ID: 1049787799

View in Genome Browser
Species Human (GRCh38)
Location 8:144459390-144459412
Sequence CAGCTTTTATGTTCTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 237}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049787799_1049787801 17 Left 1049787799 8:144459390-144459412 CCACACAGAGAACATAAAAGCTG 0: 1
1: 0
2: 1
3: 24
4: 237
Right 1049787801 8:144459430-144459452 TGCAGCCCCAACCTGACGTGAGG No data
1049787799_1049787808 30 Left 1049787799 8:144459390-144459412 CCACACAGAGAACATAAAAGCTG 0: 1
1: 0
2: 1
3: 24
4: 237
Right 1049787808 8:144459443-144459465 TGACGTGAGGCAGGACTCGGCGG No data
1049787799_1049787802 21 Left 1049787799 8:144459390-144459412 CCACACAGAGAACATAAAAGCTG 0: 1
1: 0
2: 1
3: 24
4: 237
Right 1049787802 8:144459434-144459456 GCCCCAACCTGACGTGAGGCAGG No data
1049787799_1049787806 27 Left 1049787799 8:144459390-144459412 CCACACAGAGAACATAAAAGCTG 0: 1
1: 0
2: 1
3: 24
4: 237
Right 1049787806 8:144459440-144459462 ACCTGACGTGAGGCAGGACTCGG No data
1049787799_1049787800 -7 Left 1049787799 8:144459390-144459412 CCACACAGAGAACATAAAAGCTG 0: 1
1: 0
2: 1
3: 24
4: 237
Right 1049787800 8:144459406-144459428 AAAGCTGAGTCTTGCTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049787799 Original CRISPR CAGCTTTTATGTTCTCTGTG TGG (reversed) Intronic
900147419 1:1164515-1164537 GAGCTGGTGTGTTCTCTGTGGGG + Intergenic
901173478 1:7281358-7281380 CAACTTTTATTTTCTCCATGTGG - Intronic
904374893 1:30074381-30074403 CAGATTTTTTATTATCTGTGTGG - Intergenic
904471038 1:30736359-30736381 CAGCAGTGATGCTCTCTGTGTGG + Intronic
905258556 1:36701353-36701375 GACCTTTTATGTACTCTTTGAGG - Intergenic
905383456 1:37581449-37581471 CAGCTTCTATGTCCTCTGGTTGG - Intronic
906429185 1:45740718-45740740 CAACTTTTGTGTTCTGTGGGTGG - Intronic
906440900 1:45843436-45843458 CAGTTTTTATATTCAGTGTGAGG + Intronic
909239986 1:73200534-73200556 CAGCTTTTTTTTTATCTGGGAGG - Intergenic
910430944 1:87159221-87159243 CAGCTTCTGAGCTCTCTGTGAGG + Intronic
911257841 1:95652457-95652479 CATATGTTATGTTCTCTGTTTGG - Intergenic
911648566 1:100361463-100361485 TACATTTTATGATCTCTGTGAGG + Intronic
914786008 1:150831750-150831772 TAGCTTTCATGGACTCTGTGAGG + Intronic
916429337 1:164712279-164712301 CAGCGGCTATCTTCTCTGTGTGG + Intronic
917467096 1:175289442-175289464 CAGGATTTACATTCTCTGTGGGG + Intergenic
920819168 1:209364391-209364413 TAGATTTTCTGGTCTCTGTGTGG - Intergenic
921976996 1:221213758-221213780 CACCTTTCATTTTCTCTATGGGG - Intergenic
922422737 1:225470572-225470594 AAGCGTGTGTGTTCTCTGTGCGG - Intergenic
923281674 1:232449021-232449043 CATCTTCTTTGATCTCTGTGGGG - Intronic
923455360 1:234160780-234160802 CAGCTGTTCTCTGCTCTGTGAGG + Intronic
924373363 1:243380412-243380434 CAGCTTTTAATGTCTCAGTGTGG + Intronic
1064216533 10:13405346-13405368 TAGCTTTTCTGTTCTTTGTGTGG + Intergenic
