ID: 1049788793

View in Genome Browser
Species Human (GRCh38)
Location 8:144463571-144463593
Sequence GCCTGGCAGGTGGCCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 356}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049788793_1049788806 22 Left 1049788793 8:144463571-144463593 CCCCAGAGGGCCACCTGCCAGGC 0: 1
1: 0
2: 0
3: 38
4: 356
Right 1049788806 8:144463616-144463638 CACCATGTCCCTGGAGAGTAAGG No data
1049788793_1049788811 30 Left 1049788793 8:144463571-144463593 CCCCAGAGGGCCACCTGCCAGGC 0: 1
1: 0
2: 0
3: 38
4: 356
Right 1049788811 8:144463624-144463646 CCCTGGAGAGTAAGGGCCCAGGG No data
1049788793_1049788809 29 Left 1049788793 8:144463571-144463593 CCCCAGAGGGCCACCTGCCAGGC 0: 1
1: 0
2: 0
3: 38
4: 356
Right 1049788809 8:144463623-144463645 TCCCTGGAGAGTAAGGGCCCAGG No data
1049788793_1049788807 23 Left 1049788793 8:144463571-144463593 CCCCAGAGGGCCACCTGCCAGGC 0: 1
1: 0
2: 0
3: 38
4: 356
Right 1049788807 8:144463617-144463639 ACCATGTCCCTGGAGAGTAAGGG No data
1049788793_1049788804 13 Left 1049788793 8:144463571-144463593 CCCCAGAGGGCCACCTGCCAGGC 0: 1
1: 0
2: 0
3: 38
4: 356
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788793_1049788801 -6 Left 1049788793 8:144463571-144463593 CCCCAGAGGGCCACCTGCCAGGC 0: 1
1: 0
2: 0
3: 38
4: 356
Right 1049788801 8:144463588-144463610 CCAGGCCAGGCCAGGATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049788793 Original CRISPR GCCTGGCAGGTGGCCCTCTG GGG (reversed) Intronic
900205138 1:1428219-1428241 GCCCGGCAGGCAGCCCTCAGAGG + Intergenic
900321562 1:2086916-2086938 GCATGGCAGGAGGCATTCTGAGG - Intronic
900415076 1:2531056-2531078 AGCTGGCAGGTGTCCCTCAGGGG + Intergenic
900579777 1:3403261-3403283 GCCTAGGAGGTGGCTTTCTGGGG - Intronic
900605431 1:3521601-3521623 GCCTGGGAGGTGGCCCCCAGGGG + Intronic
901875881 1:12166951-12166973 GCCTGGCCTCTGGCCCGCTGGGG + Intergenic
901921082 1:12538164-12538186 CCCTGGGAGGCTGCCCTCTGTGG - Intergenic
902374327 1:16023202-16023224 GCCTGGGAGCTGGCCCTCACTGG - Intronic
902379284 1:16045079-16045101 GCCTGGGAGCTGGCCCTCACTGG - Intronic
902970509 1:20044786-20044808 GCCTGGCAGGGTGCGATCTGAGG + Intronic
903278435 1:22236348-22236370 GCCTGGCAGGTGGACCCTGGAGG - Intergenic
903534194 1:24055906-24055928 GCCTGGAAGGTGAGCCGCTGGGG + Intergenic
904366128 1:30011980-30012002 GCCTGGCCGGGTGCCCTTTGGGG - Intergenic
905240619 1:36578668-36578690 GCCTGCCGCGTGGGCCTCTGTGG - Intergenic
905769254 1:40626716-40626738 TCCTGGCAGGTGATCGTCTGGGG - Exonic
905796952 1:40821140-40821162 CCCTGGGAGCTGGCCTTCTGAGG + Intronic
907865455 1:58395572-58395594 TCCCTGCATGTGGCCCTCTGAGG - Intronic
908354398 1:63316955-63316977 GCCTGGGAGGCCGCGCTCTGTGG + Intergenic
910362129 1:86423613-86423635 TCCTGGCAGTTGGCCCTCTCTGG + Intergenic
910657511 1:89633363-89633385 ACCGAGCGGGTGGCCCTCTGCGG - Intronic
915941567 1:160121503-160121525 CCCTGCCTGGAGGCCCTCTGGGG - Intronic
916520759 1:165561499-165561521 GCCTGGCTTGAGGACCTCTGTGG - Intronic
917458432 1:175205790-175205812 GGCTGGCAGGAGGACCTGTGGGG + Intergenic
919851173 1:201674052-201674074 GCCTGGCAGGTGGCCAGCCCAGG + Intronic
920039187 1:203084905-203084927 GCCTGGAAGCAGGGCCTCTGGGG - Intronic
920436553 1:205950544-205950566 GCCTGGGATGTGACCATCTGGGG + Intergenic
920679094 1:208059183-208059205 GTCTGCCAGGAGGACCTCTGTGG + Intronic
922539510 1:226408192-226408214 GCCTGCCGGGTGGAGCTCTGCGG + Intergenic
922765210 1:228152847-228152869 TCCTGGCTGGTGGCCTCCTGTGG + Intronic
