ID: 1049787798

View in Genome Browser
Species Human (GRCh38)
Location 8:144459389-144459411
Sequence AGCTTTTATGTTCTCTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049787798_1049787800 -6 Left 1049787798 8:144459389-144459411 CCCACACAGAGAACATAAAAGCT 0: 1
1: 1
2: 0
3: 28
4: 272
Right 1049787800 8:144459406-144459428 AAAGCTGAGTCTTGCTGTACTGG No data
1049787798_1049787806 28 Left 1049787798 8:144459389-144459411 CCCACACAGAGAACATAAAAGCT 0: 1
1: 1
2: 0
3: 28
4: 272
Right 1049787806 8:144459440-144459462 ACCTGACGTGAGGCAGGACTCGG No data
1049787798_1049787801 18 Left 1049787798 8:144459389-144459411 CCCACACAGAGAACATAAAAGCT 0: 1
1: 1
2: 0
3: 28
4: 272
Right 1049787801 8:144459430-144459452 TGCAGCCCCAACCTGACGTGAGG No data
1049787798_1049787802 22 Left 1049787798 8:144459389-144459411 CCCACACAGAGAACATAAAAGCT 0: 1
1: 1
2: 0
3: 28
4: 272
Right 1049787802 8:144459434-144459456 GCCCCAACCTGACGTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049787798 Original CRISPR AGCTTTTATGTTCTCTGTGT GGG (reversed) Intronic
901614019 1:10523201-10523223 AGCTTTTATCTTCTATGATTTGG + Intronic
903523816 1:23977082-23977104 AGCTATTATTTTCTCTGTAATGG + Intronic
903941217 1:26932773-26932795 TGCTGTTCTGTTTTCTGTGTAGG + Intronic
904471039 1:30736360-30736382 AGCAGTGATGCTCTCTGTGTGGG + Intronic
905709694 1:40091005-40091027 ACCTTTTCTGTTCTCTGATTTGG - Intronic
906429184 1:45740717-45740739 AACTTTTGTGTTCTGTGGGTGGG - Intronic
909844437 1:80374158-80374180 AGCTTTTCTTTTCTCTGTTCTGG + Intergenic
910083311 1:83369362-83369384 TGCTTCTTTGTTCTCTGTTTTGG + Intergenic
910135230 1:83960354-83960376 AGCTCTTATCTTCTCTCTCTTGG - Intronic
911032900 1:93508886-93508908 GGCTTTGCTTTTCTCTGTGTTGG + Intronic
911674091 1:100639178-100639200 GGCTTTTATTTTCACTGTGGTGG + Intergenic
915234780 1:154472682-154472704 AGCTTTGAAGATCTCTGTGCTGG + Intronic
915479225 1:156173716-156173738 GGCTTTTGTGTTCTCTATGTAGG + Intronic
915494818 1:156274562-156274584 ACCTTTCATTTTCTCTGTTTTGG - Intronic
917474833 1:175360237-175360259 ATCTTCTATGTTCTCTGTCCTGG - Intronic
917957210 1:180111805-180111827 ATGTTTAGTGTTCTCTGTGTGGG + Exonic
918932301 1:190870431-190870453 AGGTTTTATTTTATCTTTGTTGG + Intergenic
919363490 1:196625814-196625836 AGCTTTTTTTTTTTCTTTGTGGG + Intergenic
921258632 1:213365561-213365583 AGTTTTTATCTTCTGTCTGTCGG - Intergenic
921450607 1:215301595-215301617 AGCTTTGAAGCTCTCTGTGGTGG + Intergenic
921803238 1:219425857-219425879 AACTTTTTTTTTCTCTTTGTAGG - Intergenic
922793997 1:228329929-228329951 AGCTTTTATGATTTCTTTGGTGG + Intronic
923972904 1:239225717-239225739 ATTTTTTGAGTTCTCTGTGTTGG + Intergenic
1062890422 10:1056145-1056167 AGCATTTTTTTTTTCTGTGTAGG - Intronic
1063583643 10:7331633-7331655 AGCTTGCAAGTTCTCAGTGTTGG - Intronic
