ID: 1049787806

View in Genome Browser
Species Human (GRCh38)
Location 8:144459440-144459462
Sequence ACCTGACGTGAGGCAGGACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049787798_1049787806 28 Left 1049787798 8:144459389-144459411 CCCACACAGAGAACATAAAAGCT 0: 1
1: 1
2: 0
3: 28
4: 272
Right 1049787806 8:144459440-144459462 ACCTGACGTGAGGCAGGACTCGG No data
1049787799_1049787806 27 Left 1049787799 8:144459390-144459412 CCACACAGAGAACATAAAAGCTG 0: 1
1: 0
2: 1
3: 24
4: 237
Right 1049787806 8:144459440-144459462 ACCTGACGTGAGGCAGGACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049787806 Original CRISPR ACCTGACGTGAGGCAGGACT CGG Intronic
No off target data available for this crispr