922831438 1:228556471-228556493 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922831916 1:228608425-228608447 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922832477 1:228610666-228610688 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922833037 1:228612907-228612929 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922833598 1:228615148-228615170 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922834157 1:228617389-228617411 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922834715 1:228619630-228619652 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922835266 1:228621845-228621867 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922835825 1:228624065-228624087 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922836384 1:228626307-228626329 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922836942 1:228628546-228628568 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922837501 1:228630788-228630810 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922838062 1:228633029-228633051 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922838620 1:228635269-228635291 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922839178 1:228637494-228637516 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922840299 1:228641966-228641988 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922840859 1:228644207-228644229 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922841422 1:228646438-228646460 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
923338038 1:232986644-232986666 GCCTTGCAGGTGGTGCACTGAGG - Intronic
924185658 1:241486944-241486966 GCCAGGCATGTTGCACTCTGTGG + Intergenic
1062877794 10:956013-956035 GCCTGCCAGGTGCCCCACAGAGG + Intergenic
1063159334 10:3408299-3408321 GCCTTGCAGGGGGTCCTGTGGGG + Intergenic
1063159370 10:3408399-3408421 GCCTTGCAGGGGGTCCTGTGGGG + Intergenic
1063208486 10:3857192-3857214 GCCTTGCAGGAGACCCTCAGAGG - Intergenic
1063660953 10:8034864-8034886 TCCCGGCAGGTGGCTTTCTGCGG + Intergenic
1065458252 10:25930395-25930417 GCCTGGGTGGTGACCCTCTCAGG - Intergenic
1067048574 10:42999573-42999595 GCCAGGCAGGTGGTGCACTGTGG - Intergenic
1068442030 10:57069210-57069232 CCCTGGCAGTTGTTCCTCTGGGG + Intergenic
1069744470 10:70706354-70706376 GCCTGGCAGGGAGGGCTCTGAGG + Intronic
1069772962 10:70911057-70911079 GCCTGAGAGGTGTCCTTCTGCGG - Intergenic
1069830069 10:71277523-71277545 GCCTGGCAGGGAGGCCTCAGTGG + Intronic
1070114741 10:73517423-73517445 GCCTTGCAGCTTACCCTCTGGGG + Exonic
1070568149 10:77619641-77619663 GCCTGGCAGGTGGTCCTAGAGGG - Intronic
1070785683 10:79160990-79161012 GCCTGGCTGGTGGGCTTCTCTGG - Intronic
1070817614 10:79335316-79335338 GACTGGCAGGTGGCCCAGTCTGG + Intergenic
1071447234 10:85759899-85759921 GCATGGCAGGATGCCCTCAGAGG - Intronic
1071997691 10:91163370-91163392 GACTGGAAGGCGCCCCTCTGGGG - Intronic
1072032820 10:91537602-91537624 GACTGGCAGGTGGCACTCACTGG + Intergenic
1072070345 10:91909152-91909174 GCCTGCGAGGAGACCCTCTGAGG + Intronic
1072682590 10:97517614-97517636 CACTGCCCGGTGGCCCTCTGCGG + Intronic
1072782292 10:98259142-98259164 ACCTGGCAGTTGGCCATGTGGGG + Exonic
1073044355 10:100628057-100628079 GCCCGGCAGATGGGCCTGTGTGG - Intergenic
1073248170 10:102106167-102106189 GCCAGACAGGTGGCCCTCCTGGG - Intergenic
1073434638 10:103508761-103508783 TCCTGGCGGGCTGCCCTCTGAGG - Intronic
1073434898 10:103510487-103510509 GCTTGGCATGTGGCTCTGTGGGG + Intronic
1075310845 10:121412411-121412433 GCTGGGCAGTTGCCCCTCTGGGG - Intergenic
1075321661 10:121496002-121496024 GTTTGGCGGGTGACCCTCTGTGG - Intronic
1075536705 10:123277606-123277628 GCCTGGGATGAGGCCCTGTGGGG - Intergenic
1075844583 10:125535147-125535169 AGGGGGCAGGTGGCCCTCTGTGG + Intergenic
1075866042 10:125719925-125719947 CCCTGGCAGGTCCCCCTCCGCGG - Intronic
1077142604 11:1031096-1031118 GCAGGGCAGGGGGGCCTCTGAGG - Intronic
