ID: 1049788648 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:144463004-144463026 |
| Sequence | CCGCCCCTGCAGAAGGTGGG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1049788637_1049788648 | 6 | Left | 1049788637 | 8:144462975-144462997 | CCAATGGGAGAGCGAGGGCCCCC | 0: 1 1: 0 2: 0 3: 6 4: 105 |
||
| Right | 1049788648 | 8:144463004-144463026 | CCGCCCCTGCAGAAGGTGGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1049788648 | Original CRISPR | CCGCCCCTGCAGAAGGTGGG CGG | Intronic | ||
| No off target data available for this crispr | |||||