ID: 1049781808

View in Genome Browser
Species Human (GRCh38)
Location 8:144432534-144432556
Sequence TTTCCCCAAAGGGGTCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049781808_1049781813 -1 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781813 8:144432556-144432578 ACCACTACCGCAGTGCTCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 31
1049781808_1049781818 5 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781818 8:144432562-144432584 ACCGCAGTGCTCGCAGGGTGGGG 0: 1
1: 0
2: 0
3: 6
4: 78
1049781808_1049781817 4 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781817 8:144432561-144432583 TACCGCAGTGCTCGCAGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 41
1049781808_1049781821 20 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781821 8:144432577-144432599 GGGTGGGGTGGCAAGTGCAGAGG 0: 1
1: 2
2: 4
3: 76
4: 739
1049781808_1049781816 3 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781816 8:144432560-144432582 CTACCGCAGTGCTCGCAGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 52
1049781808_1049781822 26 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781822 8:144432583-144432605 GGTGGCAAGTGCAGAGGCAAAGG 0: 1
1: 0
2: 2
3: 40
4: 489
1049781808_1049781820 8 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781820 8:144432565-144432587 GCAGTGCTCGCAGGGTGGGGTGG 0: 1
1: 0
2: 2
3: 35
4: 383
1049781808_1049781815 0 Left 1049781808 8:144432534-144432556 CCCTCAGGACCCCTTTGGGGAAA 0: 1
1: 0
2: 0
3: 4
4: 160
Right 1049781815 8:144432557-144432579 CCACTACCGCAGTGCTCGCAGGG 0: 1
1: 0
2: 1
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049781808 Original CRISPR TTTCCCCAAAGGGGTCCTGA GGG (reversed) Intronic
900462784 1:2809457-2809479 CTTCCCCATAGGAGACCTGAGGG - Intergenic
901770737 1:11529273-11529295 TCTCCCCATAGGAGTCATGAAGG - Intronic
902557176 1:17253869-17253891 TTTCCCCATATGGACCCTGAAGG + Intronic
903383815 1:22914095-22914117 TTTTCCCAGAGGGGTTCTCAGGG - Exonic
906817118 1:48890517-48890539 TTTCCCCTAGGGGTTTCTGAAGG + Intronic
907596443 1:55724699-55724721 TTGCCCCAAATGGGCTCTGATGG + Intergenic
908868342 1:68577669-68577691 TTTCCCCCAAGGGATCCTATGGG - Intergenic
911726753 1:101249528-101249550 TTTCCTTAAAGGGGTACTGTAGG + Intergenic
912487942 1:110043821-110043843 TTGCCCCAAAGGGCTCCCGTGGG + Exonic
912932112 1:113973277-113973299 TCTCCCCACAGGGTTCCTCAAGG + Exonic
914829390 1:151159592-151159614 TATCCCCAAAGGGGTTCTCTGGG - Exonic
915518281 1:156426522-156426544 CTTCTCCAATGGGCTCCTGAGGG - Intronic
918013053 1:180605335-180605357 TTTGCCCAAAGTGGGCCTCAAGG - Intergenic
921257974 1:213359724-213359746 TTGCCCTAAAGAGCTCCTGAAGG - Intergenic