1077150521 11:1071106-1071128 CCCTGGCAGGTGAGCATCTGAGG - Intergenic
1077231834 11:1461225-1461247 GCCTGCCTGGTGGCCTTCTGGGG + Exonic
1077539773 11:3141004-3141026 GCCTGGCAGGTAGGACCCTGGGG + Intronic
1078686108 11:13534047-13534069 ATCTGGCGGGTGCCCCTCTGGGG - Intergenic
1079518010 11:21290605-21290627 ATATGGCAGGTGCCCCTCTGGGG + Intronic
1080559827 11:33452753-33452775 GCCTGTCAGGTGTTTCTCTGAGG + Intergenic
1083603118 11:63961247-63961269 GCCTGGCAGGTGGGCCACACGGG + Intergenic
1083736263 11:64683081-64683103 GCCAGGGAGATGGCCTTCTGGGG - Intronic
1083876123 11:65525212-65525234 CCCGGGCAGGCCGCCCTCTGGGG - Exonic
1083897202 11:65625831-65625853 CTGTGCCAGGTGGCCCTCTGTGG + Intronic
1083938839 11:65884333-65884355 TCCTGGCAGGTGGCAGGCTGGGG + Intronic
1084459215 11:69286892-69286914 GCCTGGCTGGTGGAGCCCTGGGG + Intergenic
1084890195 11:72232985-72233007 GCCTGGTAGGTGGTGATCTGAGG + Intronic
1085204335 11:74721481-74721503 GCCTGGCAGGAGGCCTCCAGTGG + Intronic
1087078455 11:94147662-94147684 GCCTCGCAGGTTCCCTTCTGAGG + Intronic
1087277746 11:96177220-96177242 CACTGGCAGGAGGCCCTTTGAGG + Intronic
1088905647 11:114153740-114153762 GCCTACCAGGTGGTCCTCTAAGG - Intronic
1089286455 11:117410956-117410978 CCTGGGCAGGTGGACCTCTGAGG + Intronic
1091037423 11:132246240-132246262 GCCTGCCCGGTGGCCCACGGAGG + Intronic
1092117645 12:6020750-6020772 GCCTGGGAAGTGTCCCCCTGCGG + Intronic
1092206005 12:6614384-6614406 GACTGGCCTGTTGCCCTCTGGGG - Intergenic
1092936257 12:13367000-13367022 GGCAGGCAGCAGGCCCTCTGAGG + Intergenic
1094488823 12:30945908-30945930 GCCTGGAAGAAGGCCCGCTGAGG + Intronic
1095300644 12:40580633-40580655 GCTTGGCAAGTGGGCCTGTGTGG - Intergenic
1096215748 12:49796684-49796706 GCCTGGCCTGTGGGCCTCTGGGG + Exonic
1096685912 12:53288206-53288228 GCCTGGTCACTGGCCCTCTGGGG - Exonic
1096843349 12:54391815-54391837 GCCTGGGGGCTGGGCCTCTGAGG + Intergenic
1100240549 12:92706824-92706846 GCCTGGCAGGTGACCACCTGGGG + Exonic
1100338979 12:93660042-93660064 GCCTGGCACCTGGCCCTGGGAGG - Intergenic
1101152361 12:101894861-101894883 GCCTGGCATGTGGCTGTCTGAGG + Intronic
1102547576 12:113667700-113667722 GCCTGGCAGCTGGGACTCAGAGG - Intergenic
1103888973 12:124224277-124224299 GCCTGGAAGGTGGCCCGCAGAGG + Intronic
1104771966 12:131369234-131369256 GCCTGGCAGGGCTGCCTCTGGGG - Intergenic
1104918707 12:132279486-132279508 GCCTGGCAGGAAGCCCACAGCGG - Intronic
1106136632 13:26978498-26978520 GCAGGGCAGGGAGCCCTCTGAGG - Intergenic
1106547797 13:30745375-30745397 GCCTGGCCCCTTGCCCTCTGTGG + Intronic
1106603737 13:31208938-31208960 GCCGGGCAGGGACCCCTCTGAGG - Intronic
1108498005 13:51044142-51044164 GGCTGACAGGTGACCCTCTGGGG + Intergenic
1109883923 13:68517588-68517610 GCCTGGCATGTGGCCACCTCAGG + Intergenic
1110389793 13:74960219-74960241 ATCTGGCAGGTTCCCCTCTGGGG + Intergenic
1112652495 13:101415573-101415595 GCCTGGCTGGGATCCCTCTGGGG - Intronic
1119434573 14:74589650-74589672 GCCTGGCAGGTGGTCAGGTGGGG - Intronic
1122249560 14:100428286-100428308 GGGAGGCAGGTGGCCCTGTGGGG + Intronic
1122401880 14:101472212-101472234 GCCTGCCTTGGGGCCCTCTGGGG + Intergenic
1122640675 14:103157230-103157252 GCCTTGCGGGAGGCTCTCTGGGG + Intergenic
1122863165 14:104591607-104591629 GGCTGGCAGGTGCCCATCGGGGG - Intronic
1202841625 14_GL000009v2_random:126283-126305 GCAGGGCAGGGAGCCCTCTGTGG - Intergenic
1202911013 14_GL000194v1_random:116515-116537 GCAGGGCAGGGAGCCCTCTGTGG - Intergenic
1123783592 15:23647521-23647543 GGCGGGCAGCTGGCCCTGTGGGG + Exonic
1124965957 15:34433936-34433958 GCCGGCCAGGTGGGCATCTGGGG + Intronic
1125503483 15:40253363-40253385 GGCAGGCAGGTGGCCCTCCTGGG + Intronic
1125722543 15:41852164-41852186 CCCAGGCAGGTGTCCCTATGGGG - Exonic
