ID: 1049788578

View in Genome Browser
Species Human (GRCh38)
Location 8:144462777-144462799
Sequence GGCCGGGCCCACTGAGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049788578_1049788592 21 Left 1049788578 8:144462777-144462799 CCGCCGCCTCAGTGGGCCCGGCC 0: 1
1: 0
2: 1
3: 31
4: 255
Right 1049788592 8:144462821-144462843 CGCGGCCACCGACCCCGGCACGG 0: 1
1: 0
2: 1
3: 10
4: 127
1049788578_1049788585 3 Left 1049788578 8:144462777-144462799 CCGCCGCCTCAGTGGGCCCGGCC 0: 1
1: 0
2: 1
3: 31
4: 255
Right 1049788585 8:144462803-144462825 GCGTAGCCCCACAGCCGCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 76
1049788578_1049788589 16 Left 1049788578 8:144462777-144462799 CCGCCGCCTCAGTGGGCCCGGCC 0: 1
1: 0
2: 1
3: 31
4: 255
Right 1049788589 8:144462816-144462838 GCCGCCGCGGCCACCGACCCCGG 0: 1
1: 0
2: 4
3: 64
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049788578 Original CRISPR GGCCGGGCCCACTGAGGCGG CGG (reversed) Intronic
900364324 1:2304706-2304728 AGGCAGGCCCACTGAGGTGGAGG - Intronic
900406424 1:2495055-2495077 GGCAGGGCCCACTGGGGCACTGG - Intronic
900584463 1:3425793-3425815 GGCAGGCCCCACAGAGGGGGAGG + Intronic
901109928 1:6785851-6785873 GACCGGGCCCAGCGAGGAGGAGG + Intronic
901279917 1:8026129-8026151 GGCCTGGCGCGCTGAGGGGGTGG - Intronic
901627061 1:10630434-10630456 GGCCGGGCCCAGGGAGGGAGGGG - Exonic
901641944 1:10697057-10697079 GGCAGGGCCCACTCAGCCTGTGG - Intronic
904822945 1:33256814-33256836 GGCCCGGCCCAGAGCGGCGGCGG + Intronic
904830978 1:33306711-33306733 GGCCGGGCCGGCTGGGCCGGCGG + Intergenic
905351046 1:37346670-37346692 GGCAGGACCCACTGAGAAGGTGG + Intergenic
905867115 1:41382398-41382420 GGGCGGGCCCCCGAAGGCGGCGG - Exonic
906282401 1:44563298-44563320 GGCAGGGCCCCCTGAGCTGGTGG + Intronic
906719991 1:47997424-47997446 GGCTGGGGCCGCTGGGGCGGGGG + Intergenic
907247271 1:53116175-53116197 GGCAGGGCCCTCACAGGCGGTGG - Intronic
910450146 1:87335541-87335563 CGCCGGGCTCACTGCGGCTGCGG - Intronic
912381454 1:109250036-109250058 GGCCGGGTCAACGGCGGCGGCGG - Exonic
916192468 1:162192610-162192632 GGCAGTGCCCACTGAGGCACAGG - Intronic
916913149 1:169373901-169373923 GTTCAGGCCCACTGAGGCTGAGG - Intronic
917846667 1:179025955-179025977 GGCCGGAGCCGCTGTGGCGGCGG + Exonic
919742639 1:200990105-200990127 GGCTGGGCCTGCTGGGGCGGAGG - Intronic
919914829 1:202132890-202132912 GGCTGGGCCCACAGAGCCTGGGG - Exonic
923042920 1:230332767-230332789 GGCCGAGCCCACCGCTGCGGTGG - Intronic
923713248 1:236403786-236403808 GGCCTGGCTCACAGAGGCTGCGG - Intronic
924953481 1:248906554-248906576 GGCCGGGCCGGCTGAGCGGGAGG + Intronic
