ID: 1049784015

View in Genome Browser
Species Human (GRCh38)
Location 8:144441990-144442012
Sequence ACCCCTGCACACACCTCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 328}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049784004_1049784015 8 Left 1049784004 8:144441959-144441981 CCTGGCGGGACTCCACCCCGCCC 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1049784015 8:144441990-144442012 ACCCCTGCACACACCTCCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 328
1049784007_1049784015 -7 Left 1049784007 8:144441974-144441996 CCCCGCCCCCAGGCTCACCCCTG 0: 1
1: 0
2: 3
3: 70
4: 1107
Right 1049784015 8:144441990-144442012 ACCCCTGCACACACCTCCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 328
1049784002_1049784015 19 Left 1049784002 8:144441948-144441970 CCCTGTACACACCTGGCGGGACT 0: 1
1: 0
2: 0
3: 5
4: 198
Right 1049784015 8:144441990-144442012 ACCCCTGCACACACCTCCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 328
1049784009_1049784015 -9 Left 1049784009 8:144441976-144441998 CCGCCCCCAGGCTCACCCCTGCA 0: 1
1: 0
2: 4
3: 108
4: 994
Right 1049784015 8:144441990-144442012 ACCCCTGCACACACCTCCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 328
1049784008_1049784015 -8 Left 1049784008 8:144441975-144441997 CCCGCCCCCAGGCTCACCCCTGC 0: 1
1: 1
2: 10
3: 135
4: 1278
Right 1049784015 8:144441990-144442012 ACCCCTGCACACACCTCCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 328
1049784006_1049784015 -4 Left 1049784006 8:144441971-144441993 CCACCCCGCCCCCAGGCTCACCC 0: 1
1: 0
2: 11
3: 182
4: 1362
Right 1049784015 8:144441990-144442012 ACCCCTGCACACACCTCCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 328
1049784003_1049784015 18 Left 1049784003 8:144441949-144441971 CCTGTACACACCTGGCGGGACTC 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1049784015 8:144441990-144442012 ACCCCTGCACACACCTCCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049784015 Original CRISPR ACCCCTGCACACACCTCCCA GGG Intronic
900659705 1:3776379-3776401 AGCTCTGCACACTGCTCCCACGG - Intergenic
900786327 1:4653000-4653022 AGCCCTGCAAACACCTCCCCGGG + Intergenic
901028856 1:6294416-6294438 AGCCCTGCCCACGCCACCCAGGG - Intronic
901320716 1:8338366-8338388 ACCCCTGCCCCCACCTCCCTGGG - Intronic
901860333 1:12070210-12070232 ACCTCTGCTCACCCCTCCCCTGG - Intronic
901921100 1:12538262-12538284 ACAGCTGCACACACCATCCATGG + Intergenic
902066360 1:13691404-13691426 ACACCTGCCAACACCTGCCAGGG - Intergenic
902204381 1:14856864-14856886 TCCAATTCACACACCTCCCAAGG - Intronic
902368696 1:15992688-15992710 ACTCCTGAACACCCCTCCAAGGG + Intergenic
902756558 1:18552894-18552916 GCCCCTCCACACAACTCCTAAGG + Intergenic
902770190 1:18641313-18641335 ACCCCTTCCCAGACCTCCGACGG - Intronic
903326053 1:22569172-22569194 CCCCCAGCACACAGCTCACACGG - Intronic
903582872 1:24385290-24385312 ACCCCTGTCGTCACCTCCCATGG - Intronic
903883678 1:26529522-26529544 ACCCCTGGACACACCACACCAGG - Intergenic
905363028 1:37433435-37433457 ACACCTGCTCCCACCTGCCAAGG - Intergenic
905521185 1:38601699-38601721 ACCCCTGCCCTCAACCCCCAGGG + Intergenic
907592303 1:55686733-55686755 AACTCTGCCCACACCTCTCAAGG + Intergenic
908918144 1:69157308-69157330 ACACCTGAACACTCCTTCCAGGG - Intergenic
911055543 1:93705420-93705442 AGCCCTGCAAACAACTGCCAAGG + Intronic
911220656 1:95241855-95241877 ACCCCTCCCCACCCCCCCCAGGG + Intronic
