ID: 1049780951

View in Genome Browser
Species Human (GRCh38)
Location 8:144428645-144428667
Sequence CCCGAAGTCCGGGCGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049780951_1049780961 6 Left 1049780951 8:144428645-144428667 CCCGCGCCCGCCCGGACTTCGGG 0: 1
1: 0
2: 2
3: 10
4: 168
Right 1049780961 8:144428674-144428696 CCTCCAGCCGCGCAGCCCCCGGG 0: 1
1: 1
2: 9
3: 41
4: 404
1049780951_1049780964 16 Left 1049780951 8:144428645-144428667 CCCGCGCCCGCCCGGACTTCGGG 0: 1
1: 0
2: 2
3: 10
4: 168
Right 1049780964 8:144428684-144428706 CGCAGCCCCCGGGACGTAACCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1049780951_1049780959 5 Left 1049780951 8:144428645-144428667 CCCGCGCCCGCCCGGACTTCGGG 0: 1
1: 0
2: 2
3: 10
4: 168
Right 1049780959 8:144428673-144428695 CCCTCCAGCCGCGCAGCCCCCGG 0: 1
1: 0
2: 4
3: 60
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049780951 Original CRISPR CCCGAAGTCCGGGCGGGCGC GGG (reversed) Intergenic
900580329 1:3405556-3405578 CCCGCAGTCGGGGCAGGCGTGGG - Exonic
902585781 1:17438099-17438121 CCCGGCGGCCGGGCCGGCGCAGG - Intronic
903652459 1:24930216-24930238 CGCGGAGTCGGGGCGGCCGCGGG - Intronic
903919244 1:26787899-26787921 CTCCAAGTCCGGGCAGGAGCGGG + Intronic
905803681 1:40861544-40861566 CCGGCACGCCGGGCGGGCGCCGG + Exonic
910448896 1:87328118-87328140 CCCGAGGGGCGAGCGGGCGCGGG + Intergenic
918048214 1:180953962-180953984 CCTGAGGGCGGGGCGGGCGCGGG - Intergenic
919712037 1:200738757-200738779 CCCGAATCCCGGGCGCGGGCGGG + Intergenic
920805682 1:209231756-209231778 CGCGGGGTCCGGGAGGGCGCAGG - Intergenic
922757210 1:228103073-228103095 CCGGGATCCCGGGCGGGCGCTGG - Intronic
1062873869 10:930924-930946 CCCCCAGGCCGGGCGGGCGCCGG - Intronic
1067147331 10:43703064-43703086 CCAGGAGTCCGGGCGTGCGTGGG - Intergenic
1069709293 10:70478709-70478731 CTCGCGGTCCGGGCGGGGGCGGG + Intergenic
1070789474 10:79180838-79180860 CCCGAAGACCGGGCTTGAGCTGG - Intronic
1071309385 10:84328586-84328608 GGCGGAGTCCGGGCGGGCGCCGG + Exonic
1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG + Intronic
1076824512 10:132960348-132960370 CTCGAATTCCTGGCGGGAGCCGG - Intergenic
1077886350 11:6390634-6390656 CCCCAGGTCCGGCCGGGAGCAGG + Exonic
1080458924 11:32437114-32437136 CCCGAAGTGTGTGCGGGCCCAGG + Intergenic
1084086305 11:66856905-66856927 CCCGAGGCCCGGGCCGGCGCGGG - Intronic
1091473591 12:752269-752291 CCCGAAGTCCGCGCGAGCTTAGG - Intergenic
1092045932 12:5431948-5431970 CCCGAAGTGAGGGCGGGGGGGGG + Intergenic
1095098891 12:38161858-38161880 CCCGAAGTCTGGGCAGGGGATGG - Intergenic
1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG + Exonic
1096522223 12:52190960-52190982 CCCGCAGTCAGGAGGGGCGCAGG + Intronic
1097264483 12:57737762-57737784 CCCGAAGGCCGGGCGGGCGGCGG - Exonic
