ID: 1049788794

View in Genome Browser
Species Human (GRCh38)
Location 8:144463572-144463594
Sequence GGCCTGGCAGGTGGCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 659}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049788794_1049788807 22 Left 1049788794 8:144463572-144463594 CCCAGAGGGCCACCTGCCAGGCC 0: 1
1: 0
2: 1
3: 51
4: 659
Right 1049788807 8:144463617-144463639 ACCATGTCCCTGGAGAGTAAGGG No data
1049788794_1049788801 -7 Left 1049788794 8:144463572-144463594 CCCAGAGGGCCACCTGCCAGGCC 0: 1
1: 0
2: 1
3: 51
4: 659
Right 1049788801 8:144463588-144463610 CCAGGCCAGGCCAGGATATCTGG No data
1049788794_1049788806 21 Left 1049788794 8:144463572-144463594 CCCAGAGGGCCACCTGCCAGGCC 0: 1
1: 0
2: 1
3: 51
4: 659
Right 1049788806 8:144463616-144463638 CACCATGTCCCTGGAGAGTAAGG No data
1049788794_1049788809 28 Left 1049788794 8:144463572-144463594 CCCAGAGGGCCACCTGCCAGGCC 0: 1
1: 0
2: 1
3: 51
4: 659
Right 1049788809 8:144463623-144463645 TCCCTGGAGAGTAAGGGCCCAGG No data
1049788794_1049788811 29 Left 1049788794 8:144463572-144463594 CCCAGAGGGCCACCTGCCAGGCC 0: 1
1: 0
2: 1
3: 51
4: 659
Right 1049788811 8:144463624-144463646 CCCTGGAGAGTAAGGGCCCAGGG No data
1049788794_1049788804 12 Left 1049788794 8:144463572-144463594 CCCAGAGGGCCACCTGCCAGGCC 0: 1
1: 0
2: 1
3: 51
4: 659
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049788794 Original CRISPR GGCCTGGCAGGTGGCCCTCT GGG (reversed) Intronic
900415075 1:2531055-2531077 GAGCTGGCAGGTGTCCCTCAGGG + Intergenic
900584870 1:3427951-3427973 GGCCTGGCCTGTGGCGCTCATGG - Intronic
900605430 1:3521600-3521622 TGCCTGGGAGGTGGCCCCCAGGG + Intronic
902141502 1:14360818-14360840 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
902286905 1:15412942-15412964 GGCCAGGAAGCTGGACCTCTAGG + Intronic
902377050 1:16034850-16034872 GGCCTGGCTGTTGCTCCTCTGGG + Intergenic
902382224 1:16058109-16058131 GGCCTGGCTGTTGCTCCTCTGGG + Exonic
902809006 1:18877769-18877791 GGCCTGGCCCGTGGGTCTCTGGG - Intronic
903885287 1:26537417-26537439 TGCCTGGCATGTGGCACTCATGG + Intronic
904181555 1:28669403-28669425 CGCCTGGGAGGAGACCCTCTCGG + Intronic
904366129 1:30011981-30012003 GGCCTGGCCGGGTGCCCTTTGGG - Intergenic
904606635 1:31701498-31701520 GGCCTTGCTGGGTGCCCTCTGGG - Intronic
904677171 1:32205663-32205685 GGCCTGGCAGTTGGCGCCCATGG + Exonic
904858542 1:33518056-33518078 GGTTTGGCTGGTGGCCCACTTGG + Intronic
904995704 1:34629766-34629788 ACGATGGCAGGTGGCCCTCTTGG - Intergenic
905107785 1:35574344-35574366 GGCCTGGCAGACGCACCTCTCGG + Exonic
907403421 1:54239607-54239629 AGCCTGGCAGGGTGGCCTCTGGG - Intronic
908270742 1:62419985-62420007 TGCCTGGCAAGTGTACCTCTGGG - Intergenic
908598190 1:65710925-65710947 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
909403381 1:75258787-75258809 CATCTGGCAGGTGCCCCTCTGGG + Intronic
909536346 1:76741030-76741052 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
909874429 1:80784306-80784328 CATCTGGCAGGTGCCCCTCTCGG + Intergenic
910177290 1:84443832-84443854 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
910799615 1:91131986-91132008 CATCTGGCAGGTGACCCTCTGGG + Intergenic
910940700 1:92530548-92530570 CATCTGGCAGGTGCCCCTCTGGG + Intronic
911270741 1:95797985-95798007 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
911632743 1:100200667-100200689 CATCTGGCAGGTGCCCCTCTGGG + Intronic