1065419247 10:25523302-25523324 CATCTTTAAGGTCCTCTGTGTGG + Intronic
1066329954 10:34410657-34410679 CAACTTTTATTTTCTGTGTTGGG + Intronic
1067963657 10:50885165-50885187 CAGATTTTGAGTTCTGTGTGTGG - Intronic
1068202924 10:53806926-53806948 CAACTTTTAAGTTGTCCGTGAGG + Intronic
1068254997 10:54497958-54497980 CATCTTATATATTCTCTGTCTGG - Intronic
1068988010 10:63124638-63124660 CAGTTTTTAAGGTTTCTGTGGGG + Intergenic
1070212079 10:74334802-74334824 AAGCTTTTATAGTCTCTGAGGGG + Intronic
1071207960 10:83305203-83305225 CAGGTTTGATGTTTTCTGAGGGG + Intergenic
1071795540 10:89001348-89001370 ATGCTTTTATTTTGTCTGTGGGG + Intronic
1073564502 10:104523580-104523602 CAGCTTTTCTGTTGTCCTTGAGG + Intergenic
1073573131 10:104597664-104597686 CAGCTCTTATTTTTTCAGTGAGG + Intergenic
1074205579 10:111280178-111280200 CAGTTTGTCTTTTCTCTGTGTGG - Intergenic
1075506566 10:123028032-123028054 CAGCACTTAGGTTCTCTTTGTGG + Intronic
1077901748 11:6495737-6495759 CAGCTTGTATGTAGTCTGTGAGG + Intronic
1079078873 11:17400137-17400159 CAGCTTTGATTGTCTCTGCGTGG + Intronic
1080096241 11:28410871-28410893 CAGTTTTTATGTAATCTTTGGGG - Intergenic
1080719061 11:34831576-34831598 CAGCTTGCATCTTCGCTGTGTGG + Intergenic
1080937441 11:36879364-36879386 AAGAATTTATGCTCTCTGTGAGG - Intergenic
1080942513 11:36935686-36935708 TAGCTTTTATTTACTCTTTGAGG + Intergenic
1082798501 11:57396037-57396059 CAGCTTTTATCTGCCCCGTGGGG - Intronic
1082914121 11:58412527-58412549 CAGCTTTTTTCTTCTTTGTCAGG + Intergenic
1083832553 11:65242068-65242090 CAGCTTAGATGGTCTCTTTGAGG - Intergenic
1083900397 11:65640714-65640736 CAGCTTTGATGGTCTCGGAGGGG + Intronic
1084509089 11:69591927-69591949 CAGATTTCATTTCCTCTGTGAGG + Intergenic
1085868133 11:80318898-80318920 TGTCTTTTTTGTTCTCTGTGAGG + Intergenic
1086112934 11:83218660-83218682 CAGAGTTTATGTTCTCTTTCTGG + Intronic
1087258819 11:95987327-95987349 AAGCTGTTTTGTTCTCTGTTGGG - Intronic
1087587947 11:100146128-100146150 CAGATTTTGTGTTTTATGTGAGG + Intronic
1089165765 11:116475359-116475381 CAAGTATTATCTTCTCTGTGAGG - Intergenic
1089543445 11:119205307-119205329 CAGCATTTCTGTTCCCTGGGCGG + Intergenic
1093566517 12:20612350-20612372 TATGTTTTATCTTCTCTGTGTGG + Intronic
1094745489 12:33340007-33340029 CAGATTGTATTTTCTCTGAGAGG + Intergenic
1100728638 12:97438318-97438340 CTCCTTTTATGTTTTCTTTGTGG + Intergenic
1101109409 12:101471491-101471513 CAGCTTTAGGGTTCTCTGTAGGG - Intergenic
1101745267 12:107536531-107536553 CAGATTTTTTTTTCTCTTTGAGG - Intronic
1103649011 12:122418865-122418887 CAGCTTCTTTCTTCTCTGAGAGG - Intronic
1104129432 12:125878828-125878850 CAGCTTTGGTGTTCTTTTTGAGG + Intergenic
1104186635 12:126438949-126438971 CAGCTTTTGCTTTCTCTCTGGGG - Intergenic
1105859316 13:24395173-24395195 CAGGTTTTAAGTTGCCTGTGAGG - Intergenic