1102904001 12:116660774-116660796 CGCGAGTTCCGGGTGGGCGCGGG + Intergenic
1103261604 12:119593681-119593703 CCCTGAGCCCGGGCGGGTGCTGG + Exonic
1103568721 12:121830321-121830343 CCTGAAATGGGGGCGGGCGCGGG - Exonic
1103852227 12:123940768-123940790 CCAGAAGTCTGGGCGGGCCCAGG - Intronic
1113820646 13:113209855-113209877 CCCGAGATCCGTGCGGGCCCCGG + Intronic
1115120060 14:29927860-29927882 CCCGAGCGCCGGGCGGGGGCCGG + Intronic
1115284228 14:31700594-31700616 CGCGAGTTCCGGGTGGGCGCAGG + Intronic
1115651169 14:35403984-35404006 CCCGCGGCCCCGGCGGGCGCCGG + Intronic
1119753517 14:77098081-77098103 CCGGAAGACCAGGCCGGCGCGGG - Exonic
1121050373 14:90816090-90816112 CCCGAGGCGCGGCCGGGCGCGGG - Intronic
1122645126 14:103189131-103189153 CCCCAGGCCTGGGCGGGCGCAGG + Intergenic
1122975313 14:105168493-105168515 CTCGGAGGGCGGGCGGGCGCTGG - Exonic
1123630740 15:22258196-22258218 GCCGCGGGCCGGGCGGGCGCCGG - Intergenic
1126848823 15:52785488-52785510 CCCGAGGTTCGGGCGGGGGTGGG - Intronic
1128594115 15:68929198-68929220 CCCGAGTTCCGGGTGGGCGTGGG - Intronic
1129158287 15:73732458-73732480 CGCGAGTTCCGGGCGGGCGTGGG - Intergenic
1129273863 15:74433199-74433221 CCCGAGCTCCGGGCCGGGGCGGG + Intronic
1132097685 15:99000098-99000120 CGCGAATTCCGGGTGGGCGTGGG + Intronic
1132163625 15:99565298-99565320 CCCGGACTCCGGGCGGCAGCCGG + Intergenic
1134163890 16:11915327-11915349 GAGGAAGTCCGGCCGGGCGCCGG - Intronic
1136141638 16:28292538-28292560 AGCGCAGCCCGGGCGGGCGCCGG + Exonic
1136500784 16:30668894-30668916 CCTGGAGTCCGGGCGGCCTCAGG - Exonic
1140664048 16:77212620-77212642 CCCGAGGTCGGGGCCGGCGAGGG + Exonic
1141972305 16:87492377-87492399 GCCGCGGGCCGGGCGGGCGCCGG + Intergenic
1143183510 17:4997954-4997976 CGCGCTGCCCGGGCGGGCGCCGG + Exonic
1143283337 17:5771293-5771315 CGCGAATTCCGGGTGGGCGTGGG + Intergenic
1143519209 17:7436139-7436161 CCCAAAGCCGGGGCGGGGGCGGG - Intronic
1145935202 17:28711190-28711212 CCCGGCGTCCGGGTGGGCGCTGG + Intronic
1146888275 17:36486849-36486871 CCGGGAGGCCGGGCGGGAGCGGG + Intronic
1148122752 17:45222264-45222286 CCCGGAGGCGGGTCGGGCGCGGG + Intronic
1148157202 17:45431219-45431241 CCCGAAGCCCGGGCGGGAGCGGG - Intronic
1148591062 17:48817099-48817121 CCCAAAGTTAGGGCGAGCGCGGG - Exonic
1149454970 17:56780421-56780443 CCCGGAGCGAGGGCGGGCGCGGG - Intergenic
1149997469 17:61412496-61412518 CCCGAGGCCTGGGCGGGCTCTGG - Exonic
1151314307 17:73312212-73312234 CCCGGAAGCCGGGCGGGCCCAGG - Intergenic
1152362557 17:79839397-79839419 CCGGGAGCCGGGGCGGGCGCGGG - Exonic
1153006274 18:500804-500826 GCCGAGGGCGGGGCGGGCGCGGG - Intergenic
1156243069 18:35271958-35271980 CGCGAGTTCCGGGTGGGCGCGGG - Intronic