1062774754 10:135642-135664 GGCCGCGGCCTCTGGGGCGGCGG + Intronic
1069913187 10:71772175-71772197 GGCCTGGGCCTCTGAGGAGGAGG - Intronic
1073288633 10:102402662-102402684 GGCAAGGCCCACTGAAGCGGGGG + Exonic
1074169717 10:110919948-110919970 GGCCGGGCCTGCGGCGGCGGCGG + Intronic
1075207131 10:120457382-120457404 GGCAGGGCGCACTGACGCGGGGG + Intronic
1075801824 10:125159329-125159351 GGCCGGGCTCCCGGCGGCGGCGG + Intronic
1076610999 10:131725877-131725899 TGCAGGGCCCACAGAGGTGGAGG + Intergenic
1077011064 11:379606-379628 GTCGGGGCGCACGGAGGCGGCGG - Exonic
1077026315 11:441569-441591 GGGCCTGCCCACCGAGGCGGGGG - Intronic
1077074675 11:694966-694988 GGCCGCGGCCGCTGTGGCGGCGG - Exonic
1077194595 11:1272774-1272796 GGCCGGGCCCAGGGATCCGGGGG + Intergenic
1077349582 11:2086274-2086296 GGCTGGGCCCAGTCAGGAGGAGG - Intergenic
1077405368 11:2380145-2380167 GGCTGGGCTCTCTGAGGCAGAGG - Intronic
1080616333 11:33947868-33947890 GGCAGGGCCTCCGGAGGCGGAGG - Intergenic
1083048286 11:59755494-59755516 GGCCGGGCCCGCCGGGGCGAAGG - Exonic
1083232557 11:61332637-61332659 GGGCGGGCCCAGTGAGACAGAGG - Intronic
1083571589 11:63764449-63764471 GCCCGGGCCCGCAGAGGAGGAGG - Exonic
1083670986 11:64299854-64299876 GGCCGGGGCCAGGGAGGAGGCGG - Exonic
1083992833 11:66257613-66257635 GGGCGGGGCCATCGAGGCGGGGG - Intronic
1085011122 11:73142290-73142312 GGCCGGGCCGCCTGAGTGGGTGG - Intergenic
1089617248 11:119701849-119701871 GGCGGGAGCCAGTGAGGCGGAGG - Intronic
1090764507 11:129865085-129865107 GGCCCAACCCACTGAGGCTGTGG + Exonic
1090784060 11:130032987-130033009 GGCCAGCCCCACTGTGGCTGGGG + Intergenic
1091197511 11:133744596-133744618 GGCCGGGCCCACTCAAGCCATGG - Intergenic
1091201890 11:133787559-133787581 AGCCGGGGCCGCTGATGCGGGGG - Intergenic
1091792554 12:3280226-3280248 GGCCCTGCCCACTGGGGTGGGGG - Intronic
1092169339 12:6363522-6363544 CGACGGGCCCCGTGAGGCGGGGG + Exonic
1092370899 12:7915941-7915963 GGACTGGCGCACGGAGGCGGTGG - Intergenic
1092849272 12:12612104-12612126 GGCCAGGCCGGCTGAGCCGGGGG + Exonic
1096255575 12:50059983-50060005 AGCCTGGCCCACAGAGGAGGAGG + Intronic
1096475756 12:51907740-51907762 GGAAGGGCCCACTGAAGCGGGGG - Intronic
1096516265 12:52157211-52157233 TTCCGGGCCCAATGAGCCGGAGG + Intergenic
1096616032 12:52834103-52834125 GGCGGGGCCCACTGTGGCCCCGG - Exonic
1096732556 12:53626150-53626172 GGACGGGGGCGCTGAGGCGGTGG - Intronic
1096783878 12:54006224-54006246 GGCCGGGCCGGCCGAGGCGCGGG - Intronic
1097399715 12:59114192-59114214 GGGAGGGCACACTGAGGCAGTGG - Intergenic
1101692313 12:107093557-107093579 GGCCGAGGCCGCTGACGCGGCGG - Exonic
1102911437 12:116717537-116717559 GGCCGGGCTCACGGTGGTGGTGG - Exonic
