ID: 1049787386

View in Genome Browser
Species Human (GRCh38)
Location 8:144457505-144457527
Sequence GTGTATCAGCATCTGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049787386_1049787395 19 Left 1049787386 8:144457505-144457527 CCCCTCTGCAGATGCTGATACAC 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1049787395 8:144457547-144457569 CCATTTGCACCTGCATCCTCAGG 0: 1
1: 1
2: 1
3: 23
4: 157
1049787386_1049787391 -4 Left 1049787386 8:144457505-144457527 CCCCTCTGCAGATGCTGATACAC 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1049787391 8:144457524-144457546 ACACACAGGTGGCCCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049787386 Original CRISPR GTGTATCAGCATCTGCAGAG GGG (reversed) Intronic
901837090 1:11931254-11931276 GAGTTTCAGCATCTGGAGACAGG - Intergenic
901960609 1:12823639-12823661 GGGTCTCAGCATCTGGATAGCGG + Intergenic
901967202 1:12878249-12878271 GGGTCTCAGCATCTGGATAGCGG + Intronic
905214358 1:36396484-36396506 GTGTATCAGAATCATCTGAGGGG + Intronic
907228179 1:52969242-52969264 GTGTATCACCATATCCAGAAAGG - Intronic
909053090 1:70791015-70791037 GAGTATCAGCATTGGAAGAGTGG - Intergenic
909407524 1:75308546-75308568 CTTTATTAGCATTTGCAGAGTGG - Intronic
913260169 1:116990658-116990680 GTGTTTCCTCAACTGCAGAGAGG - Intergenic
913663923 1:121030279-121030301 AGGTATCAGGATCTGAAGAGGGG + Intergenic
914653935 1:149722099-149722121 AGGTATCAGGATCTGAAGAGGGG + Intergenic
918456900 1:184730279-184730301 GTGTATCAGAATGTCCACAGAGG + Intronic
918741915 1:188142681-188142703 GAGTTTCAGAATCTGCAGAATGG + Intergenic
919685416 1:200479531-200479553 GTGTGTCAGTGTGTGCAGAGGGG - Intergenic
921729097 1:218556598-218556620 GTGTATCAGGATTTGCAGTGAGG - Intergenic
1066165939 10:32788457-32788479 CTGTACCAGTATCTGCAGACTGG - Intronic
1067658980 10:48219437-48219459 GTGTATCAGTAGGAGCAGAGAGG - Intronic
1068521630 10:58083673-58083695 GTGTCTCAGGATGTGTAGAGAGG + Intergenic
1069185430 10:65416998-65417020 GTGGAACAGCATATGCAGAGAGG - Intergenic
1069286248 10:66719537-66719559 GTGTAGCAGCTTCTGCACATGGG + Intronic
1069947720 10:71999282-71999304 TTTTCTCAGAATCTGCAGAGTGG - Intronic
1072436697 10:95420750-95420772 GAGGATAAGCATCTGTAGAGAGG + Intronic
1072948098 10:99828739-99828761 GTGTCTCAGCCTTTGCTGAGAGG + Intronic
1073537927 10:104294660-104294682 GTGTATGTGCATTTGCTGAGCGG + Intronic
1077251622 11:1563327-1563349 GTGTATCAGCGTGTGTAGGGGGG + Intronic
1077253501 11:1571056-1571078 GTGTACCGGCCTCTGCTGAGGGG - Intronic
1077608292 11:3627007-3627029 GTGTATATGTTTCTGCAGAGAGG + Intergenic
1079339029 11:19596905-19596927 CCGTTTCTGCATCTGCAGAGTGG - Intronic
1079400060 11:20099491-20099513 ATGGATCAGGGTCTGCAGAGGGG - Intronic
1080432363 11:32210655-32210677 GTGAATCAGCAGCTGCTGACGGG - Intergenic