1106770605 13:32957695-32957717 CAGCTTTAGTGCTCCCTGTGGGG - Intergenic
1106783566 13:33085314-33085336 CCCCTTTTATGTTCTCTTTGTGG + Intergenic
1107020226 13:35743704-35743726 CAGTTTTTAAGCTCTCTCTGGGG - Intergenic
1108518025 13:51221332-51221354 CTGCCTTTATTTACTCTGTGTGG - Intergenic
1109032822 13:57215655-57215677 CAGATTTTATATTCTTGGTGTGG + Intergenic
1109886519 13:68552509-68552531 CAACTTTTGTCTTCTTTGTGGGG + Intergenic
1110619365 13:77578089-77578111 CAGCTTTGATGTTTTAAGTGTGG - Intronic
1111681240 13:91444693-91444715 CAGCATTTCTCTTCTGTGTGTGG + Intronic
1112300427 13:98224796-98224818 CAGCCTTCATGTTCTCTGTGAGG - Intronic
1112429447 13:99337770-99337792 CAGCTTTTCCCTTCTCTCTGTGG + Intronic
1113752311 13:112784869-112784891 CAGCTTTGAAGTTCACTGTGTGG + Intronic
1114304192 14:21406170-21406192 CAGATTTTAGGATATCTGTGGGG - Intronic
1115240166 14:31245883-31245905 CATCTTTTAAGTACTCTGTGTGG - Intergenic
1115684129 14:35776676-35776698 CAGATATTATGTACTCTGTCAGG - Intronic
1116056918 14:39875422-39875444 CAGTGTATATTTTCTCTGTGAGG + Intergenic
1116368281 14:44097261-44097283 CAAATTTTATGTTCTCAGTGGGG - Intergenic
1116899563 14:50348855-50348877 CAGCTTTCCTGTTCTCTCTGAGG - Intronic
1117572971 14:57067229-57067251 CAGCGTGTATGATCTCTGAGTGG - Intergenic
1117619688 14:57572197-57572219 CAGCTTTTATATTCTGTGCCTGG - Intronic
1118008974 14:61590627-61590649 CAACTTTTTTGCTATCTGTGAGG - Intronic
1121680006 14:95785954-95785976 GAGCCTTTCTGTTCACTGTGTGG - Intergenic
1123909550 15:24953829-24953851 TAGCCTATCTGTTCTCTGTGAGG + Intronic
1124074699 15:26433658-26433680 CATGTTTTCAGTTCTCTGTGGGG + Intergenic
1124391968 15:29267594-29267616 CTGCTCTTATGTTCTATGTGGGG + Intronic
1126635940 15:50779943-50779965 CAAATATTATGTTCTCAGTGAGG - Intergenic
1128576644 15:68780536-68780558 CGGCCTTTTTGTGCTCTGTGTGG - Intronic
1128699535 15:69794230-69794252 CTTCTATTATGTTCTCTCTGTGG - Intergenic
1133886037 16:9828540-9828562 AAGATTTTCTGTTCTGTGTGTGG - Intronic
1134322597 16:13177185-13177207 CTGCTAATATGTTCTCTGAGAGG - Intronic
1137540624 16:49359279-49359301 CAGCTTTTCTGTCCTCTGACAGG - Intergenic
1138891904 16:61153867-61153889 CAGGTTGTATTTTCTCTATGAGG + Intergenic
1139213530 16:65104985-65105007 AAGCTTTTAAGTTATCTGTGAGG - Intronic
1139251149 16:65497883-65497905 CATCTATTATAGTCTCTGTGTGG - Intergenic
1140230176 16:73111563-73111585 CAGATTCCATATTCTCTGTGAGG + Intergenic
1140994946 16:80250137-80250159 CATCTTTTCTGTTTACTGTGGGG - Intergenic
1141327508 16:83075597-83075619 GAACTTTGATGTTCTGTGTGAGG + Intronic
1143781767 17:9232948-9232970 CGGCTTTCATGGTTTCTGTGGGG + Intronic
1144254310 17:13450917-13450939 CAGCTTTTTTGTTCTACATGTGG - Intergenic
1149795632 17:59516598-59516620 CAGCTGTCACCTTCTCTGTGAGG - Intergenic
1150037388 17:61818617-61818639 CAGCTTCTCTGTTCTCTTTGGGG - Intronic