1103120110 12:118372954-118372976 GGGCGGGCGGACTGAGACGGTGG - Intergenic
1103749541 12:123150105-123150127 GGCAGTGCACACTGGGGCGGGGG + Intergenic
1103906474 12:124330186-124330208 GGCCTGGCCCAGTGGGGCTGAGG - Intronic
1104568299 12:129903956-129903978 GGCCGGGCGGGCCGAGGCGGCGG - Intergenic
1104932603 12:132347717-132347739 AGCCGGGGCCAGGGAGGCGGAGG + Intergenic
1105405738 13:20131231-20131253 GGCCAGGCCCATTAAGGCTGCGG + Intergenic
1105917816 13:24933289-24933311 GGCTGGGCCCCCAGAGGCAGAGG + Intergenic
1107448120 13:40486134-40486156 GGGAGGGCCCACTGAGGGTGGGG - Intergenic
1108541829 13:51452808-51452830 GGACGGGACCCCCGAGGCGGGGG - Exonic
1112051127 13:95644467-95644489 GGCCGGGCCCGCGGAGGCCGAGG + Intronic
1113709655 13:112455032-112455054 AGCCAGGCCCACTGAGGCAGGGG + Intergenic
1113709675 13:112455091-112455113 CGCCAGGCCCACTGAGCTGGGGG + Intergenic
1113781361 13:112979425-112979447 GGCCGGGCACTCTGAGGAGGTGG + Intronic
1114483207 14:23047946-23047968 GGCCCGGCCCACCGCGGGGGGGG - Exonic
1118627670 14:67674363-67674385 GGCGGGGACCGGTGAGGCGGGGG - Exonic
1118841988 14:69520288-69520310 GGCAGAGCCCACTGAGGAGAGGG + Intronic
1122121197 14:99554367-99554389 GGGCGGGCACACTCAGGCGGAGG - Intronic
1122270766 14:100567682-100567704 GGCCCGGGCCGCTGCGGCGGGGG - Intronic
1122299230 14:100722661-100722683 GGCTGAGCACACTGAGGCTGGGG - Intergenic
1122418366 14:101560951-101560973 AGCCGGGGCCACCGAAGCGGCGG + Intergenic
1125728928 15:41882217-41882239 GGCGGGGCCCGGCGAGGCGGGGG - Intronic
1126034925 15:44537038-44537060 GGCCACGCCCCCTCAGGCGGCGG - Exonic
1126473858 15:49046240-49046262 GGCTGGGCCCGCCGAGCCGGGGG - Intronic
1127911492 15:63419839-63419861 GCCCAGGCCCACTGAGGCCCAGG + Intergenic
1128184203 15:65630487-65630509 GGCAGGACCCACAGAGGCAGGGG - Intronic
1129424786 15:75455273-75455295 GGCGGGGCCCACTGAGCTCGCGG - Intronic
1132457913 16:34217-34239 TGCTGGGCCCACTGTGGGGGTGG + Intergenic
1132490726 16:229203-229225 CGCCGGGCGGCCTGAGGCGGGGG - Intronic
1132597706 16:760858-760880 GGCAGGGCCCACTGAGACCTGGG + Intronic
1132932968 16:2468123-2468145 GGCCGGGCGCAGGGAGCCGGGGG + Intergenic
1132947102 16:2537857-2537879 GGCGGAGCCCACTAAGGCCGCGG + Intergenic
1132968588 16:2673546-2673568 GGCGGGGCCCACTCAGACCGCGG - Intergenic
1132987494 16:2775461-2775483 GGCCAGCCCCACTGTGGCTGGGG + Exonic
1133021740 16:2969896-2969918 GGCCGGGGGCACTGAGGCCGAGG + Intronic
1133049124 16:3106673-3106695 GGGCGGGGCCACTGAGGCTGCGG + Intergenic
1138298877 16:55910034-55910056 TGTCGGGCTCACTGAGGCTGAGG - Intronic
1139961903 16:70722710-70722732 GGCAGGGCCCAAGGAGGCAGAGG + Intronic