1063800960 10:9577338-9577360 ATTTTTTGTGTTCTATGTGTTGG - Intergenic
1064561013 10:16595556-16595578 GGCTCTTATGTTCTCTGTCTAGG - Intronic
1065205138 10:23349996-23350018 AGTTTTTGTGTTTTCTGTGGAGG - Intergenic
1065552318 10:26880940-26880962 AGCTTTTATTTTCTATTTTTAGG + Intergenic
1066172521 10:32866002-32866024 TGCTTTTAGGTTCTCTGAGCAGG - Intronic
1067194386 10:44102972-44102994 AGCTTTTGTTTCCTCTGTGCTGG - Intergenic
1067963656 10:50885164-50885186 AGATTTTGAGTTCTGTGTGTGGG - Intronic
1068254996 10:54497957-54497979 ATCTTATATATTCTCTGTCTGGG - Intronic
1068626468 10:59253996-59254018 AGCCTTTCTGTTCTGTGTGTTGG - Intronic
1071361465 10:84850466-84850488 ATCTTTGATGTTCTATGTATGGG + Intergenic
1071669273 10:87592528-87592550 AGTTTTTCTGTTCTCTGCTTCGG + Intergenic
1073838982 10:107476529-107476551 GGCTTGTATGTTCACTGTGCTGG - Intergenic
1077354803 11:2110284-2110306 AGTTTTAATGTTCTTTGTGTAGG - Intergenic
1079135341 11:17773319-17773341 AGCTTTCACGTTGTCTGTTTGGG + Intronic
1082702180 11:56445670-56445692 ATCTATTATGTTATGTGTGTAGG + Intergenic
1082784055 11:57307186-57307208 AGCTTTAATGTTCTTGGTGCAGG - Intronic
1085412923 11:76302205-76302227 ACATTTTAAGGTCTCTGTGTAGG - Intergenic
1085567150 11:77524556-77524578 CTCTTCTGTGTTCTCTGTGTAGG + Intronic
1086112935 11:83218661-83218683 AGAGTTTATGTTCTCTTTCTGGG + Intronic
1086535890 11:87845208-87845230 TGCTTTTATTTTCTTTGAGTTGG - Intergenic
1087258108 11:95979555-95979577 ACGTTTGATGTTCTCTGTGGTGG + Exonic
1088880133 11:113966885-113966907 GGTTTTTATGATTTCTGTGTAGG + Intergenic
1089234048 11:117007582-117007604 AGCGTTTGTGTTATGTGTGTTGG + Intronic
1090187874 11:124750135-124750157 AGATTTTAATTTCTCTTTGTGGG - Intronic
1090572020 11:128057802-128057824 ATCTTTTAAGTTCTCTGGGCCGG - Intergenic
1091745525 12:2989802-2989824 TGCTTTTAAGATCTCTGTTTTGG + Intronic
1093234150 12:16585436-16585458 AACATTTATGCTCACTGTGTAGG - Intronic
1093246818 12:16748930-16748952 GACTTTTAAGTTCACTGTGTTGG + Intergenic
1093683088 12:22024958-22024980 TGCTTTTTTGTTCTGTTTGTAGG - Intergenic
1094620418 12:32075411-32075433 AGCTGTCATGGTCTCTGTGTTGG + Intergenic
1097478000 12:60083367-60083389 AGCTTTTGTGTTTACAGTGTTGG + Intergenic
1099650123 12:85415935-85415957 ATATTTTTTTTTCTCTGTGTTGG + Intergenic
1099775194 12:87118256-87118278 AGGTTTTATTGTCTTTGTGTGGG + Intergenic
1100542540 12:95571709-95571731 AGCTTTTATCTTTACTGTTTTGG - Intergenic
1103966006 12:124639787-124639809 ATCATTTATGTTCTCCCTGTGGG + Intergenic
1104093706 12:125537345-125537367 AGCATTTGTGTTTTGTGTGTTGG - Intronic
1104477728 12:129084351-129084373 AGCTTGGATTTGCTCTGTGTTGG - Intronic
1104735068 12:131131535-131131557 AGCTTGCATGTTGTGTGTGTTGG + Intronic
1106435066 13:29716018-29716040 AGCTCTTAGGGTCTCTGTGGTGG + Intergenic