1129165414 15:73774452-73774474 GTGTGTCAGGTGGCCCACTGGGG + Intergenic
1129737502 15:77974377-77974399 GCCTGGCACGTGGTCATCTTGGG + Intergenic
1130915432 15:88300912-88300934 GCCTTGCAAGAGGCGCTCTGTGG + Intergenic
1131176312 15:90211725-90211747 GCCTTTCAGGAGGCTCTCTGGGG + Intronic
1132247889 15:100311347-100311369 GCCTGGCCCATGGCCTTCTGGGG + Intronic
1132567110 16:628625-628647 GCCGGGCTGGTGGGCCTTTGAGG - Exonic
1132569711 16:638730-638752 GCCAGGCCTGTGGCCCTCAGAGG - Intronic
1132870202 16:2112460-2112482 CCCCGGCAGGTGGACCTTTGGGG - Exonic
1132892244 16:2210081-2210103 CCCTGGCAGGTGTCGGTCTGGGG - Intronic
1133339090 16:5025301-5025323 CCCTGGCAGGTGGCCAGGTGAGG + Exonic
1134452281 16:14370902-14370924 GCCTGGAAGGGGGCCCTCCTGGG - Intergenic
1134522341 16:14924496-14924518 CCCCGGCAGGTGGACCTTTGGGG + Intronic
1134710011 16:16323147-16323169 CCCCGGCAGGTGGACCTTTGGGG + Intergenic
1134717226 16:16363147-16363169 CCCCGGCAGGTGGACCTTTGGGG + Intergenic
1134949592 16:18345498-18345520 CCCCGGCAGGTGGACCTTTGGGG - Intergenic
1134957525 16:18389012-18389034 CCCCGGCAGGTGGACCTTTGGGG - Intergenic
1137332540 16:47513559-47513581 GCACTGCTGGTGGCCCTCTGAGG - Intronic
1137485379 16:48886066-48886088 ACCTGGAATGTGGCCATCTGTGG + Intergenic
1139635845 16:68257961-68257983 GCCTGGCTGGGGGACCCCTGAGG - Intronic
1140460876 16:75138761-75138783 GCATGGCAGGCTGCCCCCTGCGG + Intergenic
1141119417 16:81340396-81340418 CACAGGCAGGTGCCCCTCTGGGG + Intronic
1141737211 16:85861636-85861658 GCCTGGGAGCTGTCCCTCAGGGG + Intergenic
1142033319 16:87849104-87849126 GACTGGCAAGTGGCCCTTTCCGG - Intronic
1142473991 17:179434-179456 GCCATGCAGAGGGCCCTCTGTGG + Intronic
1143543389 17:7582607-7582629 GCTTGGCAGGTGGCCCCGTGTGG - Intergenic
1143719462 17:8799414-8799436 TCCGGGCAGGTGGCCCGCGGAGG - Intergenic
1143731560 17:8885391-8885413 GCCTGGTAGGTGGGGCCCTGGGG - Intronic
1144682848 17:17206607-17206629 GCCTAGCGCGTGGCCCTCGGGGG - Intronic
1145199700 17:20932303-20932325 GCCTGGCTTTTGGACCTCTGTGG + Intergenic
1145255473 17:21319880-21319902 GCTTGGCAGGTGGCTCACTGGGG - Intergenic
1145317869 17:21745583-21745605 GCCTGGCAGGTGGAAGGCTGTGG - Intergenic
1145321139 17:21768072-21768094 GCTTGGCAGGTGGCTCACTGGGG + Intergenic
1146351550 17:32099269-32099291 GCACTGCAGTTGGCCCTCTGTGG - Intergenic
1146356978 17:32142601-32142623 GGCTGGCAGGTGGCGCCGTGGGG + Exonic
1146515074 17:33482789-33482811 GGCTGGCAAGTCGCCCTCTCAGG - Intronic
1147420568 17:40320329-40320351 GCCTGGCAGGAAGCCAGCTGTGG + Intronic
1148326969 17:46789027-46789049 ACCAGGCTGGTGGCTCTCTGAGG - Intronic
1148848362 17:50541937-50541959 GCCTGGCAGGCGGGCCTGTGGGG + Exonic
1150628471 17:66858958-66858980 CCCTGGAAGGTGGCCCTTGGAGG - Intronic
1151400127 17:73850514-73850536 CCCAGGCAGCTGGTCCTCTGAGG - Intergenic
1152377928 17:79928291-79928313 CCCTGGGAGGTGGTCCTGTGTGG + Intergenic
1152676820 17:81645460-81645482 GCCCTGGTGGTGGCCCTCTGGGG + Exonic
1152689209 17:81710333-81710355 GTCTTGCAGGTGGCCTTCGGAGG + Intergenic
1154378142 18:13825812-13825834 TCCTGAAAGGTTGCCCTCTGTGG - Exonic
1154420053 18:14221916-14221938 GGCTGGCAGGTGGCACTGTGGGG + Intergenic
1154529785 18:15331531-15331553 GCCTGGCAGCGGGCGCTCTCAGG - Intergenic
1159510878 18:69397190-69397212 GCCTGGAGGGTGACCATCTGAGG - Intergenic
1160559471 18:79747199-79747221 GCCTGGCAGCAGGCTCTCGGAGG + Intronic
1160872480 19:1283554-1283576 GCCTGGCAGGGGGGCCACTGTGG - Intergenic
1160884953 19:1341469-1341491 GCCACGCTGGTGGCCCTTTGCGG + Intergenic
1160951080 19:1667713-1667735 GCCTGTCAGGCCGCCCTCTTCGG - Intergenic
1161452689 19:4355184-4355206 ACCTGGGAGGTGGCATTCTGGGG + Intronic