1160554805 18:79718103-79718125 CCCGAAGTGAGGGCGGGTGGAGG + Intronic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160927879 19:1555782-1555804 GCCGGAGTCCAGGGGGGCGCAGG + Exonic
1160966659 19:1749701-1749723 AACGGAGCCCGGGCGGGCGCGGG + Intergenic
1161241126 19:3224605-3224627 CCCGATGCCGGGGCGGGCGCGGG + Intergenic
1161313821 19:3608772-3608794 CCCGAAGTGCTGGCGGGGGGTGG - Intergenic
1167636544 19:50659138-50659160 CCTGACGCCCGGGCGGGCCCCGG + Exonic
1168247292 19:55118850-55118872 CAGGAGGTCCGGGTGGGCGCAGG - Intergenic
924962516 2:46731-46753 CGCGAGGTGAGGGCGGGCGCTGG - Intronic
927125934 2:20012521-20012543 CCGGAAGCCCGGGCGGGCCACGG + Exonic
932316934 2:70790690-70790712 CACGAGGCCCGGGCGGGGGCGGG + Intergenic
932399019 2:71466793-71466815 CGCGCAGTCAGGGCGGGAGCGGG - Exonic
932611420 2:73202881-73202903 CCAGAAGGCCGGGTGGACGCAGG - Exonic
932771525 2:74503216-74503238 CCCGGGGTCCGGGTGGGCGTGGG + Intronic
932776192 2:74529740-74529762 CCCGAAGTCCTGAGGCGCGCCGG + Exonic
933666826 2:84971174-84971196 ACCGGAGTCACGGCGGGCGCCGG + Exonic
933698598 2:85238277-85238299 CCCGAAGTCAGGGCAGGCAGCGG + Intronic
935046907 2:99490427-99490449 CCCCAAGGCGGGGCAGGCGCGGG - Intergenic
936104780 2:109614638-109614660 CTTGAAGTGCGCGCGGGCGCGGG - Exonic
937221738 2:120346056-120346078 GCGGAGGCCCGGGCGGGCGCGGG + Intergenic
942292578 2:174487086-174487108 CCTGAAGGCGGGGCGGGGGCGGG - Intronic
946622460 2:221573617-221573639 CCCGGCGGCCGGGCGGCCGCTGG + Intronic
946702110 2:222424491-222424513 CCCGCACTCCGGGCGGAGGCCGG - Intergenic
948118079 2:235508619-235508641 CCCGAAGTCCGGGAGGAGGGAGG + Intronic
948140645 2:235670040-235670062 CCCGCGGGCCGGGAGGGCGCCGG - Intronic
948989058 2:241542531-241542553 GCCCAAGTCCAGGCGGGCACAGG - Intergenic
1169074601 20:2752894-2752916 CCCCAAGTCCGGGCGCGAGATGG - Intronic
1173810436 20:45952136-45952158 CCCGAGGTCCGGGTAGGTGCTGG - Exonic
1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG + Exonic
1175504132 20:59470036-59470058 CCAGGAGTCCAGGTGGGCGCAGG + Intergenic
1176131633 20:63498929-63498951 GCCGGACTCCGGGCGCGCGCGGG + Intronic
1176868608 21:14070574-14070596 CCCGAAGTCTGGGCAGGGGATGG + Intergenic
1177669673 21:24208982-24209004 CGCGAGTTCCGGGTGGGCGCGGG - Intergenic
1178992277 21:37366390-37366412 GCCGCAGTCGGCGCGGGCGCGGG + Intronic
1180109826 21:45642738-45642760 CGCGAACGCCGGGCGGGCGGAGG + Intergenic
1180649846 22:17369214-17369236 CCCAAAGTCCTGGAGGGCGGAGG + Intronic
1182304688 22:29359688-29359710 CCTGCAGGCTGGGCGGGCGCGGG + Intronic
1183411760 22:37659073-37659095 CCGGAGGCCCGGGCAGGCGCTGG - Exonic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
953909205 3:46883292-46883314 GCCGGAGGCCGGGCGGGCGGCGG - Intronic
954838803 3:53494211-53494233 CGCGGAGTCGGGGCCGGCGCGGG + Intergenic