1106513404 13:30431247-30431269 AGCTTTTATGTTCACTGTGTTGG + Intergenic
1108518024 13:51221331-51221353 TGCCTTTATTTACTCTGTGTGGG - Intergenic
1108980292 13:56502535-56502557 ATCTTTCTTCTTCTCTGTGTAGG + Intergenic
1109201783 13:59439672-59439694 AGCTGTTATTTTCCCTGTCTCGG - Intergenic
1110619364 13:77578088-77578110 AGCTTTGATGTTTTAAGTGTGGG - Intronic
1110723290 13:78789893-78789915 ATCTTTTGTGTTCTCTATCTGGG + Intergenic
1112249150 13:97762962-97762984 AGATTTTCTTTTCTCTGTGATGG - Intergenic
1114684161 14:24512609-24512631 TGATTTTATCTTTTCTGTGTGGG + Intergenic
1115829094 14:37314916-37314938 ACCTGTTATGTGCTGTGTGTTGG + Intronic
1116066946 14:39996748-39996770 AGCTTTTATACTGTCTGTGTTGG + Intergenic
1116314073 14:43364177-43364199 AGGTTTTGTTTTGTCTGTGTGGG + Intergenic
1116329908 14:43582721-43582743 TGCTTTTATACTCTTTGTGTAGG + Intergenic
1118176451 14:63445157-63445179 GGCTTCCATGTTCTCTGTCTGGG + Intronic
1118890135 14:69902241-69902263 AGCTTTCTTTTGCTCTGTGTTGG - Intronic
1125074352 15:35595738-35595760 GGGTTTTTTGTTCTCTCTGTAGG - Intergenic
1126153259 15:45542021-45542043 GCATTTTGTGTTCTCTGTGTAGG + Intergenic
1127044354 15:55010412-55010434 AGCATTGATGCACTCTGTGTCGG + Intergenic
1127301088 15:57654421-57654443 ACCTTTTATATGCTCTGTATTGG + Intronic
1127452172 15:59127285-59127307 AGGTATTTTGTTCTCTTTGTAGG + Intergenic
1128195681 15:65753140-65753162 GGCTTTTATTTTCTCTTTATTGG + Intronic
1128915736 15:71560686-71560708 ATCATTTCTTTTCTCTGTGTGGG + Intronic
1130934523 15:88457602-88457624 AGATGCTATGTTCTCAGTGTGGG - Intergenic
1132113924 15:99121923-99121945 GGCTTTTGTGTTCTATGTTTTGG + Intronic
1133886036 16:9828539-9828561 AGATTTTCTGTTCTGTGTGTGGG - Intronic
1134127641 16:11627346-11627368 AGCCTGGCTGTTCTCTGTGTTGG - Intronic
1134836022 16:17361339-17361361 AGCATATATTTTCTCTGTGTTGG - Intronic
1135628879 16:24020525-24020547 AGGTTTTATGTTCTGTGTGCAGG + Intronic
1136598418 16:31267361-31267383 AGCTTTTGTTTTCTCTGTGGAGG - Intronic
1138836225 16:60438821-60438843 AGATTTTCTGTTCTGTATGTAGG + Intergenic
1139128349 16:64109265-64109287 AGATTTTATGTTTGCTTTGTTGG + Intergenic
1139251148 16:65497882-65497904 ATCTATTATAGTCTCTGTGTGGG - Intergenic
1139810629 16:69613685-69613707 ACCTTTAATGTTATCTGTGGAGG - Intronic
1141116443 16:81313996-81314018 AGCTTTGATCTTCACTGGGTTGG + Intergenic
1144436255 17:15245393-15245415 AGCATTTATGTGCTCTGGTTAGG + Intronic
1146247714 17:31304677-31304699 ATCTTTTATTTTCTCTGTTTTGG + Exonic
1146385858 17:32372479-32372501 AGGTTTTTTGCTCTCTGTATAGG + Exonic
1147513536 17:41094592-41094614 AGCTTTTAAATTCTCTTTGATGG - Intronic
1149109692 17:53013217-53013239 AGCTCTTATTTTCTCCCTGTTGG - Intergenic
1149230462 17:54528062-54528084 TGCATTTTTGTGCTCTGTGTTGG + Intergenic