1140860116 16:79010798-79010820 GGCAGAGCACACTGGGGCGGGGG + Intronic
1141188827 16:81808818-81808840 GGCCAGGCCCACAGAGGCTATGG - Intronic
1141663156 16:85452612-85452634 GCCTGGGCCCACTGGGGCAGGGG - Intergenic
1142850659 17:2703265-2703287 GGGAGGGCCCACGGAGGCAGAGG - Intronic
1143623211 17:8093014-8093036 GGTTGGGACCACTGAGGCCGAGG + Intergenic
1144110003 17:12021467-12021489 AGCGGGGCCCACTGCGGCGGCGG - Intronic
1145066021 17:19761962-19761984 GCCCGGGCTCACTGAGGCCGAGG - Intergenic
1146454293 17:32997113-32997135 GGCTGGGCCCACGGAGGAGAGGG + Intronic
1147440278 17:40443478-40443500 GGCCCGGCCCAGGCAGGCGGCGG - Exonic
1147581939 17:41631942-41631964 AGATGGGCCCACTGAGGCAGAGG - Intergenic
1148664099 17:49361921-49361943 GGCCGGGGCGGCGGAGGCGGAGG - Intronic
1150211943 17:63446482-63446504 GGCCGGGCTCACGGTGGCCGCGG - Intergenic
1150423173 17:65056607-65056629 GGAGGGGCCCGCCGAGGCGGCGG - Exonic
1151413821 17:73948453-73948475 GGGTGGGCCCACTGGGGCAGTGG + Intergenic
1151539527 17:74758052-74758074 GGCTGGGCCCAATGGGGCGTTGG + Intronic
1152287732 17:79422383-79422405 GGCCGGGCACAGGGAGGCAGTGG - Intronic
1152630144 17:81407247-81407269 GGCTGGGCTCCCTGAAGCGGAGG + Intronic
1153474967 18:5489114-5489136 GGCCGAGCCCCAGGAGGCGGCGG - Exonic
1154125693 18:11689983-11690005 CGCCGGGCCCGCGGGGGCGGCGG + Intronic
1155362316 18:25015793-25015815 GGACAAGCCCACTGAGGCTGGGG - Intergenic
1158938259 18:62384588-62384610 CTCCAGGCCCACTGAGGCGGAGG - Intronic
1160834283 19:1117268-1117290 GGCCGGGCCTGCAGGGGCGGAGG - Intronic
1160919391 19:1512813-1512835 GGCAGGGCCCATTGAGGAGGGGG - Intronic
1161028767 19:2048501-2048523 GGAGGGGCCCACAGAGGTGGCGG + Intronic
1161207176 19:3047184-3047206 GGCCGCGCCTAATGAGGCGGAGG - Intronic
1161257973 19:3320344-3320366 CGCCGGGCACACAGAGGGGGAGG - Intergenic
1161495706 19:4584656-4584678 GGCCGGGGAAACTGAGGCGGGGG - Intergenic
1161513203 19:4683063-4683085 GACCCGGCCCTCTGCGGCGGCGG - Intronic
1161547582 19:4891103-4891125 GGCAGAGTCCACTGAGGCGCTGG + Exonic
1161981595 19:7633021-7633043 GGCCAGGGCCCCTGGGGCGGGGG - Intronic
1162395512 19:10416433-10416455 GGCCGGGCGCAGAGAGACGGCGG - Intronic
1162441718 19:10696376-10696398 GGCTGGGCTCACTGAGACGGTGG - Intergenic
1162760491 19:12885774-12885796 GGCTGGGCCCACGAAGGCGTCGG + Exonic
1163248428 19:16111558-16111580 GGCCGGGCCGCCCGAGTCGGGGG + Intergenic
1163329578 19:16627980-16628002 GGGCGGGCGGGCTGAGGCGGGGG + Exonic
1165784470 19:38453057-38453079 GGGCGGGACCACTGAGGGGCGGG + Intronic
1166133786 19:40763172-40763194 GGGCAGGCCCCCTGAGGAGGTGG + Intronic
1166799973 19:45450868-45450890 GGGCGGGCGCACGGAGACGGCGG - Intronic