958779409 3:98522966-98522988 CCCGGAGTGGGGGCGGGCGGAGG - Intronic
962770835 3:138608972-138608994 CGAGGCGTCCGGGCGGGCGCAGG - Intronic
964376239 3:156051827-156051849 CACGAGTTCCGGGTGGGCGCAGG + Intronic
964570792 3:158105843-158105865 CCGGCAGTCCGGGCGGCCGGCGG - Exonic
968865254 4:3206102-3206124 CCCGAAGCCCGGGAGAGGGCAGG + Intronic
968913266 4:3486287-3486309 CCCCAGGTCGGGGCGGGTGCTGG + Intronic
969053487 4:4387854-4387876 CGCGAAGTGGGGGCGGGCTCGGG + Intronic
971030753 4:22634805-22634827 CGCAAATTCCGGGTGGGCGCGGG + Intergenic
975373929 4:73620451-73620473 TCCGAGGCCCGCGCGGGCGCAGG + Exonic
987696578 5:21341446-21341468 CGCGACTTCCGGGTGGGCGCGGG + Intergenic
988755625 5:34245124-34245146 CGCGACTTCCGGGTGGGCGCGGG - Intergenic
991743869 5:69710867-69710889 CGCGACTTCCGGGTGGGCGCGGG - Intergenic
991743876 5:69710895-69710917 CGCGACTTCCGGGTGGGCGCGGG - Intergenic
991753836 5:69844347-69844369 CGCGACTTCCGGGTGGGCGCGGG + Intergenic
991753844 5:69844375-69844397 CGCGACTTCCGGGTGGGCGCGGG + Intergenic
991795441 5:70290599-70290621 CGCGACTTCCGGGTGGGCGCGGG - Intergenic
991795448 5:70290627-70290649 CGCGACTTCCGGGTGGGCGCGGG - Intergenic
991803453 5:70401074-70401096 CGCGACTTCCGGGTGGGCGCGGG + Intergenic
991803461 5:70401102-70401124 CGCGACTTCCGGGTGGGCGCGGG + Intergenic
991823236 5:70586135-70586157 CGCGACTTCCGGGTGGGCGCGGG - Intergenic
991823244 5:70586163-70586185 CGCGACTTCCGGGTGGGCGCGGG - Intergenic
991833149 5:70719460-70719482 CGCGACTTCCGGGTGGGCGCGGG + Intergenic
991833156 5:70719488-70719510 CGCGACTTCCGGGTGGGCGCGGG + Intergenic
991887808 5:71290118-71290140 CGCGACTTCCGGGTGGGCGCGGG - Intergenic
991887815 5:71290146-71290168 CGCGACTTCCGGGTGGGCGCGGG - Intergenic
998341707 5:141423235-141423257 CCCGAAGTCCTGGCGGACCTCGG + Exonic
1002415959 5:179121179-179121201 CGCGAAGGCCGGGCGGAAGCGGG + Intronic
1003111249 6:3253621-3253643 CGCGAGTTCCGGGTGGGCGCGGG + Intronic
1003176850 6:3758214-3758236 CGCGAGTTCCGGGCGGGCGTAGG + Intergenic
1004241365 6:13925100-13925122 CCCGCAGTCCTGGACGGCGCCGG + Intronic
1005554263 6:26956899-26956921 CGCGACTTCCGGGTGGGCGCGGG - Intergenic
1006351124 6:33521809-33521831 CTCGAGTTCCGGGTGGGCGCGGG - Intergenic
1006606298 6:35259881-35259903 GCGGGAGGCCGGGCGGGCGCAGG + Intronic
1007557785 6:42781896-42781918 CATGAAGGCCGGGCGGGCGCGGG + Intronic
1007830003 6:44630628-44630650 CCCCAAGCTCGGGCGGGGGCCGG + Intergenic
1013106157 6:107028223-107028245 CCTGCAGTCCGCGCGGCCGCGGG + Exonic
1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG + Intergenic
1019554099 7:1620011-1620033 CCTGAGGCCCGGGCGGGGGCGGG - Intergenic
1029110542 7:98211346-98211368 CCGGGTGTCCCGGCGGGCGCTGG - Intergenic
1029363222 7:100101580-100101602 CCCGCGGTCCGAGCTGGCGCGGG + Exonic