1150032713 17:61756165-61756187 AGCTTTTATATTCTCATTGCAGG + Intronic
1151069798 17:71195900-71195922 AACTTTTATTTTCTGTTTGTGGG + Intergenic
1151411387 17:73932510-73932532 ATGTTTTATGTTCTCTGCATAGG - Intergenic
1152576448 17:81143384-81143406 AGCTAGTAAGTTTTCTGTGTTGG + Intronic
1153048086 18:874754-874776 TGCTGTTATATTCTTTGTGTAGG - Intergenic
1153159540 18:2188390-2188412 AGTTTTTATTTTCTCAGTCTCGG + Intergenic
1153426490 18:4970694-4970716 AGTTTAGAAGTTCTCTGTGTGGG - Intergenic
1155727660 18:29108969-29108991 AGGTTGTATGTTCACTCTGTTGG + Intergenic
1156590525 18:38482835-38482857 AGCCTTTATGTCCTCTGTAATGG - Intergenic
1157155817 18:45264892-45264914 AGCTGTACTGTTCTCTGTGCTGG + Intronic
1158416007 18:57250301-57250323 AGGTTTTATGTCCTCAGTGCTGG - Intergenic
1159345534 18:67198406-67198428 TGCATTTATGTCCCCTGTGTAGG + Intergenic
1160472736 18:79152394-79152416 GGCTTTTATGTACTCTGGTTTGG + Intronic
1161003497 19:1923136-1923158 AGCCATCATGTTCTCCGTGTCGG + Exonic
1161416439 19:4149849-4149871 TCCTTTTATCTGCTCTGTGTTGG - Intergenic
1161706886 19:5826376-5826398 AGCTTCCATGATCTCTGTCTTGG - Intronic
1163049915 19:14675142-14675164 AGATTTTAGGGTGTCTGTGTTGG + Intronic
1163940539 19:20488661-20488683 AGATTTTATTTACTTTGTGTTGG + Intergenic
1164524922 19:29006637-29006659 AGCTTTCACTTTCTCTGTGGAGG - Intergenic
1165365291 19:35361609-35361631 AGTTTTTCTGTTCTCTGCCTTGG - Intergenic
1166386736 19:42386633-42386655 AGCTTATAAGTTCTCTGCTTTGG + Intergenic
925074254 2:999853-999875 ACCTTATATGTTGTCTGTCTTGG - Intronic
926498702 2:13624815-13624837 AGATTTTATTTTCTTTCTGTTGG - Intergenic
927410580 2:22820802-22820824 AGCTTTCATGTCCTCTCTGAGGG - Intergenic
928278456 2:29922508-29922530 AGCTATTATGAGTTCTGTGTTGG - Intergenic
928404642 2:31005254-31005276 AGCTTCTGTGTTGTGTGTGTGGG + Intronic
928691108 2:33799518-33799540 AGTATATATGTTCTCTTTGTTGG + Intergenic
928973357 2:37055797-37055819 AGCTTTTAAGTTATCTGTGATGG + Intronic
929418551 2:41768192-41768214 AGTTTTTAAGTTCACTGTGATGG - Intergenic
929453738 2:42052326-42052348 AGCTTCAATTTTCTCTGCGTGGG - Intronic
931035375 2:58236023-58236045 TCCTTTTCTGTCCTCTGTGTTGG - Intronic
932946791 2:76243337-76243359 AACTCTTATGTACTCTTTGTGGG - Intergenic
933635536 2:84704683-84704705 AGCTTTAATGTTCTTGGAGTGGG + Intronic
933721608 2:85400826-85400848 AGCTTTTATGGTCCCTGTGCTGG + Intronic
933902059 2:86857223-86857245 TGCCCTTATGTTCTCTGTGAGGG - Intronic
935043821 2:99461098-99461120 AGCTTGTAACTTTTCTGTGTAGG - Intronic
935778488 2:106492051-106492073 TGCCCTTATGTTCTCTGTGAGGG + Intergenic
936101578 2:109585720-109585742 TGCTTTAATATTCTCTGTGTGGG - Exonic
936980439 2:118259943-118259965 CTCTTTGATGTTCTCTGTGTGGG + Intergenic
937846615 2:126585486-126585508 AGATTTAGTGTTCTCTTTGTTGG + Intergenic