911938502 1:104011557-104011579 CATCTGGCAGGTGCCCCTCTTGG - Intergenic
912270945 1:108208824-108208846 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
912559261 1:110538435-110538457 GGACTCCCAGGTGGCCCCCTCGG - Intergenic
913506980 1:119526258-119526280 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
914195267 1:145445265-145445287 GGCCAGGCAGGTTGGGCTCTCGG - Intergenic
915217022 1:154347221-154347243 AGCCTGCCATGTGGCTCTCTGGG + Intronic
915320668 1:155054401-155054423 GGCCTGGCAGGTGGAGATCTTGG - Exonic
915941569 1:160121504-160121526 GCCCTGCCTGGAGGCCCTCTGGG - Intronic
917584893 1:176416545-176416567 CACCTGGCAGGTGCCCCTCTGGG - Intergenic
917731732 1:177881359-177881381 GGCCCTGCAGGAGGCACTCTGGG + Intergenic
917900712 1:179540572-179540594 CATCTGGCAGGTGCCCCTCTGGG - Intronic
918167156 1:181961312-181961334 CGGCTGGCAAGTGCCCCTCTGGG - Intergenic
918360306 1:183750941-183750963 CACCTGGCAGGTGCCCCTCTGGG - Intronic
919601985 1:199633604-199633626 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
920039188 1:203084906-203084928 GGCCTGGAAGCAGGGCCTCTGGG - Intronic
920944400 1:210515013-210515035 GCTCTGGCAGGAGGCCCTTTTGG + Intronic
921541633 1:216423422-216423444 GGTCTGCTTGGTGGCCCTCTTGG + Intergenic
921738208 1:218653149-218653171 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
922077918 1:222266283-222266305 TGGCTGGCAGGTGGACCACTAGG - Intergenic
922406148 1:225315815-225315837 CATCTGGCAGGTGCCCCTCTTGG - Intronic
922905104 1:229168367-229168389 GGCTGGGCAGGTGCCACTCTCGG + Intergenic
923066880 1:230526644-230526666 CACCTGGCGGGTGCCCCTCTGGG - Intergenic
923081318 1:230658431-230658453 CATCTGGCAGGTGCCCCTCTGGG - Intronic
923690822 1:236191705-236191727 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1063159333 10:3408298-3408320 GGCCTTGCAGGGGGTCCTGTGGG + Intergenic
1063159369 10:3408398-3408420 GGCCTTGCAGGGGGTCCTGTGGG + Intergenic
1065075918 10:22079669-22079691 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1065761062 10:28983720-28983742 GGATTAGCACGTGGCCCTCTTGG + Intergenic
1066041904 10:31556959-31556981 GGCCTGGAGGTTGGCCATCTAGG - Intergenic
1066597284 10:37064806-37064828 GGTCATGCAGGTGGCCCTTTTGG + Intergenic
1066993405 10:42539092-42539114 CCTCTGGCAGGTGACCCTCTGGG - Intergenic
1067332187 10:45333016-45333038 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1067432752 10:46254604-46254626 AACCTGGCAGGAGGCCCTATAGG - Intergenic
1068567683 10:58593501-58593523 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1069093391 10:64229329-64229351 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1069348899 10:67502349-67502371 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1070568150 10:77619642-77619664 TGCCTGGCAGGTGGTCCTAGAGG - Intronic
1070681740 10:78453621-78453643 GGCCTGGCAGGCTGCCCTGCTGG - Intergenic
1070980405 10:80641172-80641194 ATACAGGCAGGTGGCCCTCTGGG - Intronic
1071401701 10:85279764-85279786 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1071997692 10:91163371-91163393 GGACTGGAAGGCGCCCCTCTGGG - Intronic
1072024709 10:91443460-91443482 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1072024988 10:91446135-91446157 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1072358879 10:94639725-94639747 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1072404483 10:95136919-95136941 CATCTGGCAGGTGCCCCTCTCGG + Intergenic
