ID: 1049788648

View in Genome Browser
Species Human (GRCh38)
Location 8:144463004-144463026
Sequence CCGCCCCTGCAGAAGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049788637_1049788648 6 Left 1049788637 8:144462975-144462997 CCAATGGGAGAGCGAGGGCCCCC 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049788648 Original CRISPR CCGCCCCTGCAGAAGGTGGG CGG Intronic
No off target data available for this crispr