912347706 1:108980114-108980136 ACCCCTTCCCACCCCACCCATGG + Intronic
912386339 1:109273005-109273027 GCCCCTGCACAGTACTCCCAAGG + Exonic
912658112 1:111505663-111505685 ACCGCTGCACCCACAGCCCATGG + Intronic
914201483 1:145488815-145488837 ACCACTGCACAGAGCTCCGAAGG - Intergenic
914480605 1:148061942-148061964 ACCACTGCACAGAGCTCCGAAGG - Intergenic
916760084 1:167807793-167807815 ACTCTTGAACACACCTCTCATGG - Intergenic
917286518 1:173426878-173426900 GCCACTGCGCACAGCTCCCATGG + Intergenic
917980829 1:180267922-180267944 AGCCCTGCCCACTCCTGCCATGG - Intronic
920430966 1:205918841-205918863 ACCCCAGGACACAACTTCCAAGG - Exonic
920502669 1:206495267-206495289 AAAGCTGAACACACCTCCCAGGG - Intronic
920679377 1:208060706-208060728 TGCCCTGCACGCCCCTCCCAGGG - Exonic
920683461 1:208090851-208090873 ACCCCTGCCCAGGCCTCCCATGG + Intronic
921708685 1:218352037-218352059 GACCCTGCACACCTCTCCCAGGG - Intronic
922051092 1:221991334-221991356 AGCCCTGCACATACCTTCTAAGG - Intergenic
922780743 1:228250388-228250410 TCCCATGCACACCCCTCCCTTGG - Intronic
922782582 1:228264539-228264561 TCCCATGCACACCCCTCCCTTGG - Intronic
923476046 1:234332287-234332309 ACCCCAGGACACACCACCTAGGG + Intergenic
923596162 1:235362091-235362113 CCACTTTCACACACCTCCCAGGG + Intergenic
924248505 1:242108072-242108094 ACCCCAGCCCACACAGCCCAAGG - Intronic
924269972 1:242322090-242322112 ACACATGCAGACACTTCCCAAGG - Intronic
924536408 1:244939571-244939593 ACCCCTGCACCAACCTCCCTGGG - Intergenic
924929140 1:248712013-248712035 ACACCTGCACATACTGCCCAAGG + Intergenic
1062891007 10:1059919-1059941 ACCACTGCCTCCACCTCCCAGGG + Intronic
1062975126 10:1677443-1677465 AGCCCTGCACACCCCTTCCTGGG - Intronic
1063470798 10:6283307-6283329 CCCCATACGCACACCTCCCAAGG - Intergenic
1066714935 10:38276673-38276695 ACACCTGCAGACACTTCCCAAGG + Intergenic
1067667014 10:48287609-48287631 ACCCCTGTCCCCACCTCCCTGGG - Intergenic
1068192649 10:53672160-53672182 ACTCCTGCATACAACTCCCTTGG - Intergenic
1068657643 10:59591597-59591619 GCACCTGAACACCCCTCCCAGGG + Intergenic
1068777637 10:60885449-60885471 TCCCCTGAACACACCTCTCAAGG - Intronic
1072071816 10:91925138-91925160 CCCCCTTCACCCAACTCCCATGG - Intronic
1075275031 10:121085575-121085597 AAGCCTGCATACACCCCCCAGGG - Intergenic
1075805566 10:125186564-125186586 ACCCCTGCTCACATCTCCACAGG + Intergenic
1076352278 10:129825431-129825453 CCCCCTCCACAGACCTTCCAAGG - Intergenic
1076477169 10:130761075-130761097 CCACCTGCACACACCTCGCCTGG - Intergenic
1076691020 10:132223948-132223970 CCCACTGCAAACACCTCTCAGGG - Intronic
1076778211 10:132709742-132709764 AGCCCTGCACTGACCTCCCCTGG + Intronic
1077317775 11:1927018-1927040 ACCCCAGCACCGTCCTCCCAAGG - Intronic
1077535737 11:3123071-3123093 ACCTCTGCCCACGGCTCCCAGGG - Intronic
1078543401 11:12229124-12229146 ACCACTGCTCACACAGCCCAGGG - Intronic
1083163500 11:60869717-60869739 ACCTCTGGCCATACCTCCCAAGG + Exonic
1083595037 11:63915140-63915162 ACCCAAGCCCCCACCTCCCAGGG + Intronic
1085196997 11:74678820-74678842 GCCCCGGCACAACCCTCCCAGGG - Intergenic
1085754870 11:79193914-79193936 ACCCCTGCTCTCCACTCCCATGG - Intronic
1086414743 11:86577284-86577306 TCACATGCACACACCTCCTAGGG + Intronic
1087503707 11:98993571-98993593 GCATCTGCACACCCCTCCCAGGG - Intergenic
1089659385 11:119976078-119976100 CCCCCTGCACACACATCAGAGGG - Intergenic
1089906831 11:122048578-122048600 AGCCCTGCAGTCACTTCCCATGG + Intergenic