1154512763 18:15125979-15126001 CAGCTTCCAAGTTCCCTGTGGGG + Intergenic
1155107319 18:22680386-22680408 CAGGTTTTCTGTTCTTTTTGAGG - Intergenic
1159507723 18:69358123-69358145 CAGCTTTAATCTGCTCTGTGTGG + Intergenic
1162714442 19:12621057-12621079 CAGATTTTATGTTCTTTTGGAGG + Intronic
1164709239 19:30343598-30343620 CAGCTTTTAATTTCACTGCGTGG - Intronic
925204102 2:1991924-1991946 CAGCTATGATGTCCTCTGAGAGG - Intronic
925381949 2:3434637-3434659 CAGCTTTTAGGTTCCCATTGAGG + Intronic
925709131 2:6720849-6720871 CAGATTTCATATTCTATGTGGGG + Intergenic
926898159 2:17718020-17718042 CAGCCTTTATATTTGCTGTGTGG + Intronic
927410581 2:22820803-22820825 GAGCTTTCATGTCCTCTCTGAGG - Intergenic
927461814 2:23305777-23305799 CAACTTTCATGTGCCCTGTGAGG - Intergenic
928810922 2:35224765-35224787 CATCTTTTTTTTTCTCTGTATGG - Intergenic
929077362 2:38089075-38089097 CAGCCTTTGTGTTCTCCGTTGGG - Intronic
929439266 2:41952625-41952647 CAGCTTGTAGGTTCTGAGTGCGG - Intronic
929453739 2:42052327-42052349 CAGCTTCAATTTTCTCTGCGTGG - Intronic
929859035 2:45659748-45659770 CAGATGTTATGTTCTCAGTAAGG + Intronic
931158285 2:59660116-59660138 CATGTTTTATTTTCTCAGTGAGG + Intergenic
933269459 2:80217470-80217492 TAATTTTTAGGTTCTCTGTGGGG - Intronic
933885427 2:86715360-86715382 CATCTTTTATGTCACCTGTGTGG - Intronic
933902060 2:86857224-86857246 GTGCCCTTATGTTCTCTGTGAGG - Intronic
933924749 2:87081331-87081353 CATCTTTTATGTCACCTGTGTGG + Intergenic
934025335 2:87997578-87997600 TAGTTTTTATGTTTTCTCTGGGG + Intergenic
935086520 2:99851344-99851366 TGGCTTTTATGTTCTCTTTCTGG + Intronic
935106266 2:100046707-100046729 CAGTTTTTATGTTCACTTTTTGG + Intronic
935778487 2:106492050-106492072 GTGCCCTTATGTTCTCTGTGAGG + Intergenic
935786506 2:106553707-106553729 CACCTTTTCTGTTCTCTCTCGGG + Intergenic
935824578 2:106932051-106932073 CAGCTTTTCTGTTCACTATATGG + Intergenic
936031282 2:109072731-109072753 CTGCTCTTAGCTTCTCTGTGAGG + Intergenic
936101579 2:109585721-109585743 CTGCTTTAATATTCTCTGTGTGG - Exonic
936339998 2:111622775-111622797 CATTATTTATGTTTTCTGTGAGG - Intergenic
936980438 2:118259942-118259964 ACTCTTTGATGTTCTCTGTGTGG + Intergenic
941456895 2:165719898-165719920 TATTTTTTATATTCTCTGTGTGG - Intergenic
943807384 2:192138897-192138919 CAGCTATTATTTTCTCCCTGGGG + Intronic
944317591 2:198300158-198300180 CAGCCTTTTTGTTCTATGTAGGG + Intronic
944487919 2:200226004-200226026 CAGCTTTTTCCTTCTCTTTGAGG - Intergenic
945055419 2:205864582-205864604 AATCTTTTATGTTTTCTGAGTGG + Intergenic
948154132 2:235767672-235767694 CAGCTGCTGTGTTCCCTGTGGGG + Intronic
948437302 2:237962276-237962298 TAACTTTCATGTTCTCTGGGAGG - Intergenic
1170450819 20:16481694-16481716 CATCTTTTGTGATGTCTGTGTGG + Intronic
1174316551 20:49707213-49707235 GATGTTTTATGTTCTCTTTGTGG - Intronic
1174521573 20:51135016-51135038 CAGTTTTTATGGTTTCTCTGAGG + Intergenic