1161456813 19:4373752-4373774 GGCTCTCAGGGGGCCCTCTGTGG - Intronic
1162702909 19:12531638-12531660 GCCTGGGTTGTGGCCTTCTGTGG - Intronic
1163325892 19:16603067-16603089 TCCTGGCAGGAGGACCTCTTAGG - Intronic
1163830934 19:19546877-19546899 CCCTGGCAGGGGAGCCTCTGGGG + Intergenic
1164720553 19:30428905-30428927 CCCTGTCAGGTGGGCCTCAGAGG + Intronic
1165262565 19:34633132-34633154 GCTTTCCATGTGGCCCTCTGTGG + Intronic
1165375644 19:35439820-35439842 GCCTTGGTGGTGGGCCTCTGTGG - Intergenic
1165539327 19:36478537-36478559 GCATGGGAGGCTGCCCTCTGGGG - Intronic
1165824346 19:38697259-38697281 GGATGGCAGGAGACCCTCTGCGG - Intronic
1166148369 19:40852439-40852461 GCCTGTCCTGTGGCCATCTGGGG - Intronic
1166152511 19:40884224-40884246 GCCTGTCCTGTGGCCATCTGGGG - Intronic
1166171383 19:41029748-41029770 GCCTGTCCTGTGGCCATCTGGGG - Intergenic
1166942143 19:46373710-46373732 CGCTGGAAGGTGGCCCTGTGAGG - Intronic
1167300114 19:48673148-48673170 GGCTGGCAGGGGTCCCTGTGGGG - Intergenic
1167650140 19:50724404-50724426 GCCGGCCAGGCGGCCCACTGCGG - Exonic
926143157 2:10380551-10380573 TGCAGGAAGGTGGCCCTCTGTGG - Intronic
926550436 2:14294645-14294667 CCCTTGCACCTGGCCCTCTGAGG + Intergenic
927468164 2:23352097-23352119 GCCTGGCCGGTTGCCCTGCGCGG + Intergenic
929571267 2:43024572-43024594 GCCTGGGAGGTGGCCCTGGTTGG + Intergenic
932051891 2:68405956-68405978 ATCTGGCAGGTGCCCCTCTAGGG + Intergenic
933724031 2:85416313-85416335 CCCTGCCATGTGGCCCTCTCTGG + Intronic
935540726 2:104345149-104345171 ACCTGCCAGGTGTCTCTCTGTGG - Intergenic
937246783 2:120498944-120498966 GCCTGGCAGGGGACACTGTGGGG - Intergenic
938528879 2:132162971-132162993 GCCTGGCAGCGGGCGCTCTCAGG - Intronic
938952234 2:136266127-136266149 ATCTGGCAGGTGCCCCTCTGGGG - Intergenic
942045681 2:172097982-172098004 ACCTGGCAGGCGGGGCTCTGTGG + Intergenic
943362029 2:186931409-186931431 GCCTGGCACGTGGGACTTTGGGG - Intergenic
947518986 2:230829395-230829417 GCCTGGCTGGTGGTGGTCTGGGG - Intergenic
948547055 2:238740196-238740218 TCATGGCAGGTGGACCTCCGAGG + Intergenic
948653924 2:239465156-239465178 GCCTGTGAGGCGGCCCTGTGGGG - Intergenic
948851858 2:240712197-240712219 CCCTGGCTGGTGGTTCTCTGAGG - Intergenic
948890622 2:240905423-240905445 TGCTGGCAGGAGTCCCTCTGGGG - Intergenic
949009889 2:241672375-241672397 GCACAGCGGGTGGCCCTCTGGGG - Exonic
949034923 2:241811932-241811954 TCCCGGCAGGGGGCCCTCGGCGG - Intronic
1170566926 20:17612807-17612829 GCTTGGCAGGTGGCCTGCTCTGG - Intergenic
1170574430 20:17651943-17651965 TCCTGCCAGGTCTCCCTCTGGGG + Intronic
1171958415 20:31476516-31476538 GCCAGGCTGGTGGCCCCGTGGGG - Exonic
1172055648 20:32152562-32152584 GCCTCTCACTTGGCCCTCTGTGG + Intronic
1173431801 20:42994548-42994570 GCCTGGCATCTGGCTCTCTAAGG - Intronic
1173845952 20:46188916-46188938 GGCTGGCAGGGAGCTCTCTGAGG + Intronic
1174216805 20:48921992-48922014 GCCTGCCAGGTGGCGCTCGGTGG + Exonic
1174321846 20:49748166-49748188 GCCTGGCAAGGTGCCCTGTGAGG + Intergenic
1174780115 20:53382035-53382057 TCCTTGCAGGTGGAGCTCTGAGG + Intronic
1175775235 20:61648935-61648957 ACCTCGCAGGTGGCCATCGGGGG + Intronic
1175775612 20:61651624-61651646 ACCTCGCAGGTGGCCATCGGGGG + Intronic
1176083623 20:63286052-63286074 TCCTGGCATGAGGCGCTCTGCGG + Intronic
1176094461 20:63333568-63333590 ACCTTGCAGGTGGCTCTCAGAGG - Intronic
1176630367 21:9131212-9131234 GCAGGGCAGGGAGCCCTCTGTGG - Intergenic
1176767626 21:13036941-13036963 GCCTGGCAGCGGGCGCTCTCAGG + Intergenic
1176853239 21:13937395-13937417 GGCTGGCAGGTGGCGCCGTGGGG - Intergenic
1177694655 21:24555598-24555620 ATCTGGCAGGTGCCCCTCTGGGG + Intergenic
1179494663 21:41764093-41764115 GCCTGCCAGGGGGCCCTCCTGGG - Intronic
1179523867 21:41962823-41962845 ACCTGGCAGAGGACCCTCTGTGG + Intergenic