1080799794 11:35599564-35599586 GAGTTTCTGCAGCTGCAGAGAGG + Intergenic
1082841775 11:57695949-57695971 GAGGTTCAGCATCTGCAGACTGG - Exonic
1084810819 11:71610034-71610056 GTGAATCATCATATCCAGAGGGG - Intergenic
1086412114 11:86553417-86553439 GTGGATTAGCATCTGAAGGGAGG - Intronic
1087279452 11:96193923-96193945 CTGTAGCAGTGTCTGCAGAGGGG + Intronic
1087742256 11:101901431-101901453 GTCTATGAGCACCTGCTGAGTGG - Intronic
1087891610 11:103543114-103543136 GTGTATCTGCAACTGAATAGGGG + Intergenic
1089870319 11:121666731-121666753 GGATATCAGAATCTCCAGAGTGG + Intergenic
1093317333 12:17667229-17667251 CTGTAGCAGCATCTTCACAGTGG + Intergenic
1097071071 12:56355340-56355362 TTTTACCAGCTTCTGCAGAGGGG + Exonic
1097263395 12:57732372-57732394 GGGTTTCAGAGTCTGCAGAGGGG - Intronic
1099877476 12:88427047-88427069 TTGTTGCAGCATATGCAGAGAGG - Intergenic
1103107142 12:118238842-118238864 TTATAGCAGCATCTGCAGAGAGG + Intronic
1103736026 12:123061370-123061392 CTGTTTCCTCATCTGCAGAGTGG - Intronic
1105872179 13:24515165-24515187 GTGTATCAGCATATGCATAAAGG + Intergenic
1106574368 13:30961054-30961076 GTGGATCAGTCTCTCCAGAGAGG + Intronic
1107650097 13:42536335-42536357 GTGTATATGGACCTGCAGAGAGG - Intergenic
1110654135 13:77976585-77976607 ATGTTTCAGGATCTGCAAAGAGG - Intergenic
1113591946 13:111507467-111507489 TGGTTTCAGCATCTGCAGAAAGG - Intergenic
1116195273 14:41716797-41716819 GTGTATTAGCACCAGTAGAGTGG - Intronic
1116608421 14:47033328-47033350 TAGTATCAGCTTCTGCAGAAAGG + Intronic
1117699185 14:58396186-58396208 GTGCCTCAGCCTCTGCCGAGGGG + Intronic
1119078311 14:71667217-71667239 GAGGAGCAGCATGTGCAGAGCGG - Intronic
1120229147 14:81823690-81823712 ATGCAGCATCATCTGCAGAGAGG + Intergenic
1122627770 14:103092912-103092934 CTGCAGCACCATCTGCAGAGGGG - Intergenic
1123106447 14:105844014-105844036 GTGTTTCTGCACCTGCAGAGTGG + Intergenic
1123837837 15:24214005-24214027 GTGTATCAGCTCCAGGAGAGAGG + Intergenic
1125755112 15:42058235-42058257 GGGTGTCATCATCTGCATAGTGG - Intergenic
1128249422 15:66153978-66154000 GGGTATCAACAGCTGCAGGGGGG + Intronic
1128513889 15:68330003-68330025 GTGTCTCAGCATTTCCAGTGTGG - Intronic
1128678889 15:69632094-69632116 CTGTTTCCGCATCTGCAGAGAGG + Intergenic
1132995674 16:2821209-2821231 CCGTTTCTGCATCTGCAGAGTGG - Intronic
1133146815 16:3793551-3793573 GTTTTTCAGGATCTGCAGTGGGG + Exonic
1135867930 16:26121830-26121852 GTGTGTGAGGTTCTGCAGAGGGG + Intronic
1141023272 16:80518601-80518623 GTGTAACACCAGCTGCAGATGGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141494642 16:84399303-84399325 GTGTATTAGTATTTGGAGAGGGG + Intronic
1142144934 16:88489020-88489042 GTGAGTTAACATCTGCAGAGAGG - Exonic
1143384891 17:6523312-6523334 CTGTTTCTTCATCTGCAGAGTGG - Intronic