1174576384 20:51540818-51540840 CAGCTTTTATTTTCCTTGTCGGG - Intronic
1175004899 20:55671529-55671551 CGCCTTTGCTGTTCTCTGTGTGG - Intergenic
1176167505 20:63681783-63681805 CAGCCTGTGTCTTCTCTGTGCGG + Intronic
1178973120 21:37198805-37198827 CACTTTGTATGTTCTCTGAGGGG + Intronic
1183075708 22:35425615-35425637 CAGCTTTTGTTTTCTTGGTGGGG + Intergenic
1183590158 22:38775364-38775386 CAGCTTTGAAGCTCTCTGCGGGG - Intronic
1184012300 22:41758316-41758338 GTTCTTCTATGTTCTCTGTGTGG + Intronic
1184825964 22:46951153-46951175 CAGCTTTTCTTCTCTCTGGGAGG + Intronic
1185183293 22:49376606-49376628 GAGTTTTTATGTTATCTGTAAGG + Intergenic
949566052 3:5245883-5245905 CAGCTTGTCTGTGCTCTGGGTGG + Intergenic
950375610 3:12569788-12569810 GAACTTTCAGGTTCTCTGTGTGG + Intronic
951106581 3:18751046-18751068 CAGCTTTAATGTCCTGTGTATGG + Intergenic
952088788 3:29858932-29858954 CTGCTTTTATCGTCACTGTGGGG + Intronic
952750376 3:36820290-36820312 CAGCTTTTGTGTTCCCTCTGTGG - Intergenic
954524959 3:51261771-51261793 CAGCTTTTTTTTACACTGTGAGG - Intronic
954705820 3:52480007-52480029 CGGCCTCTCTGTTCTCTGTGGGG + Intronic
956073952 3:65484794-65484816 CAGCTTTGATCTAGTCTGTGGGG - Intronic
958856081 3:99387401-99387423 CTGCTTTTCTCTTCTCTGCGTGG + Intergenic
959147277 3:102564613-102564635 CAGCTTTCAGCTTCTCTCTGAGG - Intergenic
959575995 3:107934714-107934736 CAGATTTTATTTTCTCTTTCTGG + Intergenic
963343587 3:144067789-144067811 CATCTTTTATTTTATCTGTGTGG + Intergenic
964558184 3:157964105-157964127 CAGCTTTTCTGTTTTGTGGGGGG + Intergenic
966413155 3:179663900-179663922 CAGCTCAGATGTTCTTTGTGAGG + Intronic
967377310 3:188819254-188819276 CAGGTATTATGTTCACAGTGTGG - Intronic
969306191 4:6327514-6327536 CAGCTTTTATGTGCGTTTTGCGG - Intronic
971865440 4:32164605-32164627 TAGCTTTTGTGGTCTCTGTTAGG - Intergenic
973066538 4:45801334-45801356 CAGTTTTGATGTTCTGTGTTTGG + Intergenic
975253103 4:72202231-72202253 CAGCTTTTATTTTATATTTGGGG + Intergenic
975804128 4:78095353-78095375 CAGTTTTTATGAACTATGTGGGG - Intronic
978096407 4:104784332-104784354 TAGATTTTATCTTCTCTATGAGG - Intergenic
979189459 4:117838195-117838217 CAGTATTTATTTTCTCTGTTGGG - Intergenic
979646059 4:123070770-123070792 CACCTTGTTTGTTGTCTGTGAGG - Intronic
980213138 4:129815260-129815282 CATCTGTTGTGTTCTCTCTGTGG - Intergenic
980701303 4:136434856-136434878 CTCCTTTTTTCTTCTCTGTGAGG + Intergenic
982574360 4:157090006-157090028 CTGCTTTTATGGTCTCTGTCAGG + Intronic
986225196 5:5805884-5805906 CAGCTTTAATGTCCTCATTGAGG + Intergenic
986546095 5:8898815-8898837 CAGATTTTTAGTTCTCTATGTGG - Intergenic
986583786 5:9293498-9293520 CAGCTTTTATACTCACTGTATGG + Intronic
987813827 5:22874593-22874615 AAGCTTCTATGTTTTCTGTCAGG + Intergenic
987871967 5:23631116-23631138 AAGCTTTTATTTTATTTGTGTGG + Intergenic
994595876 5:101834269-101834291 CAACTTTTATTTTATGTGTGGGG + Intergenic