939118892 2:138092131-138092153 TGTTTTTCTGTTCTCTTTGTTGG + Intergenic
940503912 2:154528124-154528146 AGCTTAAATGTTCCCTTTGTGGG + Intergenic
941050617 2:160728848-160728870 AGGTATTATGTTCACTGTTTGGG + Intergenic
942598615 2:177617983-177618005 GGCTTTGATGTTCGCAGTGTTGG - Exonic
942794404 2:179800148-179800170 AGCTTTTATGTAATCTAAGTTGG + Intronic
944821519 2:203437168-203437190 AGCCTTTATGTTTTCAGTGCAGG - Exonic
946135731 2:217645447-217645469 TGCCTGTTTGTTCTCTGTGTTGG - Intronic
946554541 2:220841069-220841091 AGCTGTTTTGTTTTCTCTGTAGG - Intergenic
946806919 2:223479976-223479998 TGGTTTTAAGTTCTGTGTGTGGG + Intergenic
947512009 2:230764386-230764408 AGCTGTGATGTTCTGTGAGTTGG + Intronic
947666078 2:231906292-231906314 AGCTTTTAGATTCTCAGTGTCGG + Intergenic
948437301 2:237962275-237962297 AACTTTCATGTTCTCTGGGAGGG - Intergenic
1168922792 20:1554315-1554337 ATCTCTTATGTTCTCTGTCTTGG + Intronic
1170381694 20:15767187-15767209 AGATTTTATGTTTTCTCTTTCGG + Intronic
1171777687 20:29384891-29384913 AGCTTTTCTGTTTTTTATGTCGG + Intergenic
1171818976 20:29815568-29815590 AGCTTTTCTGTTTTTTATGTAGG + Intergenic
1173149415 20:40553300-40553322 AGCTTTTCCTTGCTCTGTGTGGG - Intergenic
1174033408 20:47649804-47649826 AGCTTTTATCATCTTTCTGTAGG - Intronic
1174847218 20:53954264-53954286 AGCTGTGATTTTCTCTGTGTTGG - Intronic
1177356595 21:20016470-20016492 AACTTTTTTGTGTTCTGTGTCGG + Intergenic
1177471512 21:21565946-21565968 AACTGTTATGTTCAATGTGTTGG - Intergenic
1177833606 21:26167933-26167955 AGCTTTACTATTCTGTGTGTCGG + Intronic
1178899307 21:36586352-36586374 AGTTTAAATGTTCTCTCTGTTGG + Intergenic
1179334045 21:40433404-40433426 AGATGTTATGCTTTCTGTGTTGG - Intronic
1179605960 21:42515079-42515101 ACCTGTGATGTTCTCTTTGTTGG + Intronic
1180322951 22:11340266-11340288 AGCTTTTCTGTTTTTTATGTAGG + Intergenic
1184274572 22:43402965-43402987 AACTTTTATGTTTTCTGTCCAGG - Intergenic
951026917 3:17840382-17840404 GGCTTCTATTTTCTCTGTGAAGG + Intronic
952489572 3:33854383-33854405 GACTTTTATGTTCTCTGCGGTGG + Intronic
952839428 3:37631670-37631692 AGCTTCTCTGTTCCCTGGGTAGG - Intronic
956177610 3:66488148-66488170 AGCTTTTATTTTCTTTGTTCTGG - Intronic
957087517 3:75695860-75695882 AGCTTTTCTGTTTTTTATGTTGG - Intergenic
958926858 3:100167899-100167921 AGCTATTATGTTCTATGTGCTGG + Intronic
959086395 3:101854950-101854972 AGGATTTATTTTCTCTCTGTGGG + Intronic
959550562 3:107651072-107651094 AACTTTTATTTCCTCTTTGTAGG + Intronic
959814294 3:110657496-110657518 AGATTTTAGGGTCTTTGTGTTGG + Intergenic
960350838 3:116590780-116590802 AGCTTTAAAATTCTCTGAGTTGG + Intronic
960357937 3:116676740-116676762 AGCTATGATGTTCAGTGTGTTGG - Intronic
962186211 3:133262544-133262566 AGCTTTTATCTTCACTGCTTTGG + Intronic
962319757 3:134380865-134380887 AGTTTTTCTGTTCTCTCTTTTGG + Intergenic