1034262560 7:149765920-149765942 GCCGCAGTCCGGGCAGGCGCAGG + Exonic
1036910950 8:12755927-12755949 CCCCAACTCCTGGCGGGCGGGGG + Intronic
1041604368 8:59762265-59762287 CACGAATTCCGGGTGGGCGTGGG - Intergenic
1044873810 8:96645200-96645222 CGGGAAGCCGGGGCGGGCGCCGG - Intergenic
1044963894 8:97556964-97556986 CGCGAGTTCCGGGTGGGCGCGGG + Intergenic
1047739395 8:127794570-127794592 CCCGCGGGCCGGGCGGGCTCGGG + Intergenic
1049197844 8:141325336-141325358 GCCGAAGGCCGGTCGGGCTCAGG - Intergenic
1049424922 8:142533697-142533719 CCCCAAGCCAGTGCGGGCGCAGG - Intronic
1049552506 8:143267130-143267152 CCCGAAGCCCGGCCCCGCGCTGG + Intronic
1049570432 8:143367859-143367881 CACGAAATCCGAGCGGGCTCCGG + Intergenic
1049643632 8:143726604-143726626 CCCGAAGGCCGGGCCCGCGGAGG - Exonic
1049714282 8:144082620-144082642 CCGGAAGTGCGGGCGAGCGCGGG + Exonic
1049780951 8:144428645-144428667 CCCGAAGTCCGGGCGGGCGCGGG - Intergenic
1057146972 9:92764947-92764969 GCCGGGGGCCGGGCGGGCGCCGG - Intergenic
1060200929 9:121651539-121651561 CCCGGAGGCCGGGCTGGCACCGG - Intronic
1061823083 9:133239290-133239312 CCCGGGGTAAGGGCGGGCGCTGG - Intergenic
1061851254 9:133417304-133417326 CCCGAAACCAGGCCGGGCGCGGG - Intronic
1061975790 9:134067583-134067605 CGCGGAGGCCGGGCTGGCGCGGG + Intronic
1185475549 X:413443-413465 TGCGGAGTCCGGGTGGGCGCCGG + Intergenic
1185508311 X:644650-644672 CCGGGAGTCCGGGCGCGCGGGGG - Exonic
1189354225 X:40299088-40299110 CCCACAGCCCGGGCGGGGGCGGG + Intergenic
1196951732 X:120931489-120931511 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196952416 X:120936350-120936372 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196953101 X:120941211-120941233 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196953786 X:120946071-120946093 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196954471 X:120950932-120950954 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196955154 X:120955792-120955814 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196955841 X:120960675-120960697 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196956523 X:120965536-120965558 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196957205 X:120970396-120970418 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196957887 X:120975256-120975278 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196958569 X:120980116-120980138 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1196959250 X:120984976-120984998 GCCGCAGCCCGGGCGGGCGAGGG - Exonic
1198184071 X:134237127-134237149 CCCGGACTCCGGACGCGCGCAGG - Exonic
1200159665 X:153999793-153999815 CCCGAAGTCCGAGCCGGCGTGGG - Intergenic
1200277797 X:154750918-154750940 CGCGAAGGCCGGGCGGGTGGCGG + Intronic