ID: 1049781808

View in Genome Browser
Species Human (GRCh38)
Location 8:144432534-144432556
Sequence TTTCCCCAAAGGGGTCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049781808_1049781817 4 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781817 8:144432561-144432583 TACCGCAGTGCTCGCAGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 41
1049781808_1049781818 5 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781818 8:144432562-144432584 ACCGCAGTGCTCGCAGGGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1049781808_1049781821 20 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781821 8:144432577-144432599 GGGTGGGGTGGCAAGTGCAGAGG 0: 1
1: 2
2: 4
3: 76
4: 739
1049781808_1049781822 26 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781822 8:144432583-144432605 GGTGGCAAGTGCAGAGGCAAAGG 0: 1
1: 0
2: 2
3: 40
4: 489
1049781808_1049781815 0 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781815 8:144432557-144432579 CCACTACCGCAGTGCTCGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1049781808_1049781820 8 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781820 8:144432565-144432587 GCAGTGCTCGCAGGGTGGGGTGG 0: 1
1: 0
2: 2
3: 35
4: 383
1049781808_1049781813 -1 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781813 8:144432556-144432578 ACCACTACCGCAGTGCTCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1049781808_1049781816 3 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781816 8:144432560-144432582 CTACCGCAGTGCTCGCAGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049781808 Original CRISPR TTTCCCCAAAGGGGTCCTGA GGG (reversed) Intronic