962441964 3:135428458-135428480 AGTTTTTATTTTCTCTTTTTTGG - Intergenic
963343588 3:144067790-144067812 ATCTTTTATTTTATCTGTGTGGG + Intergenic
964913369 3:161809605-161809627 AGCTTTTATGCCTTCTCTGTGGG + Intergenic
965154880 3:165038286-165038308 AGCTTTTTTATTCTTTGTTTTGG + Intronic
968289242 3:197525967-197525989 AGCTTTTAGTTCCGCTGTGTTGG + Intronic
968299815 3:197603873-197603895 AGCTTTTTTTTTTTCTGGGTGGG - Intergenic
968838526 4:2982780-2982802 AGTTTCTGTGTTCTCTGTGAAGG + Intronic
969424783 4:7117864-7117886 AGCATTTACTTCCTCTGTGTTGG - Intergenic
970345097 4:15145600-15145622 TGCTTTTTTGTTCTCTTTGCTGG + Intergenic
970397572 4:15684800-15684822 AGGTTTTATGTCCTCTGTCGAGG - Intronic
970723801 4:19018601-19018623 AGCTTTTAATTTCTCTGTGATGG - Intergenic
974104764 4:57457274-57457296 AGGTATTTTGTTCTCTTTGTAGG - Intergenic
974529562 4:63090127-63090149 TGCTTTTTTGTTCTCTGCGATGG - Intergenic
977395346 4:96464064-96464086 TGCTTCTATATTCTCTTTGTAGG - Intergenic
977849900 4:101814307-101814329 ATCTTTTAAGTACTCTGTTTGGG + Intronic
979829102 4:125278560-125278582 AGCTTTTTTGTTGTCGTTGTTGG - Intergenic
980067555 4:128206406-128206428 ACCTTTTATTTTCTCTTTATAGG + Exonic
980805266 4:137804651-137804673 AGCTTTTTGTTTGTCTGTGTAGG + Intergenic
980904569 4:138935022-138935044 AACTTGTATTTTCTCTGTGGTGG - Intergenic
981307458 4:143262051-143262073 AGCGATTAACTTCTCTGTGTTGG + Intergenic
981460888 4:145012756-145012778 CCCTTTTCTATTCTCTGTGTTGG - Intronic
981884167 4:149652545-149652567 AGCTTTTATATCCTTTTTGTTGG - Intergenic
983023414 4:162707763-162707785 ATCTTTTATTTTCTCTGTATTGG - Intergenic
983780402 4:171663347-171663369 AGGTTTTGTTTTCTCTGTATAGG - Intergenic
983816900 4:172141163-172141185 AGCTTTTCTGCTCTCTCTCTAGG - Intronic
984263093 4:177465157-177465179 AGCTTTTAAATTCCCTGTGCCGG - Intergenic
984341742 4:178465888-178465910 ATGTTTTATGTTCTCTGAGCTGG - Intergenic
984614580 4:181882382-181882404 AGCCTTTATTTTCTCAATGTTGG + Intergenic
984777917 4:183499750-183499772 AGCTATTATGTTATTTGTATAGG + Intergenic
984870447 4:184320157-184320179 AGCTTTTCCGTCTTCTGTGTAGG + Intergenic
984873408 4:184346986-184347008 ATCTTAGATTTTCTCTGTGTTGG - Intergenic
985443464 4:190002946-190002968 AGCTTTTCTGTTTTTTATGTAGG + Intergenic
986881833 5:12183781-12183803 AGGTTTTATTTTTTCAGTGTGGG - Intergenic
988641790 5:33048754-33048776 AACTTTTATCTTTTTTGTGTTGG - Intergenic
991968687 5:72117353-72117375 AGCTTTTATTTTTTCTCTGTAGG + Intronic
992924935 5:81573454-81573476 AGGTTTTATGTTCTCCTTGGTGG - Intronic
993126129 5:83837920-83837942 AGCTTCTACTTTCTCTGTGTTGG + Intergenic
993576140 5:89602947-89602969 AATATTAATGTTCTCTGTGTTGG - Intergenic
993771117 5:91928624-91928646 AAGTTTTATGTTTTCCGTGTAGG - Intergenic
993964348 5:94342951-94342973 AGCTTTTGTTTTCTCTTTTTTGG - Intronic