1090465653 11:126930823-126930845 ACCCCTGCACACAGCTGACCAGG + Intronic
1090654952 11:128836075-128836097 ACCCCTCCTCCCACCCCCCACGG + Intergenic
1091488924 12:916298-916320 CCTCCTGCAGACGCCTCCCAGGG + Intronic
1091728034 12:2858996-2859018 AGCCCAGTACAAACCTCCCAGGG - Exonic
1091787589 12:3252395-3252417 GCCTGTGCACACACCTGCCACGG - Intronic
1092039825 12:5374357-5374379 CTCCCTGGACACTCCTCCCAGGG - Intergenic
1092077221 12:5683999-5684021 GTCCCTGCACACATCTGCCATGG - Intronic
1093439554 12:19178038-19178060 ACTCCTGCACACAACTTCCACGG + Intronic
1093488863 12:19681952-19681974 ACCCCCGAACACACCTCCACTGG - Intronic
1093998488 12:25668592-25668614 ACACAAGCACACACTTCCCAGGG - Intergenic
1094042640 12:26133714-26133736 ACATCTGCACACAGCTGCCAGGG + Intronic
1094375580 12:29784294-29784316 ACCCCCACACCCACCTTCCAGGG + Intronic
1094411266 12:30170439-30170461 ACCCCTACGCCCACCTTCCAGGG + Intergenic
1094414206 12:30201100-30201122 ACCCCCACACCCACCTTCCAGGG - Intergenic
1094472797 12:30818935-30818957 GCTCCTGCCCACAACTCCCAGGG - Intergenic
1094829519 12:34293657-34293679 ACCCCTGCAGACACCACGTAGGG + Intergenic
1097420543 12:59373130-59373152 TCCCCTGCATAAACCTCCCCCGG - Intergenic
1100429089 12:94514347-94514369 ACCCCTGAACAAATCTCCAATGG - Intergenic
1100669251 12:96792463-96792485 TCCCCTGGATAGACCTCCCAAGG + Exonic
1102489029 12:113277698-113277720 TCCCCTGCACACACCTGGCTCGG + Intronic
1103011498 12:117461730-117461752 TCACCTGCACACACCTGCAAGGG - Exonic
1103734893 12:123054436-123054458 ACTCCTGCTTACACTTCCCAGGG + Intronic
1103926012 12:124423666-124423688 TTCCCTGCAAACCCCTCCCACGG + Intronic
1103928046 12:124434495-124434517 CCCCCTCCACAGACCCCCCAAGG + Intronic
1103947505 12:124534715-124534737 ACCCCTTCTCACCCTTCCCAGGG - Intronic
1103997991 12:124842417-124842439 TCCTCCCCACACACCTCCCAGGG + Intronic
1104044954 12:125155375-125155397 ATCCCAGCCCACACCTCCCCAGG - Intergenic
1104421660 12:128641142-128641164 CCCCCTTCACACAACTCCCCAGG + Intronic
1104848136 12:131857461-131857483 ATCACTGCACACTCCACCCACGG - Intergenic
1105306474 13:19172562-19172584 TCCCCTGCACACACTGCCAAGGG + Intergenic
1109924372 13:69115808-69115830 TTCCCTGCCCACACCTCCCCTGG - Intergenic
1113653602 13:112055198-112055220 ACCCACGCACACATCTCCCCCGG - Intergenic
1114351365 14:21855129-21855151 ACCCCTAGACCCACCCCCCAGGG - Intergenic
1116843616 14:49844186-49844208 ACCCCTGCACCCCCCATCCATGG - Intronic
1117326489 14:54673647-54673669 ACCCCTGCCCACAGGACCCAGGG - Intronic
1117373140 14:55097068-55097090 TCACCTGCACATACCTCTCAAGG + Intergenic
1117438693 14:55741139-55741161 TCCCCTGCCCCCATCTCCCAGGG - Intergenic
1118259563 14:64234638-64234660 ACCCCTGTTTACACCACCCAGGG - Intronic
1118827053 14:69393446-69393468 ATGCATGCACACACATCCCATGG + Intronic
1119510223 14:75205527-75205549 ACCCCAGAACTGACCTCCCAGGG + Intergenic
1119642944 14:76328541-76328563 CCCGCCCCACACACCTCCCAGGG + Intronic
1122011617 14:98753878-98753900 GCCCCTGCACCCACCCTCCAGGG + Intergenic
1122149677 14:99718186-99718208 CCACCTGCCCCCACCTCCCATGG + Intronic
1122345180 14:101054134-101054156 AACCCTTCACTCACCTCCCTTGG - Intergenic
1122437570 14:101710386-101710408 CCCTCTCCAAACACCTCCCATGG - Intergenic
1122745360 14:103894421-103894443 ACCACTCCCCACATCTCCCACGG + Intergenic
1122893054 14:104741881-104741903 GCCCGTGCACACACCGCCCACGG - Exonic
1202902478 14_GL000194v1_random:51626-51648 TCACCTCCACCCACCTCCCATGG + Intergenic