1166806862 19:45492813-45492835 GGCCAGGTCGCCTGAGGCGGGGG + Intronic
1166862340 19:45817676-45817698 GGCCGGGCACACAGCGGTGGAGG + Intronic
1166942548 19:46375565-46375587 GGGCGTGCACACTGAGGCTGAGG - Intronic
1166965450 19:46527089-46527111 GGGCGTGCACACTGAGGCCGAGG + Intronic
1167134371 19:47608495-47608517 GGGCGCGTCCCCTGAGGCGGAGG - Intronic
1167358150 19:49016484-49016506 GGCCAGACCCACAGAGGCAGCGG - Intronic
1167359645 19:49023374-49023396 GGCCAGACCCACAGAGGCAGCGG - Intronic
1167361486 19:49032711-49032733 GGCCAGACCCACAGAGGCAGCGG + Intronic
1167362168 19:49036074-49036096 GGCCAGACCCACAGAGGCAGCGG - Intronic
1167363916 19:49044784-49044806 GGCCAGACCCACAGAGGCAGCGG + Intronic
1167364582 19:49048143-49048165 GGCCAGACCCACAGAGGCAGCGG - Intronic
1167365867 19:49054779-49054801 GGCCAGACCCACAGAGGCAGCGG - Intronic
1167421149 19:49404146-49404168 GCCCAGGCCCACTGAGACAGAGG + Intronic
1167455443 19:49595161-49595183 GGCAGGGCCCGCTCAGGCGGCGG - Exonic
1167456070 19:49597227-49597249 GGCCGGGCCACCTGAGGACGAGG + Exonic
1168705336 19:58467387-58467409 GGCCGGGGAGACTGAGGCGCGGG + Exonic
1168721082 19:58555387-58555409 GGGTGGGCCCACCGAGGAGGAGG - Intergenic
925142847 2:1561860-1561882 TGCGGGGCCCACAGAAGCGGCGG - Intergenic
927714045 2:25341431-25341453 GGCCGGGGCCCCTGCGGCAGCGG + Intronic
928364583 2:30691374-30691396 GGCTAGGCCCCCTGAGGGGGAGG + Intergenic
929452938 2:42048497-42048519 GGCCGGGCCCAAGGGGGCCGGGG - Exonic
930762403 2:55050399-55050421 GGCTGGGCCGACTGAGCCGAGGG + Exonic
932298547 2:70646628-70646650 GGCAGGGCCCTCTGAGGCACAGG - Intronic
933708751 2:85309991-85310013 GTTCGGGCCCACTGAGGGAGGGG - Exonic
934921233 2:98346865-98346887 GGCCGAGCCCGCTGAGCCGTCGG + Intronic
936071709 2:109375620-109375642 GCCCTGGCCCACTGGGGAGGAGG - Intronic
936104697 2:109614324-109614346 GGCGCGGCCCAGTGAGGCGGTGG + Exonic
937237982 2:120442145-120442167 GGCCGGCCCCAGGGAGGCCGCGG + Intergenic
939385189 2:141486912-141486934 GGCCGGGACCACAGAGGCCCTGG - Intronic
939969637 2:148644876-148644898 GGCCGGGGGCAGTGAGGAGGAGG + Intronic
941308373 2:163898287-163898309 GGAGGTGCCCACTGAGGTGGTGG - Intergenic
941979039 2:171434567-171434589 GGTCGGGCCCATGGAGGCGCGGG - Exonic
943571512 2:189580779-189580801 GGCCCGGCCCACGGCGGCGGCGG - Exonic
944221599 2:197309977-197309999 GGCCGGTCCCTCTGAGGAGGAGG - Intronic
946167672 2:217875248-217875270 GGTCAGGCCCACTGAGAAGGTGG + Intronic
946400769 2:219467265-219467287 GGCGGGGCCCACTGACGTGGAGG + Exonic
947793571 2:232880880-232880902 GGCTGGGCCCACTGCGAAGGAGG + Intronic
949046111 2:241873407-241873429 GGGCGGGGCCTCAGAGGCGGGGG - Exonic