1144131313 17:12250202-12250224 GAGAAGCAGCAACTGCAGAGGGG - Intergenic
1145207583 17:20992765-20992787 CAGTGTCTGCATCTGCAGAGTGG - Intergenic
1147236124 17:39058874-39058896 GGGTGTCAGCAGCTGTAGAGAGG + Intergenic
1151444210 17:74152661-74152683 GTCTATGAGCATCTGCAGCCAGG - Intergenic
1154966593 18:21363688-21363710 GGGTTTCAGGGTCTGCAGAGGGG + Exonic
1156102684 18:33616915-33616937 GTGTATCTGCATTTGAAGATGGG - Intronic
1162209160 19:9077814-9077836 GTGTCTACTCATCTGCAGAGTGG - Intergenic
1163688179 19:18724174-18724196 GGGCCTCACCATCTGCAGAGGGG - Intronic
1167556500 19:50199450-50199472 GGGTATCAGCTGCAGCAGAGAGG - Intronic
925029965 2:642873-642895 CTGTATCTGCCTCTGCAAAGTGG - Intergenic
925959396 2:9001978-9002000 GTATATCAGCAAATGCAGGGTGG - Intronic
926530302 2:14036454-14036476 GTATTTCAAGATCTGCAGAGGGG + Intergenic
926556425 2:14363379-14363401 CGGTATCAGCATCTGTAAAGGGG + Intergenic
929428423 2:41867470-41867492 GTGTGTGTGTATCTGCAGAGTGG - Intergenic
930023620 2:47016312-47016334 GTGAATCAGCATCAGGAGACTGG + Intronic
930170756 2:48249114-48249136 GCGTGTCTGCATTTGCAGAGAGG - Intergenic
930237373 2:48900843-48900865 GTGAAGCAGCATCTGCTCAGAGG + Intergenic
934217878 2:90050980-90051002 TTGTATCAGCATCAGTAGACTGG - Intergenic
938266248 2:129930230-129930252 GTCTTTCAGAAGCTGCAGAGAGG + Intergenic
938998186 2:136703018-136703040 GAGTACCAGCATCTGCTGGGAGG - Intergenic
940236490 2:151516460-151516482 GAGTCTCAGCAGATGCAGAGTGG - Exonic
945255649 2:207800906-207800928 GTGTATCAGAATCAGCTGGGGGG - Intergenic
947622911 2:231602492-231602514 GTGTTTCCTCATCTGCAAAGTGG + Intergenic
1169975099 20:11316419-11316441 CTGAATCAGCATCACCAGAGTGG - Intergenic
1176422863 21:6530434-6530456 GTGTACCAGCCTCTGCTGCGTGG - Intergenic
1177987041 21:27989476-27989498 GCGTATCAGCATCTGTGGAAAGG + Intergenic
1178133921 21:29604629-29604651 ATGTAGAAGCATTTGCAGAGGGG + Intronic
1179698356 21:43138751-43138773 GTGTACCAGCCTCTGCTGCGTGG - Intergenic
1181407249 22:22693813-22693835 GTGTGTTATCATCTGCACAGTGG + Intergenic
1183961621 22:41414678-41414700 GTGGCTCAGCAGCTGCAGAATGG + Intergenic
1184095624 22:42314785-42314807 CTGGAGCAGCATCTGGAGAGGGG + Intronic
1184169756 22:42752021-42752043 GTGTTTCAGCATCTGGGGTGGGG - Intergenic
949914426 3:8947465-8947487 GTGAATCAGTATCTGCTGACTGG + Intronic
950126579 3:10513528-10513550 GTGTAACAGCATCTGCAATGCGG + Intronic
953844944 3:46419542-46419564 GTGTATCTGCAACTGAATAGGGG + Intergenic
955798976 3:62666920-62666942 CAGTTTCTGCATCTGCAGAGTGG + Intronic
956070429 3:65444215-65444237 TTGTATCAACATCTGCAAATTGG - Intronic
958993743 3:100877424-100877446 GTGTATAAACATGTGCAGAATGG - Intronic
959002570 3:100981773-100981795 GTGAAACAGGATCGGCAGAGAGG - Intronic