1123988435 15:25665469-25665491 ACCCCTGCACTGACTTCCCTGGG - Intergenic
1123998797 15:25737536-25737558 TCCCCTGCGCACACTCCCCAGGG - Intronic
1124401207 15:29349130-29349152 ACACATGCACACAACTCCCGTGG + Intronic
1125531140 15:40414350-40414372 TTTCCTGCCCACACCTCCCAAGG + Intronic
1125828642 15:42695616-42695638 GCTCCTTCACCCACCTCCCAGGG - Intronic
1128288885 15:66461675-66461697 AGCCCTGCACGCACTTCACAGGG - Intronic
1128480883 15:68036778-68036800 ACACCTGACCACTCCTCCCAGGG + Intergenic
1128869418 15:71141727-71141749 AGCACAGCACACAGCTCCCAAGG - Intronic
1129892365 15:79079889-79079911 ACACCAGGACACACCTCCCTGGG + Intronic
1130903805 15:88226228-88226250 CCCCCTGCAGACCCCTTCCATGG + Intronic
1131737443 15:95348684-95348706 TCCCCTCCCCACACGTCCCAAGG - Intergenic
1132757234 16:1491630-1491652 ACCCCTGCATATGCCTCCCTCGG + Intergenic
1133102621 16:3488385-3488407 CTCCCTGCACACACCACCCAAGG + Intergenic
1133565912 16:6993242-6993264 GACCCTGCACACACCTTCCTGGG + Intronic
1133809832 16:9152833-9152855 CCCTCTGCTCACCCCTCCCAGGG + Intergenic
1133989573 16:10694296-10694318 ACCCCTGTACTCACCTGCAATGG + Exonic
1134552591 16:15144949-15144971 GCCCCTGCACACAGCTGACATGG + Intergenic
1135382197 16:22004548-22004570 ATCCCTGCACTGACCTGCCATGG - Intergenic
1135391004 16:22093045-22093067 TCTCCTGCAATCACCTCCCAGGG + Intronic
1136289305 16:29261964-29261986 ATCCCTTCACACCCTTCCCAGGG - Intergenic
1137713053 16:50580301-50580323 ACCCCTTCCCACACATGCCAGGG + Intronic
1138477215 16:57278786-57278808 AGCCCTGCTCACACCTCACTCGG + Intronic
1138526735 16:57612784-57612806 AACCCTGCAGAAGCCTCCCAGGG - Intronic
1139611303 16:68060958-68060980 ACCCCGGCACTCACTTCCAAGGG - Intronic
1140160490 16:72486852-72486874 ACCACTGCACACTCCAGCCAGGG - Intergenic
1141722709 16:85765822-85765844 AGCTCTTCCCACACCTCCCAGGG + Intergenic
1142095040 16:88234921-88234943 ATCCCTTCACACCCTTCCCAGGG - Intergenic
1142199751 16:88755472-88755494 CCACCTGCACATTCCTCCCAGGG + Intronic
1142353314 16:89589626-89589648 CCCCCTGCAGACGCCTCCCCGGG - Intronic
1142353646 16:89591077-89591099 CCCCCTGCACTCCCCTCCCCAGG - Intronic
1142625021 17:1186527-1186549 ACGCCCCCACACACTTCCCAGGG + Intronic
1142766754 17:2068709-2068731 CCCCCTCCACACACGCCCCACGG - Intronic
1143303729 17:5929719-5929741 ACCTGTGCCCTCACCTCCCAAGG - Intronic
1144959313 17:19035924-19035946 TCCTCTGCACACACCCCCAAGGG + Intronic
1144975846 17:19138600-19138622 TCCTCTGCACACACCCCCAAGGG - Intronic
1145398179 17:22512217-22512239 TCCCCTGCACTCTCCTGCCAAGG + Intergenic
1146161707 17:30563296-30563318 ACTCCTGCAGACTCCTCCAAGGG + Exonic
1147119647 17:38328431-38328453 GCTCCAGCACCCACCTCCCAGGG + Exonic
1147334585 17:39719690-39719712 ACCCAGCCACACCCCTCCCAGGG + Intronic
1147484269 17:40797081-40797103 CTCCCTGCTCACACCTCCCCGGG - Intronic
1147536965 17:41327635-41327657 ACTCCTGCACACCCTTCCAAGGG + Intergenic
1147623536 17:41884318-41884340 AACCCTGTACACACTTCCCCAGG - Intronic
1147882523 17:43663140-43663162 TCTCCTGCACCCACCCCCCAGGG - Intergenic
1148445448 17:47734373-47734395 CCCCCTGCGCCCACCTCCCCCGG + Intronic
1148454542 17:47804008-47804030 TCCCCTGCACACATCCCCCTGGG + Intergenic
1150291502 17:63985008-63985030 ACCCCAGCCCACACCTCTCAGGG - Intergenic
1151480667 17:74368589-74368611 CCCCCTGGAATCACCTCCCATGG - Intronic
1151966724 17:77435393-77435415 ACCCCTAAACACGCCCCCCATGG + Intronic