1168802745 20:653520-653542 GGCCGGGCCGACTTAGGCCGCGG + Intronic
1170904298 20:20498570-20498592 AGCCGGGCCCACTGAGGAGCAGG - Intronic
1170908483 20:20539204-20539226 GGACTGCCCCACTGAGGCAGTGG - Intronic
1172474451 20:35226646-35226668 GGCGGGGCGCGCGGAGGCGGGGG + Exonic
1174176707 20:48650051-48650073 GGACCTGCCCACTGAGGGGGTGG + Exonic
1174399736 20:50269622-50269644 GGCCTGGCCCACTGGGTGGGTGG - Intergenic
1174494728 20:50931305-50931327 GACCGGGCCGGCGGAGGCGGCGG + Intergenic
1175311027 20:58011653-58011675 GGCCGGGGCCCCTGAGGAGGTGG + Intergenic
1175934316 20:62508074-62508096 GGCGGAGCCCAGTGAGGTGGGGG + Intergenic
1175997116 20:62816924-62816946 AGCCGGGCCCACCTGGGCGGGGG - Intronic
1176053879 20:63134654-63134676 GGCAGGGCCCAGAGAGGAGGCGG + Intergenic
1176053945 20:63134796-63134818 GGCAGGGCCCAGAGAGGAGGCGG + Intergenic
1176054057 20:63135043-63135065 GGCAGGGCCCAGAGAGGAGGCGG + Intergenic
1176054142 20:63135255-63135277 GGCAGGGCCCAGAGAGGAGGCGG + Intergenic
1176054183 20:63135343-63135365 GGCAGGGCCCAGAGAGGAGGCGG + Intergenic
1176054272 20:63135538-63135560 GGCAGGGCCCAGAGAGGAGGCGG + Intergenic
1176299314 21:5091084-5091106 GGCCTCTCCCACTGAGGCAGCGG + Intergenic
1178351114 21:31873565-31873587 GGCTGGGCCCAGGGCGGCGGCGG + Exonic
1179784050 21:43719685-43719707 GACCGGGCCAACTGCCGCGGGGG + Intronic
1179857712 21:44170863-44170885 GGCCTCTCCCACTGAGGCAGCGG - Intergenic
1179967944 21:44817794-44817816 GGGCGGGCCCACTTAGGGGCGGG + Intronic
1180172624 21:46067700-46067722 GGCCAGGCCCACTGAGGTGGAGG + Intergenic
1181273437 22:21674026-21674048 GGCAGGGCCCACGGAGGGCGGGG + Intronic
1181514438 22:23402903-23402925 GGCCTGGCCCACTGCGGCCCGGG - Intergenic
1181634206 22:24166893-24166915 GGCAGGGCCCACTGAGCCCATGG + Exonic
1181734965 22:24874442-24874464 GGCAGGGCCCACAGAGACGGAGG - Exonic
1183472641 22:38017644-38017666 GGAGGGGCCCTCTGAGGCTGTGG + Intronic
1184034057 22:41910259-41910281 GGCGGGGCCCGCTGGGGCGAGGG + Intronic
1184070763 22:42144811-42144833 GGCCGGGTCCACTGAGACCCTGG - Intergenic
1185326691 22:50229078-50229100 TGCCGGGCCCACTGGGGAGCAGG + Intronic
950471601 3:13189801-13189823 GGGAAGGCCCACTGAGGTGGTGG - Intergenic
950759224 3:15206116-15206138 GGCCGGGCCCACGCAGGAGCCGG - Intergenic
951558802 3:23945826-23945848 GGCCGGGCCATGTGAGGGGGGGG - Intronic
954117174 3:48473363-48473385 GTTGGGGCCCACTGAGGCTGGGG - Intronic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
954699708 3:52444931-52444953 GGCGGGGCACACTGGGGCCGGGG + Exonic
960988415 3:123295289-123295311 GGCCGGGCCAAGAGAGGCAGAGG + Intronic