961109914 3:124275227-124275249 ATGTACCAGAATCTGCAGAGTGG + Intronic
962718557 3:138150363-138150385 CTGTATCAACTTCTGTAGAGGGG + Intergenic
964102684 3:153006025-153006047 CTGTATCAACTTCTGCAGAGGGG - Intergenic
967445992 3:189567082-189567104 CTGAATCAGCATTTTCAGAGAGG + Intergenic
970090875 4:12406614-12406636 GTGTATCAGGATCTGCTTTGAGG + Intergenic
972098473 4:35380634-35380656 GTTCATCAGCATCTGCACAAAGG - Intergenic
972871529 4:43305884-43305906 CTGTATCAGCATCTGCTGGAGGG + Intergenic
980190312 4:129516745-129516767 GTTTAGCACCATCTCCAGAGTGG - Intergenic
980736838 4:136900851-136900873 GTGACTCAGCATCTGCAGTCTGG - Intergenic
981613176 4:146618361-146618383 GTGATTCAGAGTCTGCAGAGAGG - Intergenic
984211801 4:176858839-176858861 GTGAATCAGCATCTACTGAAAGG + Intergenic
988531235 5:32029043-32029065 GTTTTTCAGCATCTGCAGCCTGG + Intronic
989196363 5:38720559-38720581 GTATATCAGCATCCCCACAGAGG - Intergenic
989364632 5:40642073-40642095 GTGGATTATCCTCTGCAGAGGGG + Intergenic
992992163 5:82294764-82294786 TTGTTTCCTCATCTGCAGAGTGG - Intronic
997167006 5:131672013-131672035 GTGTATCAGACTCTCCAGATTGG + Exonic
999820050 5:155217907-155217929 GTGTATCAGTGTATGCAGAATGG + Intergenic
1000395802 5:160773552-160773574 GTATATTAGCAGCTCCAGAGCGG + Intronic
1001765803 5:174246011-174246033 GTGTACTAGCACCTGCAGATTGG + Intergenic
1001856786 5:175018707-175018729 GTATATTAACATCTACAGAGTGG + Intergenic
1003328160 6:5108551-5108573 CTGAGTCAGAATCTGCAGAGAGG + Exonic
1008258397 6:49333447-49333469 GTGTATCAGAATCACCTGAGGGG + Intergenic
1010023896 6:71193576-71193598 GTTAATTAGCATCTGCAGTGGGG + Intergenic
1010251775 6:73714491-73714513 GTGGATCAGCACCTGCAGAAGGG - Intronic
1012132894 6:95519149-95519171 GTGTGTCACCATCTGCAGCTTGG + Intergenic
1012871877 6:104682753-104682775 GCGGGTCAGCTTCTGCAGAGTGG - Intergenic
1013192455 6:107815178-107815200 TGGTAACAGCTTCTGCAGAGGGG + Intronic
1014161058 6:118168946-118168968 GACTGTTAGCATCTGCAGAGGGG + Intronic
1014752775 6:125272450-125272472 GTGTATCTGCAACTGAATAGGGG - Intronic
1016700487 6:147048651-147048673 GTCCATCAGCCTCTGCACAGTGG + Intergenic
1019567862 7:1693570-1693592 GTGTGTGCACATCTGCAGAGGGG + Exonic
1019573809 7:1726551-1726573 GTGTGGCAGCTGCTGCAGAGGGG + Intronic
1019809948 7:3158008-3158030 GAGCAGGAGCATCTGCAGAGTGG - Intronic
1020895049 7:13929500-13929522 GTGTGTCAGGATCTGAAGACTGG - Intronic
1022481578 7:30746902-30746924 CTCTTACAGCATCTGCAGAGGGG - Intronic
1022809165 7:33852032-33852054 GAGTATCATCATCTCCTGAGAGG - Intergenic
1023852833 7:44159642-44159664 GTGGATTTTCATCTGCAGAGAGG + Intronic
1026503190 7:70960179-70960201 CTGTCTCATCATCTGCTGAGTGG - Intergenic
1028679088 7:93504934-93504956 TTGCAGCAGCATCTTCAGAGAGG - Intronic