1179562395 21:42223940-42223962 GCGTGGCAGCTGGCCTCCTGGGG + Intronic
1179821537 21:43940038-43940060 GCCACGCAGGTGGCACCCTGGGG + Intronic
1179824518 21:43956748-43956770 GCCTCCCAGGTGGCCCCCTCAGG + Intronic
1179951507 21:44711287-44711309 GACTGGCAGGTAGCACCCTGTGG - Intronic
1180176655 21:46093803-46093825 CTCTGGCAGGTGGCACGCTGGGG + Intergenic
1180226686 21:46397684-46397706 CCATGGGAGGTGGCCCTCAGAGG - Intronic
1180569079 22:16699163-16699185 GCCTGGGAAGTGTCCCCCTGTGG + Intergenic
1180876813 22:19178566-19178588 TCCTGGCAGGTGGGCCCCTCCGG - Exonic
1181049722 22:20232767-20232789 CCCTGGAAGGTGGCTCCCTGTGG + Intergenic
1181171740 22:21013950-21013972 GCAGGGCACGTAGCCCTCTGCGG - Intronic
1181695685 22:24591825-24591847 GGCTGGCAGGTTGCGGTCTGGGG - Intronic
1182022336 22:27091393-27091415 CCCTGGCAGATGGTCCTCTCTGG - Intergenic
1182962509 22:34488825-34488847 ACATGGCAGTTGGTCCTCTGGGG - Intergenic
1183546949 22:38459397-38459419 GCCAGGCAGGTGGACAGCTGGGG + Intergenic
1183949183 22:41343281-41343303 AGCTGGCAGGAGGCCCTCAGAGG + Intronic
1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG + Intergenic
1184109370 22:42385866-42385888 GCCTGGCACTTGGCCTTCTCTGG - Intronic
1184963159 22:47946364-47946386 GGCTGGGTGCTGGCCCTCTGTGG + Intergenic
1185231713 22:49687597-49687619 GCCTGGGAGGTGGCGCTCCGGGG - Intergenic
949505036 3:4719598-4719620 GCCTGCCCAGTGGCCCACTGAGG + Intronic
950053992 3:10011136-10011158 GCCTGGGAGGCGGAGCTCTGCGG - Intergenic
950680551 3:14582206-14582228 TCCTGGCAGGTATCCCACTGTGG + Intergenic
951839294 3:27016479-27016501 GGCTGGCAGATGGCCTACTGTGG + Intergenic
951847900 3:27104072-27104094 CCCTGCCATGTGGCCCTCTCCGG - Intergenic
951950378 3:28193807-28193829 GCCTAGCAGGTGGGGCTGTGGGG + Intergenic
952114958 3:30167921-30167943 ACCTGGAAGCTGCCCCTCTGTGG - Intergenic
952225030 3:31366402-31366424 TCCTGTCAGGTTGCCCTTTGGGG - Intergenic
953069220 3:39502820-39502842 GGCTGGCGCCTGGCCCTCTGAGG - Exonic
954137179 3:48587371-48587393 GGCTGGCAGTTGGGGCTCTGTGG - Intronic
955468202 3:59258177-59258199 TCCTGGCAGGTGTGGCTCTGGGG - Intergenic
955984818 3:64561545-64561567 GCCTGGCAGGTACCCCTTTGTGG + Intronic
959382155 3:105654083-105654105 GGCTGACAGGTGGCCTTCTTGGG + Intergenic
960149190 3:114232933-114232955 GTCAGGCAGGGGGCCCTCCGGGG - Intergenic
961017557 3:123479494-123479516 GCTGGGCAGCTGGCCCTCCGTGG - Intergenic
961355864 3:126339662-126339684 GCCTGGCAGGGGAACCTGTGAGG - Intergenic
961366331 3:126402140-126402162 GCCAGGCAGATGCCACTCTGAGG + Intronic
961430849 3:126881870-126881892 CCCTGGCAGGTGGCTCTGGGTGG + Intronic
961503503 3:127354886-127354908 GCAGGGCAGCTGGCCCCCTGAGG - Intergenic
961555591 3:127694869-127694891 ACCTGGGAGGTGGCCCTCGAGGG + Intronic
962990471 3:140573054-140573076 ACCTGGCAGGTGGCCTTCCTGGG - Exonic
964501687 3:157354995-157355017 GACTGGAAGTTGGCCCCCTGGGG - Intronic
964904917 3:161707837-161707859 ATCTGGCAGATGCCCCTCTGGGG + Intergenic
966355273 3:179072406-179072428 GTCTTGCAGGTGAGCCTCTGGGG - Intergenic
966561373 3:181324616-181324638 CTCTGGCAGGTGCCCTTCTGGGG - Intergenic
967971533 3:195003144-195003166 GCCTGGCAGTTGGGAGTCTGGGG + Intergenic
967994991 3:195159781-195159803 GCCGTGCATGTGGCCCTCTGTGG - Intronic
968120123 3:196120260-196120282 GCCTGGCCGCTGGCTCTGTGGGG - Intergenic
968555241 4:1243575-1243597 GCCCGGCAGGGGGCGCTTTGTGG - Intronic
968555659 4:1245366-1245388 GCCAGGAAGGTGGCGTTCTGGGG - Intronic
968755452 4:2413606-2413628 GCCTGGCACGTTTCTCTCTGAGG - Intronic
968814620 4:2815448-2815470 GCCTGGCTGCTGTCCCGCTGTGG - Intronic
968871820 4:3246291-3246313 TCCTGGAAGGTGCCCCTCAGTGG + Intronic
968962525 4:3752784-3752806 GCCTGGCAGGGAGGGCTCTGGGG + Intergenic
