic
1124742541 15:32312638-32312660 CGCGCGTCCCGCGGTGACCTTGG - Intergenic
1127319153 15:57826027-57826049 TCAGCCTCCCAAGGTGACCTGGG - Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1143953675 17:10653004-10653026 TCCTCCTCTCGCTGTGAGCTGGG - Intronic
1144212762 17:13029252-13029274 TCCGCCTGCCATGGTGAACTTGG + Intergenic
1145969935 17:28950783-28950805 TCCCCCTCCCTCGGCCATCTAGG + Intronic
1160858409 19:1227523-1227545 TCCGCCTCCCGCGGGCCCCTGGG - Intronic
1161210432 19:3062628-3062650 CCCGCCCGCCGCGGTGACCTTGG + Intronic
1161215023 19:3090295-3090317 TCCACCTCCTGGTGTGATCTCGG + Intergenic
1162043454 19:7984100-7984122 TGCGACTCCCTCGGTGATGTTGG - Intronic
1163415401 19:17183433-17183455 TCGGCATCCTGCTGTGATCTGGG + Intronic
1163510504 19:17732527-17732549 CCAGCATCCCGCAGTGATCTTGG + Intronic
1167253986 19:48416143-48416165 TCGGCCTTCCTCGGTAATCTGGG + Exonic
926116520 2:10217182-10217204 TCCACCTCTCGCGGTGCTCCTGG - Intergenic
927053963 2:19353485-19353507 GCTGCCTCCAGCGGTGATCTCGG + Exonic
929599135 2:43194185-43194207 TCTCCCTCCCACGGTGACCTTGG - Intergenic
944809290 2:203312192-203312214 TCAGCCTCCGGTGGGGATCTGGG - Intergenic
1173401863 20:42733239-42733261 CCATCCTCCCGCTGTGATCTTGG - Intronic
1179886192 21:44315180-44315202 TCCGGCTCCAGTGGTGACCTTGG + Intronic
1185344890 22:50306859-50306881 CCCGCCTCCCCCTGTCATCTGGG - Intronic
953709540 3:45258562-45258584 TTCTCCTCCAGCGGTGACCTTGG + Intergenic
954624880 3:52016895-52016917 TCCCCCTCCCTGGGTGCTCTGGG + Intergenic
973662763 4:53125001-53125023 TCCTTCTCCCGGGGTGATCTTGG - Intronic
985806945 5:2052858-2052880 TCCGCCTCCTCCGGTCCTCTGGG + Intergenic
989584109 5:43061220-43061242 TCAGCCTCCAGCTCTGATCTGGG - Intergenic
992269999 5:75053799-75053821 TCAGGCGCGCGCGGTGATCTCGG + Intergenic
1001725224 5:173890675-173890697 TCAGCCCTCTGCGGTGATCTCGG - Exonic
1007658794 6:43469446-43469468 TCCACCTCCCGTGGTGAGGTAGG - Intergenic
1016597205 6:145815335-145815357 TCCGCCGCCCGCCGGGATCCAGG - Intergenic
1019734566 7:2644441-2644463 TCCGCCTCCCTGTGTGATCTTGG + Intronic
1022955263 7:35374660-35374682 GCCAGCTCCCGCTGTGATCTTGG + Intergenic
1040065321 8:43140364-43140386 TCCGCCTCCCGCGGTGACTCAGG + Intergenic
1049777558 8:144413634-144413656 TCCGCCTCCCGCGGTGATCTGGG - Intronic
1062493700 9:136821785-136821807 TCCCTCTCCCGCGGAGAACTTGG - Intronic
1193919748 X:87410470-87410492 TTCGCCTCCCGCTGTGATTTTGG - Intergenic
1200248052 X:154536240-154536262 TCCTCCACCCTTGGTGATCTGGG + Intronic