1067271454 10:44795062-44795084 TTTCCCAAAATGCGTTCTGAAGG + Intergenic
1068607732 10:59024603-59024625 TTTCCCTAAATGGCTCCTGCTGG + Intergenic
1074119235 10:110481115-110481137 TTTCACCAAATGTTTCCTGAAGG - Intergenic
1074228226 10:111508285-111508307 TTTCCCCAAATGGAGACTGAGGG - Intergenic
1076101273 10:127780844-127780866 TTTTCCCAAAGTCATCCTGATGG - Intergenic
1077192625 11:1261783-1261805 CCTCCCGAAAGGGGTCCTGCTGG - Exonic
1079341339 11:19614032-19614054 TTTCATGAAAGGGGCCCTGAAGG - Intronic
1080199029 11:29647001-29647023 TTTCCCAAAATGGGTTCTGTGGG - Intergenic
1084012723 11:66361669-66361691 TTTCCCCAGCTGGGCCCTGAGGG - Intronic
1084322717 11:68382537-68382559 TGACCCCAAGGGCGTCCTGAGGG + Intronic
1084399439 11:68935158-68935180 TTTCCCCATGGGGCTCCTGCAGG + Intronic
1084653056 11:70500207-70500229 CCACCACAAAGGGGTCCTGAGGG + Intronic
1084668860 11:70593434-70593456 TTACACCAAAGTGGTCCTGGAGG + Intronic
1084708948 11:70832049-70832071 TGTCCCCAAAGGTGTCCCCACGG - Intronic
1085042816 11:73336580-73336602 TTGCCCCAGAGGGGTCCAGCTGG - Intronic
1085282503 11:75340431-75340453 TTTCCCCAGAGGGGCCTTGGAGG - Intronic
1089255070 11:117189867-117189889 TTTTGCCAAAGGGGCCCGGATGG + Intronic
1089625971 11:119751352-119751374 TTTCTCCAAAGGGCTCTTCATGG - Intergenic
1089676969 11:120096778-120096800 TTTCCAGAAAGAGGACCTGAAGG + Intergenic
1091274935 11:134343681-134343703 TTCCCCGAAAGGACTCCTGAAGG + Intronic
1092159299 12:6307237-6307259 CTTCCCTAAAGGCCTCCTGAGGG - Intergenic
1095708448 12:45262918-45262940 TTTCCTCCAACAGGTCCTGAAGG - Intronic
1095905242 12:47370442-47370464 TTGCAGCAAAAGGGTCCTGATGG + Intergenic
1096788673 12:54031961-54031983 TTTCCCCAAAGGGCACATAACGG + Intronic
1097154267 12:57001476-57001498 TTTGCCCAAAGAAGTCTTGAGGG - Exonic
1097175778 12:57142143-57142165 TTTCCCCCAAAGGGCCCTGTGGG + Intronic
1099827239 12:87792391-87792413 TTTCTCCAAAGGGATTCTGTGGG - Intergenic
1100796297 12:98185278-98185300 TCTCCCCAAAGGGCTCTTCAGGG - Intergenic
1100869108 12:98892805-98892827 TTTCCCTAATGGGGGCCAGAAGG - Intronic
1102646799 12:114409014-114409036 TCTCCGCCAAGGGGTCCCGAGGG + Intergenic
1103261464 12:119593034-119593056 TTTCTCCCCAGGGGTCCTGCAGG + Intergenic
1103520066 12:121532354-121532376 TTTCCCCAGGGTGGTCATGAGGG - Intronic
1104736840 12:131140198-131140220 TTTCCCCAGAGGCTTCCTCATGG + Exonic
1105591874 13:21799871-21799893 TTTCCCTAAAAGGTGCCTGAAGG + Intergenic
1105786197 13:23751766-23751788 TTTAGCCATGGGGGTCCTGATGG - Intronic
1108461163 13:50668768-50668790 TTTCAGCAAAGGAGTTCTGAGGG - Intronic
1111980031 13:95005463-95005485 TTTACCCAGAGAGGACCTGAGGG + Intergenic
