ID: 1049786391

View in Genome Browser
Species Human (GRCh38)
Location 8:144452926-144452948
Sequence GTGTCCAACGCAGGACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049786391_1049786405 27 Left 1049786391 8:144452926-144452948 CCCTGAGGTCCTGCGTTGGACAC 0: 1
1: 0
2: 0
3: 10
4: 174
Right 1049786405 8:144452976-144452998 CCCACAGCCACAAAGAGCACTGG No data
1049786391_1049786397 -1 Left 1049786391 8:144452926-144452948 CCCTGAGGTCCTGCGTTGGACAC 0: 1
1: 0
2: 0
3: 10
4: 174
Right 1049786397 8:144452948-144452970 CGCTGTCCTGGGCCCTTCAAGGG No data
1049786391_1049786398 0 Left 1049786391 8:144452926-144452948 CCCTGAGGTCCTGCGTTGGACAC 0: 1
1: 0
2: 0
3: 10
4: 174
Right 1049786398 8:144452949-144452971 GCTGTCCTGGGCCCTTCAAGGGG No data
1049786391_1049786396 -2 Left 1049786391 8:144452926-144452948 CCCTGAGGTCCTGCGTTGGACAC 0: 1
1: 0
2: 0
3: 10
4: 174
Right 1049786396 8:144452947-144452969 ACGCTGTCCTGGGCCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049786391 Original CRISPR GTGTCCAACGCAGGACCTCA GGG (reversed) Intronic
902567891 1:17325919-17325941 GTCTCCAACTCCCGACCTCATGG + Intronic
903125800 1:21246874-21246896 GTCTCAAACGCAGGGACTCAAGG + Intronic
905376801 1:37527024-37527046 GTCTCCAACTCCTGACCTCAAGG - Intergenic
912707019 1:111922240-111922262 GAGTCCAAGGCAGAGCCTCAAGG - Intronic
912748524 1:112266290-112266312 TTGTCCAGCCCAGCACCTCAAGG + Intergenic
913854603 1:123667585-123667607 GTTTCCAACGAATGGCCTCAAGG - Intergenic
921066071 1:211622782-211622804 GTCTCCAACTCCTGACCTCAGGG + Intergenic
921793252 1:219313750-219313772 GTCTCCAACTCCTGACCTCAAGG + Intergenic
922905299 1:229169309-229169331 GTGTCCTATTCATGACCTCATGG - Intergenic
923456898 1:234172442-234172464 GTCTCGAACTCATGACCTCAGGG + Intronic
1063178827 10:3577765-3577787 GTCTCCAACTCCTGACCTCAGGG - Intergenic
1065374032 10:25018328-25018350 GTGTCCACCGCATGTCCACAGGG + Intronic
1070557616 10:77540781-77540803 GTCTCCAACTCCTGACCTCAGGG - Intronic
1071822548 10:89293062-89293084 GTGTCAAGGGCAGGACCTGATGG + Intronic
1076574718 10:131456611-131456633 GTGCCCAGAGCAGGCCCTCAGGG + Intergenic
1076875469 10:133213571-133213593 GTGTCCAAGGCAGGGTCCCAGGG - Intronic
1077114296 11:876323-876345 CTGTCCAGGGCAGGACCACAGGG + Intronic
1077545455 11:3167376-3167398 GTGGCCAACGCAGGAAATGAAGG + Intergenic
1079236230 11:18692700-18692722 GTATCCAACTCCCGACCTCAAGG + Intergenic
1082664042 11:55951073-55951095 GTGTCAAGGGCAGGACCTGATGG + Intergenic
1083067481 11:59939955-59939977 GTCTCCAACTCTTGACCTCAAGG + Intergenic
1084522510 11:69673017-69673039 GTCTCCAACTCCTGACCTCAAGG + Intronic
1085470434 11:76754060-76754082 GTCTCCAGCTCAGGAGCTCAGGG + Intergenic
1091101222 11:132875679-132875701 GTCTCGAACTCACGACCTCAGGG + Intronic
1101487297 12:105178006-105178028 GTGTCGAACTCCTGACCTCAGGG + Intronic