1153822922 18:8847712-8847734 AACCCTGGACATACCACCCATGG - Intergenic
1154313534 18:13285463-13285485 AGCCCAGCAGACACCTCCAATGG - Intronic
1156231270 18:35155934-35155956 ACCCCTCCTCCCACCTGCCAGGG - Intergenic
1157551626 18:48585767-48585789 ACCACTGTTCCCACCTCCCAGGG + Intronic
1160014348 18:75129040-75129062 CCCCCTGCAGACACATTCCATGG + Intergenic
1160583764 18:79901675-79901697 ACCGCTGCCCCCACCTGCCACGG + Intergenic
1160611949 18:80095760-80095782 CCCCCTGCACACGCCACTCAAGG + Exonic
1160821222 19:1059077-1059099 ACCCCTGGACTCACCTCACCAGG - Exonic
1161178788 19:2865663-2865685 CCCCCTGCACAGATCTCCCCCGG + Intergenic
1161261887 19:3342343-3342365 ACCCCTGTACCCACCTCTCCAGG - Intergenic
1161298844 19:3533081-3533103 ACCCCTCCACCCACCGCCAAAGG - Intronic
1161702402 19:5802626-5802648 ACCCCTGCACACACACAGCAGGG - Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162130251 19:8521970-8521992 ACCACTGCACACCCTCCCCACGG - Intronic
1162366987 19:10255685-10255707 CCCCCTGCTCACACCTTCCCTGG + Intronic
1164578674 19:29420968-29420990 ACACTCGCACACACCTCCCCCGG + Intergenic
1164898043 19:31894692-31894714 GACCCTGCAAAGACCTCCCAAGG + Intergenic
1165330747 19:35140132-35140154 TCCCCTGCACTCACCTGCCTTGG - Exonic
1165859346 19:38899139-38899161 ACCCCTGCTGACCCCTCCTATGG - Intronic
1166174519 19:41057339-41057361 ACTACTGTACTCACCTCCCAGGG + Intergenic
1166663754 19:44664589-44664611 AGCCCTGTACAGCCCTCCCATGG - Intronic
1166787849 19:45379971-45379993 AGCCCTTCCCAGACCTCCCAAGG + Exonic
1168113198 19:54206598-54206620 ACCCTTGCACACAGCTCACCAGG + Intronic
925106858 2:1299239-1299261 AGCCCTGCGCACATTTCCCAGGG + Intronic
925258652 2:2511068-2511090 ACCCTTGCACACTCTTCCCTGGG - Intergenic
925427559 2:3763079-3763101 GCCCCTCCACACCCCTCCCCTGG + Intronic
925987145 2:9225753-9225775 ACCCCTACAACCACTTCCCACGG - Intronic
927524104 2:23721479-23721501 CCCCCTGCAGACACATCCCCAGG + Intergenic
927797972 2:26068333-26068355 ATCCCTGCTCAAACCTTCCATGG - Intronic
929053729 2:37858567-37858589 ACCCCTCCACCAGCCTCCCAAGG + Intergenic
932133898 2:69211893-69211915 ACCTCTGCTCACACCACCCCCGG + Intronic
932720975 2:74138930-74138952 ACCCTTGCTGACACCTCCCCAGG + Intronic
934655388 2:96114640-96114662 CCCCCTGCCCACCCCTCCCAAGG + Exonic
937023673 2:118680389-118680411 ACCCCTGTCCTCACCTTCCAGGG + Intergenic
942251267 2:174049377-174049399 TCTCCTGCACACACCTCCAGGGG + Intergenic
945041344 2:205745958-205745980 CCCCCTCCACAGCCCTCCCAGGG - Intronic
947043425 2:225949844-225949866 ACACCTGAGCACCCCTCCCAAGG + Intergenic
947169983 2:227301000-227301022 AGCCCTCCAGACTCCTCCCAAGG - Intronic
947518841 2:230828788-230828810 AGCCCTCCTCAGACCTCCCAAGG + Intergenic
947697714 2:232206065-232206087 TGCCCTGCACAGGCCTCCCATGG - Intronic
947733907 2:232445172-232445194 ACCCCAGCACCCAGCTCCCAGGG - Intergenic
1168794641 20:603397-603419 ACACCAGCTCTCACCTCCCAGGG + Intergenic
1171184850 20:23117989-23118011 AGCCCTGCCCAGACCTCCCTTGG + Intergenic
1172105527 20:32515125-32515147 ACCTCTTCTCACGCCTCCCAAGG - Intronic
1173120398 20:40283841-40283863 ACTCATGCCCACACCTGCCAAGG - Intergenic
1173617317 20:44411517-44411539 ACCCGCCCACACCCCTCCCACGG - Intronic
1174458891 20:50668897-50668919 ACACATGCACACACCACACATGG + Intronic
1175033130 20:55974715-55974737 ACCCCTTCACACATGCCCCAAGG + Intergenic
1175141952 20:56867311-56867333 GCCCCTGCACACACTCACCATGG + Intergenic