1117775184 14:59176779-59176801 TTTCCCATAAGGGGTTCTTATGG - Intergenic
1117870138 14:60192035-60192057 TTTCTCCAAAGCAGTCCTGGAGG + Intergenic
1118776221 14:68975952-68975974 ATTCCCCAGAAGAGTCCTGAGGG + Intronic
1123157448 14:106242224-106242246 TTTACCCAAAGGTGTCCAAAGGG - Intergenic
1202928791 14_KI270725v1_random:20187-20209 TTTCCAAAAAGGAGACCTGAGGG - Intergenic
1124254844 15:28132025-28132047 TTTTCCCAGAGGGGCCCTGGGGG + Intronic
1125875097 15:43137155-43137177 CTTCTCCAAAAGAGTCCTGATGG + Intronic
1127232753 15:57014797-57014819 TTTCCCTACAGTGGTCCTTATGG + Intronic
1132341369 15:101080254-101080276 TTTCCCCTAAGGGCTTCTCAAGG - Intergenic
1134755792 16:16666118-16666140 TTTCTCCAAAGGGGAACGGAGGG - Intergenic
1134793601 16:17013863-17013885 TTTCCCCAGAGGATTCCAGATGG + Intergenic
1134990274 16:18693047-18693069 TTTCTCCAAAGGGGAACGGAGGG + Intergenic
1136399653 16:30010566-30010588 TGTCCCCCAAGGGGCCCTGCAGG + Intronic
1137074233 16:35942357-35942379 TTGCCTCAATGGGCTCCTGAAGG + Intergenic
1141220487 16:82065057-82065079 CTTCCCCACAGGGGTCCACAAGG - Intronic
1141853422 16:86664361-86664383 TTTCCCCAAAGAGGCCGTGGCGG - Intergenic
1142954639 17:3513342-3513364 TTTCCCCGAAGGGTTCCGGAAGG + Exonic
1142990278 17:3725507-3725529 TTTCCTCAAAGGTTTTCTGATGG - Exonic
1147224071 17:38962155-38962177 TTTTCCCAAAGGGATGATGATGG - Intronic
1148605599 17:48926957-48926979 TCTCTCCAAAAGGGTCCTGTGGG - Exonic
1154293240 18:13128938-13128960 TTCCCCAAAAGTGGTCCTGTGGG - Intergenic
1158605900 18:58895778-58895800 TTTCCCTAAAGGTGTCATAAGGG + Intronic
1160337376 18:78054477-78054499 TTTCTCCCCAGGGGTCGTGAGGG - Intergenic
1160462922 18:79052986-79053008 TTCCCCCAAAGGGAACCTAAAGG + Intergenic
1163681432 19:18684519-18684541 TGTCCCCCAGGGGGTCCAGAGGG + Intronic
1164400308 19:27897516-27897538 ATTCCCCATGGTGGTCCTGAAGG - Intergenic
1167879617 19:52445108-52445130 TTGCCTCACAGGGGTCCTGGGGG - Intronic
925697644 2:6597855-6597877 TTTCCCCAAAGGTTTCCTCTTGG - Intergenic
926202991 2:10814501-10814523 TTTCCCTGAAGGGCGCCTGAGGG + Intronic
926344829 2:11935754-11935776 TTTCCCCACTGGGGCCCTCATGG - Intergenic
927945614 2:27133499-27133521 TTTCCCCAAGGGGGTAGAGAGGG + Intronic
929816849 2:45239171-45239193 TTTCCCAAAAGGGGTGTAGAGGG + Intergenic
931925437 2:67067232-67067254 TTTCCCCAAAGTGATGCTGCTGG + Intergenic
932762010 2:74444088-74444110 TTTCCCCAGAGGGGGCAAGAAGG - Intergenic
932901795 2:75710373-75710395 TTTCCCCCAAGGAGTCCAAAAGG + Intronic
938365315 2:130729063-130729085 CTGCCCCACAGGGGTCCTGATGG - Exonic
939530473 2:143353910-143353932 TTGCCCCAAAGTTGTCATGATGG + Intronic
939648703 2:144735253-144735275 TTTCTCCAAATGCTTCCTGATGG - Intergenic