969600623 4:8173990-8174012 GCCTGGCAGAAGGGACTCTGGGG + Intergenic
970922157 4:21407235-21407257 GCCTGCCATGTGACTCTCTGTGG - Intronic
974748498 4:66106089-66106111 GGCTGCCACGTGGCCCTTTGGGG + Intergenic
974964468 4:68744485-68744507 CCCTGGCTTGTGGCACTCTGGGG - Intergenic
976048573 4:80983211-80983233 GCCTGGCAGGCAGCCCCCTGTGG + Intergenic
976744624 4:88390843-88390865 GCCGGGCAGCTGGCCCTCAGTGG + Exonic
979494821 4:121371488-121371510 GCCTGGAAGTTGGTCCACTGGGG + Intronic
980330305 4:131402963-131402985 ATCTGGCAGGTGCCCCTCTGGGG - Intergenic
981199741 4:141966459-141966481 TACGGGCAGGTGCCCCTCTGTGG + Intergenic
981304500 4:143232294-143232316 GCCTGGGAGATAGGCCTCTGTGG - Intergenic
982600538 4:157443627-157443649 CCCTGGCAGGTGGCCCTGCCTGG + Intergenic
985633882 5:1026709-1026731 GCCTGGCAGGTGGCTCAGGGAGG - Intronic
986267236 5:6201224-6201246 GCCTTGCTGGGGGCCCTGTGAGG + Intergenic
986585583 5:9313688-9313710 GCTTGGCTGGTGACCCTCTGAGG - Intronic
998108158 5:139481601-139481623 GCCTGCCTGGTGACCCTTTGGGG - Exonic
998139070 5:139689896-139689918 GCCTGGGAGGTGGCCACCTGGGG - Intergenic
999204340 5:149837221-149837243 GCCTTGAAGGTGGTCTTCTGGGG + Intronic
1001330661 5:170760198-170760220 GTCTGGCAGGGGCCCCTGTGGGG + Intergenic
1001459225 5:171894729-171894751 AACTGGCAGGTAGCCCACTGTGG + Intronic
1001643867 5:173265494-173265516 ACCTGGCAGGGGCCCCTCTGGGG + Intergenic
1002605766 5:180381837-180381859 GCCTGGCAGCTGTGTCTCTGTGG + Intergenic
1007073068 6:39050190-39050212 GCCTGGCTGGGGGCGCTGTGAGG - Intronic
1007125061 6:39418992-39419014 GCCTGGGAGATGGGTCTCTGTGG + Intronic
1007396989 6:41583520-41583542 GGCTGGCAGAGGGGCCTCTGAGG + Intronic
1007794637 6:44337637-44337659 GCCTGGGAGGTTGGCCTATGTGG - Intronic
1008886863 6:56440777-56440799 GGCTGGCAGGTGGACATCAGTGG + Intergenic
1009458839 6:63888400-63888422 ATCTGGCAGGTGCCCCTCTGGGG + Intronic
1010033012 6:71289218-71289240 GCTTGGCACTTGCCCCTCTGGGG - Intronic
1011065569 6:83321913-83321935 ATCTGGCAGGTGCCCCTCTTGGG + Intronic
1015883197 6:137890770-137890792 ATCTGGCGGGTGACCCTCTGGGG - Intergenic
1018143744 6:160864137-160864159 GACTGGCAGGAGGCCCGCTGGGG - Intergenic
1018886020 6:167938151-167938173 GGCTGGCAGGTGAGCCTCGGAGG + Intronic
1019718798 7:2555537-2555559 GCCTGGCAGGTGGCACTGTCCGG - Exonic
1023489160 7:40719478-40719500 CCCTGGCATGTGGCTCTCCGGGG - Intronic
1023806239 7:43875020-43875042 GCCTGGCAGGCTGCCTGCTGTGG - Intronic
1024984246 7:55181898-55181920 GCCTTGCAGGAGGCCCAGTGAGG + Intronic
1025731946 7:64115062-64115084 CCCTGGCAGGTGGCAGGCTGGGG + Intronic
1026406339 7:70070210-70070232 GCCAGCCTGGTGGCACTCTGGGG + Intronic
1026535959 7:71238718-71238740 GCCTGTCTGGTGGCCCCGTGGGG + Intronic
1028987703 7:97021245-97021267 GCCGGCCAGGGCGCCCTCTGGGG - Intronic
1029460349 7:100690816-100690838 GCCTGGCAGGGGGCAGTGTGAGG - Intergenic
1029732279 7:102446438-102446460 GCCTGGCAGGTGGCCCTGGTGGG + Intronic
1030523874 7:110630290-110630312 CCCAGGCATGTGGCCCTGTGTGG + Intergenic
1031777087 7:125918386-125918408 GCAAGGCAGGTGTCCCTGTGTGG - Intergenic
1032097312 7:128946049-128946071 GCCTCCCAGGTGGCCCACAGAGG - Intronic
1034335972 7:150323622-150323644 GCCCAGCAGGTGGCCCCCCGGGG - Intronic
1034356896 7:150458002-150458024 GCCAGGCATATGGCTCTCTGAGG - Intronic
1034452132 7:151142753-151142775 GCTTGGCAGTTGGCCCCTTGGGG + Intronic
1035231377 7:157468067-157468089 GCGTGGGAGGTGGCCCCATGCGG + Intergenic
1035604410 8:920228-920250 GCCAGGCAGGGGTGCCTCTGTGG - Intergenic
1036769798 8:11571187-11571209 GCCTGTCCAGTGGCCCTCAGGGG + Intergenic
1037220207 8:16509916-16509938 GCCTGGAAATTGGTCCTCTGAGG + Intronic
1038401520 8:27287941-27287963 GCCTGGGAGGTGGCCCTTGGGGG - Exonic