1028830349 7:95321009-95321031 GGGTATCTGCATCTGGTGAGGGG + Intronic
1029875908 7:103751448-103751470 GTGAATCAGCATGTACTGAGAGG + Intronic
1031328096 7:120427464-120427486 GACTATTAACATCTGCAGAGGGG + Intronic
1032595007 7:133230909-133230931 TTGTTTCAGCATCAACAGAGTGG - Intergenic
1034656742 7:152735829-152735851 CTGTCCCAGCATCTGCAGCGTGG + Intergenic
1035565823 8:640295-640317 GTGTGTCAGCAGCTCCAGAGAGG - Intronic
1037292520 8:17366433-17366455 ATGAATCAGCATCAGCAGAATGG + Intronic
1038236719 8:25765821-25765843 GTGCATCAGCCTCTCCAGAAAGG - Intergenic
1040456262 8:47601278-47601300 GTGTTTCCTCATCTGCAAAGTGG - Intronic
1041777821 8:61543247-61543269 GTGTACCAGCATATGCATAATGG - Intronic
1042169484 8:65978011-65978033 CTGGGTCAGCAGCTGCAGAGGGG - Intergenic
1045174167 8:99703330-99703352 CTATACCAGTATCTGCAGAGTGG - Intronic
1045397648 8:101776935-101776957 TTGTATCCTCTTCTGCAGAGTGG - Intronic
1048518626 8:135133629-135133651 GTGCAGCAGCATTTGCAGTGGGG + Intergenic
1049188034 8:141269395-141269417 GTGAATCTGCAGCGGCAGAGGGG + Intronic
1049545143 8:143227278-143227300 GTGAAAGAGAATCTGCAGAGAGG + Intergenic
1049787386 8:144457505-144457527 GTGTATCAGCATCTGCAGAGGGG - Intronic
1050906311 9:11011395-11011417 GTGTAACAGCATCTGAGTAGGGG - Intergenic
1051380668 9:16455237-16455259 ATATATCAGCATCTGCAGGTGGG + Intronic
1054778062 9:69140463-69140485 GTGTGTCAGCAGGTGCAGCGTGG + Intronic
1054870309 9:70043151-70043173 GTGCATCAGAATCTGCTGAAGGG - Intergenic
1054885199 9:70189707-70189729 GTGTACCAACATATGCATAGTGG - Intronic
1055395675 9:75871804-75871826 CTGTATCAGCATCTAGAAAGAGG - Intergenic
1056852454 9:90095937-90095959 GTGTCTCAGCAGCGACAGAGCGG - Intergenic
1057262857 9:93595600-93595622 GTGTGTCTGCACATGCAGAGAGG - Intronic
1057330387 9:94108941-94108963 GTGTATTAGCATGAGCAGCGTGG + Exonic
1058329065 9:103736331-103736353 GTGGATCAGCATGTGGATAGTGG + Intergenic
1058637993 9:107055553-107055575 TTGTATCACCAACTTCAGAGGGG + Intergenic
1058745422 9:107985869-107985891 GTGTCTCCTTATCTGCAGAGTGG - Intergenic
1061187595 9:129063713-129063735 GTGTATCAGCCTGTGCACAGGGG - Intronic
1185693443 X:2175415-2175437 GTGTCCCAGAAACTGCAGAGAGG + Intergenic
1186655075 X:11603506-11603528 GTGTATATGCATGTGTAGAGGGG + Intronic
1187467133 X:19537602-19537624 ATGTATCCAGATCTGCAGAGAGG + Intronic
1190874947 X:54453136-54453158 GGGACTCATCATCTGCAGAGAGG - Intronic
1194432822 X:93831690-93831712 ATTTATCAACATATGCAGAGTGG - Intergenic
1196130862 X:112154653-112154675 TTGTCTCAGCCTTTGCAGAGGGG + Intergenic
1197988834 X:132295482-132295504 CTGAATCAGCATCTTCAGATGGG - Intergenic
1198395843 X:136218599-136218621 GTGTGTCAGCAACTCCAGAGGGG - Intronic
1199827791 X:151516688-151516710 GTGTGTGAGCATATGCAGGGTGG + Intergenic