ID: 1049780951

View in Genome Browser
Species Human (GRCh38)
Location 8:144428645-144428667
Sequence CCCGAAGTCCGGGCGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 168}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049780951_1049780964 16 Left 1049780951 8:144428645-144428667 CCCGCGCCCGCCCGGACTTCGGG 0: 1
1: 0
2: 2
3: 10
4: 168
Right 1049780964 8:144428684-144428706 CGCAGCCCCCGGGACGTAACCGG 0: 1
1: 0
2: 0
3: 4
4: 46
1049780951_1049780959 5 Left 1049780951 8:144428645-144428667 CCCGCGCCCGCCCGGACTTCGGG 0: 1
1: 0
2: 2
3: 10
4: 168
Right 1049780959 8:144428673-144428695 CCCTCCAGCCGCGCAGCCCCCGG 0: 1
1: 0
2: 4
3: 60
4: 451
1049780951_1049780961 6 Left 1049780951 8:144428645-144428667 CCCGCGCCCGCCCGGACTTCGGG 0: 1
1: 0
2: 2
3: 10
4: 168
Right 1049780961 8:144428674-144428696 CCTCCAGCCGCGCAGCCCCCGGG 0: 1
1: 1
2: 9
3: 41
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049780951 Original CRISPR CCCGAAGTCCGGGCGGGCGC GGG (reversed) Intergenic