942370138 2:175275270-175275292 TTTCCCCAACTGGGTCCTCTTGG + Intergenic
944211660 2:197212076-197212098 TTCCCCCAAAGTGGTGCTGTGGG - Intronic
1169072025 20:2738607-2738629 TTTCCCCAAACCAGGCCTGAGGG - Intronic
1170481409 20:16768561-16768583 GTTCCCCAAAGGCCTCCTGTGGG + Intronic
1171430506 20:25081018-25081040 TTTCCCCAAAGAAATCCAGACGG - Intronic
1176034599 20:63030035-63030057 CTCCCACAGAGGGGTCCTGAAGG - Intergenic
1176590812 21:8648774-8648796 TTTCCAAAAAGGAGACCTGAGGG - Intergenic
1176896246 21:14382732-14382754 CCTCCACAAAGGGGTCCTGGAGG + Intronic
1180038186 21:45261469-45261491 TTTCCACAAAGGGGTTTTGGAGG - Intergenic
1180273641 22:10625807-10625829 TTTCCAAAAAGGAGACCTGAGGG - Intergenic
1183615365 22:38941806-38941828 TTTGCCCACGGGGGACCTGAGGG - Intergenic
1185136602 22:49077076-49077098 TTTCTCCAGAGGGGTGTTGATGG - Intergenic
1185294084 22:50044890-50044912 TCTCCCCAAAGGGGCCCCGTGGG - Intronic
949136455 3:572905-572927 TTTCCAAAAAGGAGACCTGAGGG + Intergenic
949686263 3:6575132-6575154 TTTCCCCAAATGAGTTCAGAGGG - Intergenic
950395263 3:12729136-12729158 TATGCCCAAAGGGGACTTGAAGG - Intergenic
950395518 3:12731077-12731099 TATGCCCAAAGGGGACTTGAAGG - Intergenic
950441320 3:13012355-13012377 GTTCCCCAAAGGCTTCCTGGAGG - Intronic
950447612 3:13047378-13047400 TTCCCCCAAAGGGCTCTTGGAGG + Intronic
952954892 3:38550782-38550804 CTTCACCAAAAGGGTCCTGGGGG - Exonic
955376441 3:58401252-58401274 TTTCCCCACAGGGCTCTTCAGGG - Intronic
956387245 3:68733054-68733076 TTTCTGCAAAGGGGCCATGATGG + Exonic
958787503 3:98613507-98613529 TTTGCTCACAGGGGTCCTTAGGG - Intergenic
961506779 3:127375331-127375353 TCTCCCCACAGGGTTCCTGCAGG - Intergenic
966621324 3:181967316-181967338 TTTCAGCAAAGGATTCCTGAAGG - Intergenic
971386873 4:26148885-26148907 TCTTCCCACAGTGGTCCTGATGG - Intergenic
974436770 4:61866760-61866782 TTCCCTCAAAGAGGGCCTGAGGG - Intronic
977129721 4:93220386-93220408 TTTCACCAAAGGGTTCCTAAAGG + Intronic
978065081 4:104387582-104387604 TTTCCCCAAATTGATCCAGAGGG - Intergenic
985406989 4:189647636-189647658 CTTCCCTTAAGGGGCCCTGAGGG + Intergenic
985779556 5:1863054-1863076 CTTCCCCAAAGGGAGCCTGCAGG - Intergenic
987084573 5:14456615-14456637 TTCCCCAGAAGAGGTCCTGATGG - Intronic
991001556 5:61788637-61788659 TTTCCCCAAAGAGTGCCTTAGGG + Intergenic
993532818 5:89044922-89044944 TTTCCCCAAAGGGGAGTTCAGGG + Intergenic
995277114 5:110289487-110289509 TTTCTCCTCAGGGGACCTGATGG + Intronic
996004739 5:118406144-118406166 TTACCCCATGGGGCTCCTGAGGG + Intergenic
999393426 5:151211318-151211340 CTAGCCCAAAGGGCTCCTGAAGG + Intronic
999625488 5:153516412-153516434 TTTCCCCCAAAGGGTGCTGTGGG - Intronic