1103598121 12:122036637-122036659 GTGTCCCCCGCAGGTCCTCACGG + Intronic
1109230194 13:59747577-59747599 GTGGCCAAGGCAGGACCTGATGG - Intronic
1114328552 14:21613801-21613823 GTCTCCAACTCCTGACCTCAAGG - Intergenic
1114498529 14:23151215-23151237 GTGTGCCAGACAGGACCTCAAGG - Intronic
1115123917 14:29970778-29970800 GTTTCCAACTCCTGACCTCAGGG + Intronic
1115277428 14:31623505-31623527 GTGTCAAGGGCAGGACCTGATGG + Intronic
1115543441 14:34443751-34443773 GTCTCCAACTCCTGACCTCAGGG + Intronic
1116866318 14:50034597-50034619 GTGTCCAACACAGGATCGCATGG + Intergenic
1117252393 14:53950583-53950605 GGGTCCAGCGAAGGACCGCAGGG + Exonic
1117692472 14:58322185-58322207 GTCTCCAACTCCTGACCTCAAGG + Intronic
1122120322 14:99549805-99549827 GTGTCCTCCCCAGGACCTCTGGG - Intronic
1122459356 14:101882610-101882632 GTGGCCAGCGCAGGACCTGGGGG - Intronic
1123464385 15:20504357-20504379 GTCTCCAACTCCTGACCTCAGGG + Intergenic
1123653678 15:22496082-22496104 GTCTCCAACTCCTGACCTCAGGG - Intergenic
1124032002 15:26020261-26020283 GGTTCCAACACAGGACCTCTGGG + Intergenic
1124275114 15:28320329-28320351 GTCTCCAACTCCTGACCTCAGGG + Intronic
1124307587 15:28591270-28591292 GTCTCCAACTCCTGACCTCAGGG - Intergenic
1125757988 15:42078095-42078117 GTGTCCAGAGCAGCAGCTCAGGG - Intronic
1125958591 15:43809408-43809430 GTGTAAAGCGCAGGACGTCAAGG + Intronic
1127107647 15:55634284-55634306 GTCTCCAACTCCTGACCTCAGGG + Intronic
1127192490 15:56545610-56545632 GTCTCGAACGCCTGACCTCAGGG + Intergenic
1127489825 15:59451973-59451995 GTGGACAACACAGGTCCTCATGG + Intronic
1128155831 15:65391340-65391362 GTGTCCAATGCAGGGCCACAAGG + Intronic
1130319345 15:82827725-82827747 GTCTCAAACTCATGACCTCAAGG - Intronic
1130904401 15:88229659-88229681 GTGACCAGGGCAGGACCTCAGGG - Intronic
1131071856 15:89471112-89471134 GTGCCCAGAGCAGGACCACATGG + Intergenic
1131791057 15:95965870-95965892 GTCTCCAACTCCTGACCTCATGG + Intergenic
1132289296 15:100688340-100688362 GTGTCCCACCCAGGACCCCAGGG + Intergenic
1132659623 16:1055554-1055576 GTGTTCAGAGCAGGACCCCAGGG + Intergenic
1135343608 16:21669124-21669146 GTCTCAAACTCATGACCTCAAGG - Intergenic
1135812871 16:25605559-25605581 GTGTCAAAGGCAGGACCTGCTGG + Intergenic
1138062971 16:53910751-53910773 GTGTCAAACTCCTGACCTCAGGG + Intronic
1139021168 16:62751655-62751677 CTGTCCAAAGAAGGACCACATGG - Intergenic
1139604096 16:68005589-68005611 GTCTCAAACTCATGACCTCAAGG + Intronic
1140052521 16:71494699-71494721 GTCTCAAACTCCGGACCTCAGGG + Intronic
1141104508 16:81222312-81222334 GTCTCCAACTCCTGACCTCAGGG - Intergenic
1141474478 16:84263466-84263488 GTGTCCAACTCCTGAGCTCAGGG - Intergenic
1143051924 17:4133026-4133048 GTTCCCACCGCAGGGCCTCAGGG - Intronic
1143533280 17:7518974-7518996 GTCTCCAACTCCTGACCTCAGGG + Intergenic
1144888306 17:18478563-18478585 GTTTCCAAGCCAGGCCCTCATGG - Intronic