1041574809 8:59381599-59381621 ATCTGGCAGGTGCCCCTCTGAGG + Intergenic
1044940167 8:97334517-97334539 ATCTGGCAAGTGCCCCTCTGGGG - Intergenic
1045544084 8:103112460-103112482 GCCTTGCAGATGGTCCTTTGGGG - Intergenic
1048535659 8:135291824-135291846 GGCTTGCAGATGGCCCACTGTGG + Intergenic
1049504491 8:142988535-142988557 GCCTGCTGGGTGGCGCTCTGTGG - Intergenic
1049581557 8:143413574-143413596 GCCAGGCAGGTTGGCCTCAGAGG + Intergenic
1049604910 8:143524804-143524826 GGCTGGCAGGTGCCCTGCTGTGG - Intronic
1049674416 8:143883345-143883367 GCCTGGGACGTGTCCCCCTGGGG + Intergenic
1049787974 8:144460229-144460251 CCCTGGCTGGTGGCCCTCCCTGG - Intronic
1049788793 8:144463571-144463593 GCCTGGCAGGTGGCCCTCTGGGG - Intronic
1052329470 9:27252248-27252270 ATCTGGCAGGTGCCCCTCTGGGG + Intergenic
1053522076 9:38790687-38790709 GCCTGGCAGGAGGGCCTGTAAGG + Intergenic
1054194303 9:62015151-62015173 GCCTGGCAGGAGGGCCTGTAAGG + Intergenic
1054644104 9:67573539-67573561 GCCTGGCAGGAGGGCCTGTAAGG - Intergenic
1055477458 9:76677535-76677557 TGCTGGCAGCCGGCCCTCTGTGG + Intronic
1055957981 9:81792228-81792250 GGCTGGCAGGGTGTCCTCTGAGG + Intergenic
1055987067 9:82063024-82063046 GCCTGGTGGGAGGCCCTCGGGGG + Intergenic
1056235339 9:84588436-84588458 GCCTGGCAGGTGGACTTTTATGG + Intergenic
1056825106 9:89871898-89871920 ACCTGGCTGGTGGCTCCCTGTGG + Intergenic
1057139375 9:92717454-92717476 GCCTGGCAGGTGCCCACATGTGG - Intronic
1057482515 9:95456441-95456463 GGCGGGCAGGTCACCCTCTGGGG + Intronic
1057801947 9:98196149-98196171 GCCTGGCCTGTGGCCTCCTGGGG - Intergenic
1057846456 9:98530025-98530047 GCCTGGCAGATGGGCCTTGGGGG + Intronic
1057975835 9:99605182-99605204 CCCAGGCACGTGGACCTCTGGGG + Intergenic
1058887325 9:109331351-109331373 GCCTGGCAGGGGGCCCAGGGAGG + Intergenic
1060023968 9:120155523-120155545 GCCTTGCAGGTGCCTCTCAGTGG - Intergenic
1060114664 9:120930433-120930455 CCCTCCCAGGTGGGCCTCTGAGG - Intergenic
1060215719 9:121737207-121737229 CCATGGCAAGTCGCCCTCTGGGG - Intronic
1060820902 9:126661238-126661260 GCCTGGGAGGTCGCCCTGCGTGG - Intronic
1061036042 9:128114886-128114908 GACTGGCAGGTGGCACGCAGGGG + Intergenic
1061307955 9:129743236-129743258 GCCTCGGAGGGGCCCCTCTGCGG - Intronic
1061591790 9:131602727-131602749 GCCTGAGAGCTGGCCCTTTGGGG - Intronic
1061677631 9:132227428-132227450 GGCTGGCAGGTGGCCCCCATGGG + Intronic
1062157550 9:135061585-135061607 GGCTAGCGGGAGGCCCTCTGTGG - Intergenic
1062327132 9:136017768-136017790 ACTGGGCAGGTGGCCCTCTCAGG - Intronic
1062473696 9:136717569-136717591 GCCTGGGAGCCGGCCCTGTGGGG - Exonic
1062658126 9:137614629-137614651 GCCTGGCCGGGGGCTCACTGGGG - Exonic
1062686588 9:137816892-137816914 TCCTGGCATGTGGGCCTCTGAGG - Intronic
1203753198 Un_GL000218v1:98897-98919 GCAGGGCAGGGAGCCCTCTGTGG - Intergenic
1187728976 X:22234169-22234191 ATCTGGCAGGTGCCCCTCTGGGG - Intronic
1187729611 X:22238988-22239010 ATCTGGCAGGTGCCCCTCTGTGG + Intronic
1187969665 X:24647136-24647158 GCCTGGGAGGAGACTCTCTGAGG - Exonic
1189288749 X:39870543-39870565 GCCTGCAATGGGGCCCTCTGGGG - Intergenic
1190533859 X:51407389-51407411 GCGTGGCCAGTGGCCTTCTGGGG - Exonic
1191237970 X:58151378-58151400 TTCTGGCAGGTGCCCCTCTGGGG + Intergenic
1194374261 X:93112657-93112679 GCCTGGCAGGGCCCCCTTTGGGG - Intergenic
1196435676 X:115672334-115672356 ATCTGGCAGGTGCCCCTCTGGGG + Intergenic
1197804444 X:130385575-130385597 GGCTGGCAGGTCGCCATCTTTGG + Intergenic
1198749374 X:139923265-139923287 GCCTGTCAACTGGGCCTCTGGGG - Intronic
1200285916 X:154822199-154822221 GCCTGTCATGTGGCCTGCTGTGG - Intergenic
1200682288 Y:6226725-6226747 GCCTGGCAGGGCCCCCTTTGGGG - Intergenic
1201462346 Y:14240060-14240082 ATCTGGCATGTGCCCCTCTGGGG + Intergenic