961640564 3:128362189-128362211 TGCCTGGCACACTGAGGCAGAGG - Intronic
961664649 3:128488060-128488082 GGCCGGCCCCCCTCAGCCGGCGG + Intronic
962715802 3:138124944-138124966 GGCCAGGCCCAGAGAGGCTGGGG + Intronic
964771291 3:160226125-160226147 GGCCGGGGCCGGGGAGGCGGCGG + Exonic
968498567 4:932483-932505 GGCCGGGCTGACTCAAGCGGAGG + Exonic
968511356 4:997297-997319 GGCCGGGCCCGCTGGGCTGGGGG - Intronic
968544809 4:1193411-1193433 GGTGGGGCCCACTGAGACTGGGG - Intronic
969530299 4:7726732-7726754 GGCCTGGCCGAGTGAGGCAGCGG - Intronic
969912118 4:10456939-10456961 CGCCGGGGCGACCGAGGCGGGGG - Intronic
970394816 4:15655302-15655324 GGCCGCGGCTGCTGAGGCGGAGG - Exonic
974009708 4:56595368-56595390 GGTTGAGCCCACTGAGTCGGAGG + Intronic
975613175 4:76221248-76221270 GGCCAGGACCAGTGAGGCAGTGG - Intronic
976297318 4:83485146-83485168 GGCGGGGCCCAGCGAGGAGGCGG + Exonic
982493750 4:156063977-156063999 GGCTGTGCCCACTGAGGCTGTGG + Intergenic
983577186 4:169271520-169271542 GGCTGGGTCCGCGGAGGCGGCGG + Intergenic
984844927 4:184100882-184100904 GGTCGGGGCCACAGAGGTGGAGG + Intronic
985532665 5:443182-443204 GGCCGGGACCCCGGAGGCGGAGG + Exonic
985628897 5:1004864-1004886 GGCTGCGCCCGCTGAGGTGGAGG + Intergenic
985644104 5:1077061-1077083 GGTCGGGGAAACTGAGGCGGGGG - Intronic
985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG + Intergenic
992763186 5:79969901-79969923 GGCTGGGACCACTGGGGCTGGGG - Intergenic
997644150 5:135469037-135469059 GGCTGGGCCCAAGGAGGTGGGGG - Intergenic
998036851 5:138924746-138924768 GGCCTGCCTCACTGAGGCTGCGG - Intronic
998200429 5:140114115-140114137 GGCTGAGGCGACTGAGGCGGCGG + Exonic
999241365 5:150129728-150129750 GTCAGGGGCCACTGAGGCTGGGG + Intronic
1001732536 5:173971092-173971114 GGCCGGGCACAGTGAGCCAGGGG + Intergenic
1002638471 5:180619475-180619497 TGCCGGCCCCACTGAGGCAGAGG + Intronic
1002712458 5:181203733-181203755 GGCCCTGCTCACTGAGGGGGAGG + Intronic
1002928472 6:1618562-1618584 GGCAGGGCCTAGAGAGGCGGAGG + Intergenic
1006313512 6:33277547-33277569 GGGCGGCCCCGGTGAGGCGGGGG - Exonic
1006368140 6:33628054-33628076 AGCTTGGCCCACTGGGGCGGTGG + Intronic
1006785063 6:36660874-36660896 GGCCACGCCCACCGAGGGGGAGG - Intergenic
1011506342 6:88048023-88048045 GGCCTGGCCCACGAAGGCGAGGG + Exonic
1013917143 6:115354439-115354461 GGCCGGGAGCAGTGAGGCTGAGG + Intergenic
1016388710 6:143553870-143553892 GGCAGGCCCCACTGAGAAGGTGG + Intronic
1017810765 6:157981936-157981958 GGTCGGGCCCACTGCGGGCGGGG - Exonic
1017992907 6:159506018-159506040 GGCTGGGCCCACTGCTGTGGGGG - Intergenic
1019294655 7:267334-267356 GGCCGGGCTGAGGGAGGCGGTGG - Intergenic