994804757 5:104430724-104430746 CATATTTTATGTTTTCTGTTTGG + Intergenic
994836016 5:104853421-104853443 CTGTTTTAATGTTCTTTGTGTGG - Intergenic
994977734 5:106831631-106831653 CATCTTTTGTGCTATCTGTGTGG + Intergenic
996506456 5:124273153-124273175 CAGCTGTAATTTTCTCTCTGAGG + Intergenic
997135712 5:131322938-131322960 CAGCATTTATTTTCTGTGTGTGG + Intronic
997325797 5:133019979-133020001 CATCTTTTATGTTCTCTTTTTGG - Intronic
998015083 5:138725362-138725384 CAGTTTTTCTATTCTCTGAGGGG + Intronic
1000412857 5:160951806-160951828 CAGCTTTTATATTTTATATGGGG + Intergenic
1001649431 5:173304933-173304955 CAGCTTTTGGGTTCTCTGCAGGG - Intergenic
1003848539 6:10198646-10198668 CTGTTTTTAAGCTCTCTGTGAGG - Intronic
1007646927 6:43390105-43390127 ATGCTTTTATGTCCTCTCTGGGG - Intergenic
1007920157 6:45600246-45600268 CAGCTTTTTTTTTCTATGTATGG - Intronic
1008709432 6:54206556-54206578 ACCCTTTTATGTTCTCTGTGAGG - Intronic
1009827209 6:68882059-68882081 AAGCTTTTATGTTCTCTTAAAGG + Intronic
1011149653 6:84256450-84256472 TAGATTTTGTGTTCTCTATGAGG - Intergenic
1011562338 6:88633225-88633247 CACCTTTTATGTATTCAGTGGGG - Intronic
1015492449 6:133841389-133841411 CAGCTTTTATGCTGGCTCTGAGG + Intergenic
1017359773 6:153554115-153554137 CAGCTTTCCTGTTCTTTGTAGGG + Intergenic
1017480477 6:154849132-154849154 CAGCTTGAATTTTCTCTGTTTGG + Intronic
1018895218 6:168011771-168011793 CAGCTTTTCTCTTCTCTTTCTGG + Intronic
1019840158 7:3433827-3433849 CGGCTTGTATGTACTCTGTAAGG - Intronic
1020450293 7:8314429-8314451 CAGGTTTTCTGTTTTCTGTGGGG + Intergenic
1020569091 7:9835564-9835586 CATATTTGATGTTCTATGTGTGG + Intergenic
1020771475 7:12400932-12400954 CAGCTTTTATGCTATCTATGTGG - Intronic
1020940184 7:14523560-14523582 AAGCATTTATGTTTTATGTGTGG - Intronic
1023695018 7:42836860-42836882 CAGCTTTTCACTTCTGTGTGAGG - Intergenic
1024359516 7:48454271-48454293 CAGCTTTTCTGTCCACTGGGTGG - Intronic
1024850587 7:53711314-53711336 CAACTTTTATGTTATCAGTAAGG + Intergenic
1025065008 7:55846517-55846539 CACTTTTAATATTCTCTGTGTGG - Exonic
1026042948 7:66884013-66884035 CAGCTGGTATACTCTCTGTGAGG - Intergenic
1027462808 7:78476686-78476708 AAGATTTTATGTGCTCTTTGTGG - Intronic
1028032819 7:85938322-85938344 CAGCTTTGATTTGCTCTGTAAGG - Intergenic
1028101008 7:86820760-86820782 AATCTTTTATGTTCCCTGAGAGG + Intronic
1031297149 7:120015065-120015087 CAGTTTTTCTGTTCTTTCTGAGG - Intergenic
1031793503 7:126140226-126140248 CAGCTTTGGTGATCTCTTTGTGG - Intergenic
1032071549 7:128810797-128810819 CACCTTTGGTGTTCTCTATGAGG + Intronic
1033563336 7:142555013-142555035 CAGCTTCTATGAGTTCTGTGGGG - Intergenic
1036895712 8:12633201-12633223 CAGTTTCTCTGTTCTATGTGTGG - Intergenic
1037551895 8:19982501-19982523 CAGATTTTGTGTCCACTGTGTGG - Intergenic
1037793769 8:21973274-21973296 CAAAATTTATGTACTCTGTGGGG - Intronic