996695092 5:126385580-126385602 TGCTATTATTTTCTCTGTGCCGG + Intronic
999402902 5:151280787-151280809 AGCATCTATTTTCTATGTGTAGG + Intronic
1000178642 5:158784926-158784948 AGCTCCTATGTGCTCTGTGGAGG + Intronic
1000953907 5:167519296-167519318 ACCTGTTATGTGCTCAGTGTTGG - Intronic
1003820981 6:9896834-9896856 TGTTCTTATGTTCACTGTGTCGG - Intronic
1004986850 6:21092205-21092227 AGCTTTTTTTTTTTCTGGGTCGG + Intronic
1007698478 6:43749082-43749104 AGCTATTATGTTCTATATGATGG - Intergenic
1008637200 6:53422903-53422925 ATTTTGTATGTTCCCTGTGTTGG + Intergenic
1009380677 6:63024976-63024998 AGCTTACATGTTTTCTGTATTGG + Intergenic
1009592940 6:65697535-65697557 AGCTGTTGTGTTTTCTCTGTGGG - Intronic
1010698246 6:79005609-79005631 TGCTTTTTTGTTCTCTCTCTTGG - Intronic
1012681445 6:102187296-102187318 AGCTTATATGTTATCTGGGCTGG - Intergenic
1013229126 6:108145398-108145420 AGCTTTTTTGTTCTATTTGAAGG - Intronic
1013962333 6:115915314-115915336 AGTTTTAATGTTCTTTGTTTTGG - Intergenic
1014887951 6:126804685-126804707 ATGTTTCATGTTCTGTGTGTGGG + Intergenic
1016380309 6:143470939-143470961 TGCTTTTCTTTTCTCTGTGAAGG + Exonic
1016714974 6:147215056-147215078 AGGCTTTATGGTCTCTGTGACGG + Intronic
1017297462 6:152815093-152815115 AGCTTCTGTGTTCTCTGACTAGG + Intergenic
1017513730 6:155137394-155137416 TGTTTCTATGTTCTCAGTGTTGG - Exonic
1020499542 7:8899208-8899230 AGGTTTTCTGTTTTCTCTGTTGG + Intergenic
1020569092 7:9835565-9835587 ATATTTGATGTTCTATGTGTGGG + Intergenic
1021137242 7:16980282-16980304 AGCTTTCTTTTCCTCTGTGTTGG - Intergenic
1021365705 7:19774466-19774488 AGCTTTTATGTTCTCATCATGGG - Intergenic
1021627269 7:22605914-22605936 AGTATTTATCATCTCTGTGTTGG + Intronic
1022843798 7:34190373-34190395 ACCCTTTATGCTCACTGTGTTGG + Intergenic
1023252722 7:38282823-38282845 AGCTTTTTTGTTCTGTGGTTTGG + Intergenic
1025065007 7:55846516-55846538 ACTTTTAATATTCTCTGTGTGGG - Exonic
1026626738 7:71999848-71999870 AGCCTTTATATTATCTGTCTTGG - Intronic
1027300142 7:76825504-76825526 TGCTTCTTTGTTCTCTGTTTTGG + Intergenic
1027462807 7:78476685-78476707 AGATTTTATGTGCTCTTTGTGGG - Intronic
1029433881 7:100550703-100550725 AGATTTTATGTCCTCTCTTTTGG + Intronic
1030598808 7:111570255-111570277 AGTTTAAATGTTCTCTCTGTGGG - Intergenic
1031185338 7:118472802-118472824 TGCTTTTATGTTTTCTGTCCAGG - Intergenic
1031631697 7:124050826-124050848 AGCTTTTGTGTTCTTAGTCTTGG + Intergenic
1032101164 7:128979023-128979045 CGCTTTGCTGTTCGCTGTGTAGG - Exonic
1033035860 7:137875632-137875654 AGCTTTCAAGTTCTCTGGGCAGG - Exonic
1033815429 7:145065994-145066016 AGCTTTTATCCTCACTGTGGAGG + Intergenic
1033924121 7:146436205-146436227 AGATTTTATGTTTTTTGTGATGG + Intronic
1036895711 8:12633200-12633222 AGTTTCTCTGTTCTATGTGTGGG - Intergenic
1037395420 8:18436444-18436466 AGCTTTTATCTTCATTTTGTTGG - Intergenic