1175172670 20:57091276-57091298 ACCCATGCACACACCTCCACTGG + Intergenic
1175288867 20:57859944-57859966 ACTCCTGCACCCTCCACCCAAGG + Intergenic
1175694484 20:61091221-61091243 ACCCATGTAACCACCTCCCACGG + Intergenic
1175790610 20:61737915-61737937 AGCCCTGCGCACACCTACCCTGG - Intronic
1176180325 20:63746789-63746811 CCCCCTGAACCCACCCCCCACGG - Exonic
1176621844 21:9066393-9066415 TCACCTCCACCCACCTCCCATGG + Intergenic
1176688111 21:9872933-9872955 ACCCCTCCCCTCACCTCTCAGGG - Intergenic
1180099513 21:45577978-45578000 AACCCTCCACCCACCTGCCACGG - Intergenic
1180843437 22:18969785-18969807 ACCCCTACACACACCACACAGGG - Intergenic
1181058030 22:20268935-20268957 GCCCCTGCACACACCACACAGGG + Intronic
1181577417 22:23803737-23803759 AGCCCTGCACACACCTGCCTTGG + Intronic
1182520210 22:30880866-30880888 ACCCCTGCTCAGACCTCACATGG + Intronic
1184058637 22:42068506-42068528 GCTCCTGCAGACACCACCCATGG - Exonic
1184290851 22:43497440-43497462 ACAGCTGCCCACAGCTCCCAAGG + Intronic
1184328899 22:43813032-43813054 ACCACAGCACCCACCTCACAGGG - Intergenic
1184937030 22:47732261-47732283 ATCCCTGTACACACCTAGCAAGG - Intergenic
1185173081 22:49304739-49304761 ACCTCTGCACGCAGCTCCCAAGG + Intergenic
1185292924 22:50036132-50036154 ACCCCAGGGCACACCTGCCAGGG + Intronic
950090330 3:10290338-10290360 ACCCCCGCTTCCACCTCCCAAGG + Intronic
950544180 3:13629103-13629125 CCCTCCACACACACCTCCCAGGG - Intronic
950616873 3:14166806-14166828 ACACTTGCACACACCTAGCAAGG - Intronic
952243708 3:31562374-31562396 ACACCTGAACACTACTCCCAGGG - Intronic
952616179 3:35276645-35276667 ACACCTGCACACACTTCCAAGGG + Intergenic
952907568 3:38152355-38152377 ACCACTGCACACACCAGCCTGGG - Intergenic
952943396 3:38459768-38459790 AGCGCTGCCCACACCTCCCCAGG - Intronic
953476646 3:43211083-43211105 CCCCATGAACACACTTCCCAGGG - Intergenic
953850140 3:46459781-46459803 ACCACTGAACACTCCTCCTACGG + Exonic
954103678 3:48397776-48397798 CTCCCTTCTCACACCTCCCATGG - Intronic
954594699 3:51814446-51814468 ACCCCTGCACACCTCTCCACTGG - Intergenic
955034221 3:55250612-55250634 ACCCATCCACAGACTTCCCACGG - Intergenic
955867609 3:63401567-63401589 AAAACTGCACAGACCTCCCAGGG - Intronic
957913769 3:86659069-86659091 AACCCTGCACTGACCTCCCAGGG - Intergenic
958606484 3:96364620-96364642 GAGCCTGCACACACCTCCAAAGG + Intergenic
962755281 3:138461419-138461441 CCCACTGGACACACCTCCCCAGG + Intronic
963125515 3:141812351-141812373 AGCCCTGCACAGAACTGCCAGGG + Intronic
966899416 3:184469562-184469584 ACCTCTGCAAACAGTTCCCAAGG - Intronic
967256289 3:187595433-187595455 ACCCCTGCTCTTTCCTCCCATGG - Intergenic
968056612 3:195696854-195696876 CCCGCTGCTCCCACCTCCCATGG + Intergenic
968116224 3:196092125-196092147 AGCTCTGCAGACACCTCCCCAGG + Intergenic
968529731 4:1085061-1085083 ACCCCTACACACACAGCCAATGG + Intronic
969115100 4:4866338-4866360 ACCCCTGCCCACTCCGCCCTCGG - Intergenic
969186685 4:5479626-5479648 AGCCCTGCTGCCACCTCCCAAGG - Intronic
969476075 4:7423031-7423053 ACCCCAGCTCATCCCTCCCAGGG + Intronic
969879589 4:10162077-10162099 ACCCCACCACAAACCACCCACGG - Intergenic
975303097 4:72814870-72814892 ATTGCTGCACACACCACCCAGGG + Intergenic
976383389 4:84426841-84426863 ACCCCTACACACCCTTCCCTGGG + Intergenic
980351484 4:131690772-131690794 ACCCCTTCCCTCACCTCTCAGGG - Intergenic
981037486 4:140187588-140187610 ACCCCAGCACTCTCCTCCCTCGG - Intergenic
981348150 4:143699483-143699505 CCCCCTGCAGAGAACTCCCATGG - Exonic