1145143900 17:20465739-20465761 GTTTCCAAGCCAGGCCCTCATGG + Intronic
1145791975 17:27632954-27632976 GTTTCCAAGCCAGGCCCTCATGG - Intronic
1146484437 17:33231614-33231636 GTCTCCAACTCAGCACCTAAGGG - Intronic
1151742180 17:75990930-75990952 GTCTCCAACTCCTGACCTCAAGG - Intronic
1151938472 17:77278644-77278666 GTCTCCAACTCCTGACCTCAAGG - Intergenic
1152592812 17:81222229-81222251 GTGTCCCTCCCAGGACCTGAAGG + Intronic
1153833482 18:8943692-8943714 GTCTCAAACTCATGACCTCAAGG + Intergenic
1158024501 18:52879647-52879669 GTCTCCAACTCCTGACCTCATGG + Intronic
1159197306 18:65134104-65134126 GTCTCCAACTCCTGACCTCAAGG - Intergenic
1160367739 18:78342873-78342895 GTCTCCAACTCCTGACCTCAGGG - Intergenic
1160727975 19:626369-626391 GTCTCCAACTCCTGACCTCAGGG + Intronic
1161561552 19:4975808-4975830 GTCTCCAACTCCTGACCTCAGGG + Intronic
1163274389 19:16274032-16274054 GTCTCCAACTCCTGACCTCAAGG + Intergenic
1163787095 19:19280277-19280299 GTTTCCAGTTCAGGACCTCAAGG - Exonic
1165013413 19:32864466-32864488 ATGTCCAACGCTGGAGCTCAGGG - Intronic
1165674374 19:37708627-37708649 GTCTCCAACTCCTGACCTCAGGG - Intronic
1166044247 19:40220336-40220358 GTGTTCAAGGCTGGACCCCAGGG - Intergenic
1166148195 19:40851340-40851362 GTTTCCAACCCAGATCCTCAGGG + Intronic
1166152337 19:40883125-40883147 GTTTCCAACCCAGATCCTCAGGG + Intronic
1168556196 19:57342942-57342964 GTCTCCAACTCCTGACCTCAAGG + Intergenic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
926306115 2:11638356-11638378 GTCTCCAACTCCTGACCTCAGGG + Intronic
928425144 2:31171573-31171595 GTCTCCAATGCAGGGACTCAGGG - Intergenic
928962572 2:36942911-36942933 GTGTCGAACTCCTGACCTCAAGG + Intronic
932896504 2:75645886-75645908 GTTTCCAACTCATGAGCTCAAGG + Intergenic
933480177 2:82846711-82846733 GTCTCCAACTCCTGACCTCAGGG - Intergenic
935668950 2:105538982-105539004 GTGTCCAACGGAGGACAGGACGG + Intergenic
937047375 2:118858924-118858946 ATGTCCACCCCAGGAGCTCAGGG - Intergenic
937385032 2:121421758-121421780 GTCTCCAACTCCTGACCTCAAGG + Intronic
937424983 2:121791159-121791181 CTGGTCAACTCAGGACCTCATGG - Intergenic
942297001 2:174527535-174527557 GTGTCCCAGGCAGAAGCTCAGGG + Intergenic
944025985 2:195167715-195167737 TTGTCCAACCCACGACCCCATGG - Intergenic
948816189 2:240511515-240511537 GTCTCTGACTCAGGACCTCAGGG - Intronic
1170708295 20:18766069-18766091 ATGTCCATAGCAGCACCTCATGG + Intergenic
1171537519 20:25908869-25908891 GTCTCCAACTCCTGACCTCAAGG + Intergenic
1173777336 20:45721308-45721330 GTCTCCAACTCCTGACCTCATGG + Intergenic
1176190279 20:63805629-63805651 GAGTCCAGCGCTGGAACTCAGGG - Intronic
1178626184 21:34220788-34220810 GTGCCCAGGGCAGGGCCTCAGGG - Intergenic
1180160319 21:45996228-45996250 GTTCCCAAGGCAGGATCTCAGGG + Intronic
1184439320 22:44498822-44498844 GTCTCCAACTCCTGACCTCAGGG + Intergenic
