ID: 1049784805

View in Genome Browser
Species Human (GRCh38)
Location 8:144445209-144445231
Sequence CTTCAGCTGCAGAAGTAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049784803_1049784805 12 Left 1049784803 8:144445174-144445196 CCAGCTGTATTCTCGGAAGAGTC No data
Right 1049784805 8:144445209-144445231 CTTCAGCTGCAGAAGTAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049784805 Original CRISPR CTTCAGCTGCAGAAGTAGCC CGG Intergenic
No off target data available for this crispr