1038361399 8:26882852-26882874 AGCTATTATTTTGTTTGTGTGGG - Intergenic
1040449194 8:47527078-47527100 ATGTTTTATGTTCTATGTCTAGG + Intronic
1040974347 8:53173425-53173447 AGCTGTGATCTTCTGTGTGTTGG - Intergenic
1044741851 8:95335722-95335744 AGCTTCTATGTTCTCATTTTTGG + Intergenic
1044913906 8:97091579-97091601 ACATTTTAGGTTCTCTTTGTAGG + Intronic
1044930953 8:97251298-97251320 AGCATCTGTGTTCTCTGTGAAGG - Intergenic
1046592966 8:116227876-116227898 AGCCTTTATGTATTCTTTGTAGG - Intergenic
1047810576 8:128404254-128404276 AGCTTTTATTTTCTTTCTTTAGG - Intergenic
1048541381 8:135345043-135345065 ATCTATTATGTGCTCTGTGTTGG + Intergenic
1049787798 8:144459389-144459411 AGCTTTTATGTTCTCTGTGTGGG - Intronic
1050489723 9:6175777-6175799 AGCTTTTATTTTCTTAGTTTGGG - Intergenic
1051665799 9:19465874-19465896 AGCTTTCATGTTCTAACTGTTGG - Intergenic
1052249490 9:26380646-26380668 ATCTTTTATATTCTCTGAGGGGG - Intergenic
1055468956 9:76592508-76592530 AGCTTTTATGTTCCCTGACCAGG - Intergenic
1056261144 9:84849976-84849998 AGATTTTAAGCACTCTGTGTGGG - Intronic
1056304829 9:85279761-85279783 AGGGTTTGTGTTCTCTGTGGGGG - Intergenic
1058472648 9:105297124-105297146 TGCTCTTTTGTTTTCTGTGTGGG + Intronic
1059037319 9:110768713-110768735 AGTTTTTATTTTCTCTATCTTGG - Intronic
1060406773 9:123376728-123376750 AGCTCTGATTTTCTCTGAGTAGG + Intronic
1061514876 9:131083234-131083256 AGCTTTTACCTTCTCATTGTCGG + Intronic
1186140296 X:6564807-6564829 AGCTCTTATGTTCTGTTGGTGGG + Intergenic
1187483737 X:19682384-19682406 GGCCTTTATCTTCTTTGTGTAGG - Intronic
1187578527 X:20583696-20583718 AGATTTTAGGTTGTATGTGTAGG + Intergenic
1188308859 X:28592072-28592094 AGCTTTTAATTTGTCTTTGTTGG - Intronic
1188820397 X:34767835-34767857 CTCTTTTGTGTTCACTGTGTGGG - Intergenic
1188989947 X:36805847-36805869 AGCTTTACTTTTCTCTTTGTTGG - Intergenic
1190045497 X:47108708-47108730 AGCTTTTATGATCTGTTTGATGG - Intergenic
1192829753 X:74739550-74739572 AGCTTGTATGATCCCTTTGTGGG - Intronic
1193452253 X:81685150-81685172 AGCTTTTATCTTCTTTGCGATGG - Intergenic
1193757057 X:85421749-85421771 AGTTTTTAATTTCTATGTGTTGG + Intergenic
1196324687 X:114389327-114389349 CGCTTTGCTGTTCGCTGTGTAGG + Intergenic
1196437410 X:115687421-115687443 AGCTTTTGTGTTCTGTGTCTTGG - Intergenic
1196871870 X:120120295-120120317 AGCTTAAGTGTTCCCTGTGTTGG - Intergenic
1198001323 X:132440621-132440643 AGATTTTTTTTTTTCTGTGTAGG + Intronic
1198656868 X:138924278-138924300 AGCTTTGCTTTTCTCTGTGTTGG + Intronic
1198734138 X:139767796-139767818 TGCTTTCATGGTCTCTGTGACGG - Intronic
1199739336 X:150718455-150718477 AGCTTTTAAGTTGTCTTTGAAGG + Intronic
1200465558 Y:3512083-3512105 ACCTTTTATTTTATCTGTTTTGG - Intergenic
1201952558 Y:19581450-19581472 AGGTTGTGTGTTCTCTCTGTTGG + Intergenic