1184527950 22:45036589-45036611 GTGTCCAAAGCTGGCCCCCAGGG + Intergenic
951308184 3:21092360-21092382 GTTTCCAACGAATGTCCTCAAGG - Intergenic
955692623 3:61605471-61605493 GTCTCAAACTCTGGACCTCAGGG + Intronic
955725174 3:61925373-61925395 GAGTCCAAAGCAGGAGCTGAGGG + Intronic
957490462 3:80920648-80920670 GTGTTCAAGGCAGGACCACGTGG + Intergenic
959950087 3:112170994-112171016 GTCTCCAACTCCTGACCTCAGGG - Intronic
961736488 3:129004986-129005008 ATGTGCCAGGCAGGACCTCATGG - Intronic
964722293 3:159779449-159779471 GTCTCCAACTCCTGACCTCAAGG - Intronic
967949632 3:194830858-194830880 TTTTTCAACGAAGGACCTCAAGG - Intergenic
968211177 3:196850120-196850142 GTGTCGAACTCCTGACCTCAGGG + Intergenic
968646506 4:1743836-1743858 GTGACCTCCGCAGGACATCAGGG + Intronic
972621481 4:40751338-40751360 GTCTCAAACTCTGGACCTCAAGG + Intronic
974595959 4:64014711-64014733 TTGTCCCAGCCAGGACCTCAAGG - Intergenic
974756214 4:66211125-66211147 GTCTCCAACTCCTGACCTCAAGG + Intergenic
975583311 4:75926341-75926363 GTGTCGAACTCCTGACCTCAGGG - Intronic
982433642 4:155354679-155354701 GTGTCGAACTCCAGACCTCAAGG + Intronic
983195788 4:164804971-164804993 GAGTCCAACGCTGGAGCTAATGG + Intergenic
983233221 4:165150454-165150476 GTGTCGAACTCCTGACCTCAGGG + Intronic
983539082 4:168889379-168889401 GTCTCCAACTCCTGACCTCAGGG + Intronic
987369502 5:17180293-17180315 GTTTCAAACGCCTGACCTCAGGG + Intronic
987592885 5:19954982-19955004 GTGTCAAGGGCAGGACCACATGG + Intronic
988853051 5:35197859-35197881 ATGTCCAAGGCATGCCCTCAGGG - Intronic
989230706 5:39083315-39083337 ATGTCGAAGGCAGGACCTGACGG - Intergenic
989262214 5:39430934-39430956 GTGTCCAGAGCAGGACCACTTGG + Intronic
990224575 5:53634970-53634992 GTCTCGAACGCTTGACCTCAAGG - Intronic
990552966 5:56902645-56902667 GTGTCAAACTCCTGACCTCAAGG + Intergenic
994080461 5:95703414-95703436 GTCTCGAACTCATGACCTCAAGG - Intergenic
995275015 5:110268028-110268050 GTGTCGAACTCCTGACCTCAGGG - Intergenic
995722884 5:115154960-115154982 GTGTCCAACTCCTGACCTCAGGG - Intronic
997460340 5:134047496-134047518 GTGTCCAACTCCAGACCCCAGGG + Intergenic
997553382 5:134773015-134773037 GTTTCCAACTCCTGACCTCAAGG + Intronic
999134207 5:149307027-149307049 GTCTCCAACTCCTGACCTCAGGG - Intronic
999973103 5:156884503-156884525 GTGTCCCATGAAAGACCTCAGGG + Intergenic
1002669839 5:180857712-180857734 GTCTCCAACGCCTGACCTCAGGG + Intronic
1006664640 6:35683694-35683716 GTCTCCAACGCCTGACCTCCTGG + Intronic
1007762252 6:44139881-44139903 GTCTCCAACCCAAGCCCTCAGGG - Intronic
1009080233 6:58761678-58761700 GTTTCCAACGAAGGGCCTCTAGG - Intergenic
1009095796 6:58978618-58978640 GTTTCCAACGAAGGGCCTCTAGG - Intergenic
1009112898 6:59216460-59216482 GTTTCCAACGAAGGGCCTCTAGG - Intergenic
1009119481 6:59307942-59307964 GTTTCCAACGAAGGGCCTCTAGG - Intergenic