1019381536 7:726774-726796 GGCCGAGACGGCTGAGGCGGTGG + Exonic
1019496250 7:1341822-1341844 GGCAGGCCCCACTGAGGCCTGGG + Intergenic
1022018597 7:26376783-26376805 GGCCGGGCCCCATGGGGCCGGGG - Intergenic
1024084960 7:45885181-45885203 GGTCAGGCCAACTGAGGCTGAGG + Intergenic
1024533328 7:50410556-50410578 GGCAGTGCCCACTGAGGGTGGGG - Intergenic
1025198593 7:56949108-56949130 GGCCGGGCCGAGGGAAGCGGTGG - Intergenic
1025673359 7:63627828-63627850 GGCCGGGCCGAGGGAAGCGGTGG + Intergenic
1031899289 7:127392273-127392295 GGCCGAGACGACTGCGGCGGCGG + Exonic
1034522629 7:151632329-151632351 GGCCGCGCCACCTGCGGCGGCGG - Intronic
1034866020 7:154642784-154642806 GGCCGGGCTTAGTGAGGCTGAGG + Intronic
1035337959 7:158142215-158142237 GTCTGAGCCCACAGAGGCGGAGG - Intronic
1035640792 8:1183586-1183608 GCCCGGGGCCACAGAGGCGGAGG + Intergenic
1038429859 8:27491326-27491348 GCCCCGACCCACTGCGGCGGCGG - Intronic
1041068533 8:54104366-54104388 GGGCGGGCCCACAGTGCCGGGGG - Intergenic
1047608684 8:126499539-126499561 GGCAGGGACCACTTAGGAGGTGG - Intergenic
1049194515 8:141308107-141308129 GGCCGGGGCCGCGGGGGCGGCGG + Intronic
1049684038 8:143932126-143932148 GGCCCGGCCCACGGTGGAGGTGG - Exonic
1049788578 8:144462777-144462799 GGCCGGGCCCACTGAGGCGGCGG - Intronic
1049930009 9:447018-447040 GGGCAGCCCCAGTGAGGCGGTGG + Intronic
1050524765 9:6536168-6536190 GGTGGAGCCCACTGAGTCGGAGG - Exonic
1052852177 9:33385068-33385090 GGCAGGGCTCACAGAGACGGGGG + Exonic
1053455636 9:38231319-38231341 GGCAGGGCCTAGTGAGGCAGGGG - Intergenic
1055308276 9:74952502-74952524 GGCCGGATCCAGAGAGGCGGTGG + Exonic
1056739839 9:89244970-89244992 GGCAGGGCCAACTGAGGCCACGG + Intergenic
1060593281 9:124832841-124832863 GGCCAGGACCCCTGAGGAGGTGG - Intergenic
1060661884 9:125409307-125409329 GGCCGGGCCGATTTAGGGGGTGG + Intergenic
1060794422 9:126504513-126504535 GGCCGTCCCCGCTGAGGCAGAGG - Exonic
1061450469 9:130664599-130664621 GGCCGGGCCGACGGGGGAGGTGG - Exonic
1061492918 9:130956197-130956219 GGCCGCCCCCACTGAGGAGGGGG + Intergenic
1202779769 9_KI270717v1_random:24098-24120 GGCGGGGGCCACGGCGGCGGGGG + Intergenic
1203772815 EBV:58112-58134 GGCCGGGGCCGCGGAGGCCGGGG + Intergenic
1203772822 EBV:58127-58149 GGCCGGGGCCGCGGAGGCCGGGG + Intergenic
1203772829 EBV:58142-58164 GGCCGGGGCCGCGGAGGCCGGGG + Intergenic
1203772836 EBV:58157-58179 GGCCGGGGCCGCGGAGGCCGGGG + Intergenic
1203772843 EBV:58172-58194 GGCCGGGGCCGCGGAGGCCGGGG + Intergenic
1203772849 EBV:58187-58209 GGCCGGGGCCGCAGAGGCCGGGG + Intergenic
1203772855 EBV:58202-58224 GGCCGGGGCCGCAGAGGCCGGGG + Intergenic
1195269450 X:103215527-103215549 GGGCGGGGCGGCTGAGGCGGGGG + Intronic