1038142728 8:24864132-24864154 CAGCTTCAAATTTCTCTGTGAGG - Intergenic
1039965252 8:42279244-42279266 GAGCGTGTATGTTCTCTGTTGGG + Intronic
1041307520 8:56477973-56477995 CTGCTTTAATATTCTGTGTGGGG - Intergenic
1041675846 8:60538664-60538686 CAGCTTCTATGGTGTGTGTGTGG + Intronic
1042302668 8:67302452-67302474 CCGCTTTTATTTCCTCTGAGGGG + Exonic
1046882141 8:119320691-119320713 CAGCTTTTAAGGTTTCTCTGGGG - Intergenic
1049787799 8:144459390-144459412 CAGCTTTTATGTTCTCTGTGTGG - Intronic
1050737487 9:8780576-8780598 GTGCTTTTATTCTCTCTGTGAGG + Intronic
1050827538 9:9967546-9967568 CATCTTTTATGGTCACTGTAAGG - Intronic
1052023999 9:23555229-23555251 TAGATTTTATGTGCTCTTTGAGG - Intergenic
1052136872 9:24922882-24922904 CAGCTTATATTTTCTTTGAGTGG + Intergenic
1052145784 9:25046265-25046287 CAGCAATTAAGTTCTCTGAGTGG - Intergenic
1052249491 9:26380647-26380669 CATCTTTTATATTCTCTGAGGGG - Intergenic
1053540047 9:38964044-38964066 CAGCTTTTCAGTTTTCTCTGGGG + Intergenic
1053804397 9:41786201-41786223 CAGCTTTTCAGTTTTCTCTGGGG + Intergenic
1054140886 9:61529261-61529283 CAGCTTTTCAGTTTTCTCTGGGG - Intergenic
1054192703 9:61997692-61997714 CAGCTTTTCAGTTTTCTCTGGGG + Intergenic
1054626094 9:67399875-67399897 CAGCTTTTCAGTTTTCTCTGGGG - Intergenic
1054645702 9:67590999-67591021 CAGCTTTTCAGTTTTCTCTGGGG - Intergenic
1054821699 9:69528117-69528139 GTCCTTTTATTTTCTCTGTGAGG - Intronic
1054928894 9:70616207-70616229 CAGTTGTTATATGCTCTGTGGGG + Intronic
1056304830 9:85279762-85279784 CAGGGTTTGTGTTCTCTGTGGGG - Intergenic
1056622318 9:88224649-88224671 CAGCTTTACTCCTCTCTGTGAGG - Intergenic
1059517882 9:114912790-114912812 CAGCTTTTATTGTTTCTTTGGGG + Intronic
1061533666 9:131234213-131234235 CAGCCTTTATATTCTGTATGTGG + Exonic
1062645239 9:137544406-137544428 CAGCTTCCCTGTCCTCTGTGGGG + Intronic
1187620080 X:21042775-21042797 CAACTTTTATGTTTTCAGTGAGG - Intergenic
1188820398 X:34767836-34767858 CCTCTTTTGTGTTCACTGTGTGG - Intergenic
1189135484 X:38544945-38544967 CAGGCTTTACTTTCTCTGTGTGG + Intronic
1193960737 X:87922366-87922388 CAGGTTTTATGTTATTTGTATGG + Intergenic
1195318154 X:103698953-103698975 CAGATATCATGTTTTCTGTGAGG - Intergenic
1195674433 X:107497070-107497092 CAGCTTGTGTGCTCTCTCTGCGG - Intergenic
1196928380 X:120656599-120656621 CAGCTTTCATCTGCTCTGTGGGG - Intergenic
1196967629 X:121076019-121076041 CAGCTTTTAGTTTCTCCCTGAGG - Intergenic
1197984590 X:132254120-132254142 AAGCTTTTAGATTCTCTGTTTGG - Intergenic
1198809003 X:140516375-140516397 TAGCTTTTATATTTTCTCTGAGG + Intergenic
1199717256 X:150515549-150515571 CAGCCTTGAGGTTCCCTGTGTGG - Intergenic
1201630112 Y:16062403-16062425 CAGCTTGCATGTTTTCAGTGAGG - Intergenic
1202067583 Y:20956751-20956773 CAGCCTTTGTGTTTTATGTGGGG + Intergenic
1202597954 Y:26563145-26563167 CAGGTTTTATGTTGGGTGTGTGG + Intergenic