982424364 4:155240452-155240474 AACACTGCACAAACTTCCCAAGG - Intergenic
983570983 4:169207917-169207939 ACCCCTACTGACACCCCCCATGG - Intronic
983650399 4:170031294-170031316 ACACATGCACACCCCTCCAAGGG - Intronic
985062496 4:186092927-186092949 ACCCCGGCACCCTACTCCCATGG - Intergenic
985478093 5:91131-91153 ATCCCTGTCCACACCTCCCTGGG - Intergenic
985534315 5:455077-455099 AGCCCTGGACTCACCTCCCCTGG + Intronic
985539148 5:479730-479752 GCCCCTGCACCCGCGTCCCAAGG - Intronic
985698855 5:1358595-1358617 GCCCTTGCACACACTTGCCAGGG - Intergenic
985927552 5:3029672-3029694 ACACCTGCACAGTCCTCCCAGGG - Intergenic
986517461 5:8579399-8579421 GGCCCTGCACACAACTGCCAGGG - Intergenic
990400216 5:55430023-55430045 ACACCTGAGCACTCCTCCCAGGG + Intronic
995722385 5:115150751-115150773 GCCCCTGAACACACCTCCACTGG + Intronic
998451027 5:142234932-142234954 ACTCCTGCACACCCCTGCCAAGG + Intergenic
999758297 5:154681627-154681649 ACCCCCACACATACCCCCCAAGG + Intergenic
1001554346 5:172625841-172625863 ACCTCTTCACAAACCTCCCCAGG - Intergenic
1001991039 5:176115507-176115529 AGACCTGCACACCCATCCCAGGG + Intronic
1001993449 5:176135199-176135221 CCCCCTCCCCACACTTCCCAGGG + Intergenic
1002082876 5:176748035-176748057 ACCCAGCCACCCACCTCCCAAGG + Intergenic
1002100840 5:176856808-176856830 ACCCCTGCACATGACCCCCAAGG + Intronic
1002225833 5:177722633-177722655 AGACCTGCACACCCATCCCAGGG - Intronic
1002268016 5:178048579-178048601 AGACCTGCACACCCATCCCAGGG + Intronic
1002301066 5:178257474-178257496 CCCCCTGCCCCCACCTCCCATGG - Intronic
1002335038 5:178471722-178471744 ACCCCTGCCCTCATCACCCATGG + Intronic
1002468661 5:179421723-179421745 ACCCCTGCCCACACGCCCCTTGG + Intergenic
1002705305 5:181157234-181157256 AGCCCAGCAAACACCTCCCTGGG - Intergenic
1003562632 6:7195524-7195546 ATTCCTGCACACACATCCCAGGG - Intronic
1003882860 6:10494146-10494168 ATACCTGCACCCAACTCCCAGGG + Intronic
1004222924 6:13761907-13761929 ACTCCTGCACCCAACTCCCCAGG - Intergenic
1005456148 6:26021590-26021612 ACCCCTGCCCCCACCTCCAGCGG - Intergenic
1006148740 6:31975158-31975180 ACCACAGCAGTCACCTCCCAGGG - Intronic
1007222932 6:40293402-40293424 CACCCTGCCCACCCCTCCCAAGG - Intergenic
1007284233 6:40736357-40736379 GCCCCTGCCCCCATCTCCCAGGG + Intergenic
1010196147 6:73241825-73241847 ACCCCAGCCCAGACCTTCCAAGG + Intronic
1011117121 6:83905947-83905969 GCACCTGAACACTCCTCCCAGGG - Intronic
1011219065 6:85034895-85034917 ACCCCCACCCACACCTCCCCAGG - Intergenic
1012502193 6:99900827-99900849 ACTCCTGCATACAACTCCCTTGG - Intergenic
1013404410 6:109830370-109830392 AGCTCTGCACAAAGCTCCCAGGG + Intergenic
1019380919 7:723013-723035 ACCCCTGCAGGCAGCACCCATGG - Intronic
1019629075 7:2036930-2036952 CCTCCTGAACACTCCTCCCAGGG + Intronic
1020178972 7:5906564-5906586 TCCCCTGCATAGGCCTCCCAAGG + Intronic
1022529625 7:31058719-31058741 ACCCCCACACACACCTCCAGGGG - Intronic
1023654515 7:42406512-42406534 AACGCAGCACACACCTCTCAGGG - Intergenic
1024077140 7:45827254-45827276 GCCTCTGCAGACACATCCCAAGG + Intergenic
1025127276 7:56354167-56354189 GCCTCTGCAGACACATCCCAAGG - Intergenic
1025602527 7:63013739-63013761 GCCTCTGCAGACACATCCCAAGG - Intergenic
1029557537 7:101280757-101280779 GCCTCTGCAGACACATCCCAGGG - Intergenic
1034954914 7:155328129-155328151 ACCCCTGCTCAGACCACCCCGGG + Intergenic
1034959244 7:155354543-155354565 TCACCTGCACACACCACACATGG + Intergenic
1035026573 7:155830401-155830423 CCCCTTGCCCACCCCTCCCAAGG - Intergenic