1001158257 5:169291583-169291605 TTTCCCCAAATTGGACATGATGG + Intronic
1004372661 6:15065920-15065942 TTTCTCCAAATGGGCCCAGATGG - Intergenic
1005059563 6:21763036-21763058 TTTCTCAAAAGGGGTACTCAGGG + Intergenic
1006906527 6:37536933-37536955 TTTATCCAAAGCGGTCCTTAAGG + Intergenic
1014709046 6:124785049-124785071 TTCCCCCACTGGAGTCCTGAAGG - Intronic
1020462050 7:8437108-8437130 TTTACCCCAAGGTGTCCTGTGGG - Intronic
1020474617 7:8581126-8581148 TTTCCCCAGAGGGGTTAGGATGG + Intronic
1021835268 7:24666014-24666036 GTTCCACAAAAAGGTCCTGAAGG - Exonic
1022498881 7:30870305-30870327 TAACCTCAAAAGGGTCCTGAGGG - Intronic
1023067559 7:36393509-36393531 TATTTACAAAGGGGTCCTGATGG + Intronic
1023327970 7:39080673-39080695 TTTCCTCAAAGCTGTTCTGATGG + Intronic
1023709958 7:42981594-42981616 TTTCCCCACAGGGGAGGTGAAGG + Intergenic
1024686918 7:51755954-51755976 TTTTCCTAAAGGGATCCTCATGG - Intergenic
1027231272 7:76274111-76274133 TTTGCCCGAAAGGGCCCTGAAGG - Intronic
1032416166 7:131737115-131737137 TTTCCCCTAAGGAGTCCCTAAGG + Intergenic
1032439653 7:131932675-131932697 TGTCCCCCAAGAGGGCCTGAGGG - Intergenic
1034264858 7:149776009-149776031 GTTCCCCAAAGGTGCCCTGGGGG + Intergenic
1036481134 8:9140670-9140692 TTTTCCCAAACGGGGCCTCATGG + Exonic
1036504898 8:9346433-9346455 TTTCCCCAAAAGGCTTCTTATGG + Intergenic
1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG + Intronic
1040699037 8:50038971-50038993 GTTCCCCAAAGGGCTCCTGCAGG - Intronic
1043547843 8:81335321-81335343 TTTCCAGGAAGGAGTCCTGACGG + Intergenic
1049781808 8:144432534-144432556 TTTCCCCAAAGGGGTCCTGAGGG - Intronic
1050179413 9:2904096-2904118 TGTCCCCAAAGAGCTCCTCATGG - Intergenic
1051870818 9:21735689-21735711 TTTCCACAAAGGGGGGCTGGGGG + Intergenic
1052041492 9:23744048-23744070 TTACCACAAAGGGGTCCCTAAGG + Intronic
1052879135 9:33589858-33589880 TTTCCCCAAAGCTGCCCTCATGG - Intergenic
1052990130 9:34514219-34514241 TTTCCCCCAGGGTGTGCTGAGGG + Intronic
1053496841 9:38554361-38554383 TTTCCCCAAAGCTGCCCTCATGG + Intronic
1057553150 9:96066836-96066858 TGTCCCCAAAGGGGGCATGGGGG - Intergenic
1057676751 9:97141919-97141941 TTTCCCCAAAGCTGCCCTCATGG + Intergenic
1059632520 9:116139917-116139939 TTTCCACTAAGTGGTCCTGTGGG - Intergenic
1061431233 9:130532712-130532734 TTTCCCCCAGGGGGTCTTCAAGG - Intergenic
1061853192 9:133428101-133428123 TTTACCCAAAGCGGAACTGATGG - Intronic
1198813205 X:140557822-140557844 TTTTCCCCAAGGGCTCCAGAAGG + Intergenic
1199482379 X:148311714-148311736 TTTCCTCACAGGTGTCATGAAGG - Intergenic
1199698146 X:150358221-150358243 TTTCCCCAAAGCCTCCCTGATGG - Intergenic
1201279540 Y:12329892-12329914 TTTCCTCACAGGGGGCCTAAAGG - Intergenic