1009120972 6:59328834-59328856 GTTTCCAACGAAGGGCCTCTAGG - Intergenic
1009127563 6:59420340-59420362 GTTTCCAACGAAGGGCCTCTAGG - Intergenic
1009130435 6:59460278-59460300 GTTTCCAACGAAGGGCCTCTAGG - Intergenic
1009130805 6:59465547-59465569 GTTTCCAACGAAGGACCTAAAGG - Intergenic
1009146276 6:59680347-59680369 GTTTCCAACGAAGGGCCTCTAGG - Intergenic
1009892100 6:69697840-69697862 TTGTTCAACACAGGACCTAAAGG - Intronic
1011689582 6:89854245-89854267 GTCTCCAACTCCTGACCTCAGGG - Intronic
1013203706 6:107927281-107927303 GTCTCCAACTCCTGACCTCAGGG + Intronic
1013206617 6:107952538-107952560 GTTTCCAACTCCTGACCTCAAGG - Intronic
1016395766 6:143621872-143621894 GTGAGCAAGGCAGGAACTCAGGG - Intronic
1018011006 6:159670088-159670110 GACTCCAACTCATGACCTCAAGG + Exonic
1020156034 7:5725630-5725652 GTGTCGAACTCCTGACCTCAAGG - Intronic
1022737691 7:33091144-33091166 GTTTCCAACGCAGGAATTCTGGG + Intergenic
1024709492 7:51999368-51999390 GTTCCCAATGCAGGTCCTCATGG - Intergenic
1026325392 7:69305082-69305104 GTGTCAAAGGCAGGACCTGGTGG + Intergenic
1027243981 7:76353428-76353450 GTCTCCAACTCCTGACCTCATGG + Intronic
1029564108 7:101323658-101323680 GTGTCAAACTCCTGACCTCATGG + Intergenic
1030407574 7:109133448-109133470 GGGTCCACTGCAGGATCTCAGGG - Intergenic
1031339707 7:120583953-120583975 GTGTCAACCACAGGACATCAGGG + Intronic
1034351701 7:150419844-150419866 GTCTCCAACTCCTGACCTCAAGG - Intergenic
1035340610 7:158158397-158158419 CCAGCCAACGCAGGACCTCAGGG + Intronic
1036405496 8:8451409-8451431 ATGTTCATCGCAGGACTTCACGG + Intergenic
1038241093 8:25808548-25808570 GTCTCGAACTCATGACCTCAAGG - Intergenic
1040307143 8:46217976-46217998 GTGTGCACCGCAGGGACTCAGGG - Intergenic
1040387402 8:46922789-46922811 GTGTCCACAGGAGGACGTCAGGG - Intergenic
1040395684 8:46998010-46998032 ATGTCCCACTCAGCACCTCAGGG - Intergenic
1047144848 8:122186913-122186935 GTATCCAACTCCTGACCTCAGGG + Intergenic
1047749814 8:127871869-127871891 GTCTCCAACTCCTGACCTCAGGG - Intergenic
1048017834 8:130513276-130513298 GTCTCCAACTCCTGACCTCAAGG - Intergenic
1049786391 8:144452926-144452948 GTGTCCAACGCAGGACCTCAGGG - Intronic
1054722350 9:68616752-68616774 GTCTCGAACTCGGGACCTCAGGG + Intergenic
1062021835 9:134323231-134323253 GTGACCAGCTCAGGACCACAGGG + Intronic
1062024921 9:134335867-134335889 GGGACCAAGGCAGGACCACAGGG - Intronic
1185585394 X:1238984-1239006 GTCTCCAACTCCCGACCTCAGGG - Intergenic
1186884874 X:13903203-13903225 GTCTCCCACGCAGGGTCTCAAGG + Intronic
1191869449 X:65733576-65733598 GTTTCCACCCCAGAACCTCAGGG - Intronic
1192590339 X:72354426-72354448 GTGTCCAACTCAAGTCATCACGG + Intronic
1193538876 X:82746409-82746431 GTCTCCAACTCCTGACCTCAGGG - Intergenic
1195168995 X:102247513-102247535 GTCTCCAACTCCCGACCTCAGGG + Intergenic
1195189862 X:102439576-102439598 GTCTCCAACTCCCGACCTCAGGG - Intronic