1035359303 7:158299816-158299838 ACCCCAGCAAGCACCTGCCAGGG - Intronic
1035842170 8:2824978-2825000 ACCTCTGCACATTCCTGCCATGG - Intergenic
1036627695 8:10485055-10485077 ATGCCTGCACACAGCTGCCATGG - Intergenic
1037730976 8:21523897-21523919 GCCACTCCACACATCTCCCAGGG - Intergenic
1038014997 8:23507339-23507361 AGCTCTGCACACACCTCCCTGGG - Intergenic
1038496344 8:28006120-28006142 ACACATGCACACACTTCCCAAGG - Intergenic
1039005175 8:33028370-33028392 GCACCTGCACACACTTCCCAGGG + Intergenic
1041907615 8:63050944-63050966 ACTCCTTAACACACCTCTCATGG - Intronic
1047323548 8:123813798-123813820 AACACTGCACAAACTTCCCAAGG - Exonic
1047448280 8:124939033-124939055 GCCCCTCCCCACCCCTCCCAGGG + Intergenic
1048327515 8:133450818-133450840 AACCCTGCACCCACCCCTCATGG + Intergenic
1049784015 8:144441990-144442012 ACCCCTGCACACACCTCCCAGGG + Intronic
1050023362 9:1308070-1308092 ACCCCTGCGCACCCCTCTCCTGG - Intergenic
1053196714 9:36125525-36125547 CCCCCAACTCACACCTCCCATGG - Intergenic
1053720020 9:40935987-40936009 ACCCCTTCACTCAGGTCCCATGG - Intergenic
1054915550 9:70492360-70492382 ACCACTGCACACACCCACCTGGG + Intergenic
1056508618 9:87281492-87281514 ATCCCAGCACACACCTCCTATGG + Intergenic
1059567409 9:115396791-115396813 AGCCCTGAACACTCCTCCTAGGG + Intronic
1060214389 9:121729941-121729963 ACACACCCACACACCTCCCAAGG - Intronic
1060326925 9:122625812-122625834 GCCCCTCCACCCACATCCCAAGG - Intergenic
1060531289 9:124348330-124348352 AGCCGTGGACACAGCTCCCATGG + Intronic
1060727363 9:126015532-126015554 ACTCCTGCACGCACCTCCGCTGG - Intergenic
1061428809 9:130518219-130518241 ACCTCTGCACCCACCTCCCTTGG - Intergenic
1061452465 9:130675793-130675815 ACCACTGAACACACCCCACAGGG - Intronic
1061508370 9:131045671-131045693 CTCCCTGCAAACGCCTCCCAAGG + Intronic
1062051496 9:134449597-134449619 GACCCTGCATACAGCTCCCATGG - Intergenic
1062121248 9:134835230-134835252 ACCCCTGCTCACGCCTCCGTGGG + Intronic
1062599368 9:137313077-137313099 GCCCCTGCACACAACACCCTTGG + Intronic
1062599723 9:137314418-137314440 CCAGCTGCACACACCTCCCCAGG - Intronic
1186770667 X:12815148-12815170 ACCCCTGCAAACAGCTTCCTGGG - Intronic
1187494022 X:19778563-19778585 ACCTCTTCACATACTTCCCAAGG + Intronic
1187628307 X:21141573-21141595 ACACCTGCACACACCACCTAGGG - Intergenic
1188294963 X:28435867-28435889 ACCCCCACACACCCCTCCCCCGG - Intergenic
1190199372 X:48347151-48347173 GGACCTGCACACACCTTCCACGG + Intronic
1190210417 X:48442249-48442271 GGACCTGCACACACCTTCCACGG - Intergenic
1190452265 X:50593961-50593983 ACCCCTCCTGCCACCTCCCAGGG - Exonic
1190711969 X:53077885-53077907 ACCTTTGCCAACACCTCCCAAGG + Exonic
1191689554 X:63925996-63926018 CCCCCTGCCCACCCCTCCCTTGG + Intergenic
1197971944 X:132123565-132123587 ACCCCTGGGCAAACATCCCAAGG + Intronic
1198194336 X:134344900-134344922 GCCACTGCACCCACCTTCCATGG - Intergenic
1198548573 X:137720029-137720051 GCACCTGCACACACCATCCAGGG - Intergenic
1200256778 X:154586464-154586486 ACCTCTGCACCCATCTCCCTGGG - Intronic
1200260991 X:154617939-154617961 ACCTCTGCACCCATCTCCCTGGG + Intronic
1200267033 X:154652307-154652329 ACCTCTGCACCCATCTCCCTGGG + Exonic
1201158365 Y:11151846-11151868 TCACCTCCACCCACCTCCCATGG + Intergenic
1201240857 Y:11955286-11955308 ACCCCGGCACCAACCTCCCGGGG - Intergenic
1201853908 Y:18519855-18519877 ACCCCTGCAGACACCTGTAAAGG - Intergenic
1201879413 Y:18800529-18800551 ACCCCTGCAGACACCTGTAAAGG + Intronic