1073248171 10:102106168-102106190 AGCCAGACAGGTGGCCCTCCTGG - Intergenic
1073434897 10:103510486-103510508 GGCTTGGCATGTGGCTCTGTGGG + Intronic
1075310846 10:121412412-121412434 GGCTGGGCAGTTGCCCCTCTGGG - Intergenic
1075536706 10:123277607-123277629 GGCCTGGGATGAGGCCCTGTGGG - Intergenic
1075983828 10:126766424-126766446 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1076094623 10:127721041-127721063 GCCCTGGCATCTGGCCCGCTTGG - Intergenic
1076215556 10:128690883-128690905 GCCCTGGAAGGTGACCATCTGGG - Intergenic
1076389887 10:130091180-130091202 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1077117868 11:893452-893474 GGCCCGGCTGCTGGCCCTCCTGG - Exonic
1077228179 11:1447357-1447379 GGCGTGGGAGGCCGCCCTCTTGG + Intronic
1077231833 11:1461224-1461246 AGCCTGCCTGGTGGCCTTCTGGG + Exonic
1077377095 11:2210165-2210187 GGCCTGGGAGGTGGGCCCATGGG - Intergenic
1077404596 11:2377460-2377482 GGCCTGGCGGGTGGCCGGCAAGG - Exonic
1077411709 11:2406776-2406798 GGTCTGGCAGGTCTCTCTCTGGG + Exonic
1078732816 11:13991939-13991961 CATCTGGCAGGTGCCCCTCTAGG - Intronic
1078814029 11:14801513-14801535 CATCTGGCAGGTGTCCCTCTGGG - Intronic
1078998430 11:16728339-16728361 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1079328091 11:19511709-19511731 GGCCTGGCAGGTGGTGCTGGAGG + Intronic
1080849455 11:36055560-36055582 GGACTGGCAGATGGCACTATCGG + Intronic
1081414345 11:42796693-42796715 AGCCTGGCATGTGGCACTCCTGG - Intergenic
1082774726 11:57236398-57236420 GGCCTGGGAGGTGGGCCTTGGGG - Exonic
1082903531 11:58282690-58282712 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1083159740 11:60847778-60847800 GGCCTGACAGGCGGCCTTCCAGG - Intronic
1083510301 11:63202917-63202939 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1083603117 11:63961246-63961268 TGCCTGGCAGGTGGGCCACACGG + Intergenic
1083736264 11:64683082-64683104 GGCCAGGGAGATGGCCTTCTGGG - Intronic
1083876125 11:65525213-65525235 GCCCGGGCAGGCCGCCCTCTGGG - Exonic
1083938838 11:65884332-65884354 GTCCTGGCAGGTGGCAGGCTGGG + Intronic
1084213078 11:67632753-67632775 GCCCTGGCACCTGGGCCTCTTGG + Intronic
1084434543 11:69131262-69131284 AGCCTGGCAGGGGAGCCTCTAGG + Intergenic
1084445677 11:69202234-69202256 GGCCTGGCAGGTGGTCCAAGTGG + Intergenic
1084459214 11:69286891-69286913 GGCCTGGCTGGTGGAGCCCTGGG + Intergenic
1084778835 11:71395779-71395801 GGCCTGGCAGCAGGACCCCTGGG + Intergenic
1085433945 11:76482008-76482030 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1085683712 11:78602813-78602835 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1086067789 11:82764934-82764956 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1087007167 11:93481848-93481870 GGACTGGCAGGTGGCACCCCAGG + Intronic
1087305847 11:96487895-96487917 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1087410590 11:97785956-97785978 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1087484932 11:98748664-98748686 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1088307324 11:108423670-108423692 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1088787220 11:113193078-113193100 GGCCTGGAATCTGGCCCTTTTGG + Intronic
1089067164 11:115670686-115670708 GGCTTGGCAGGGGGTCCTATGGG + Intergenic
1089882370 11:121787190-121787212 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1091443702 12:530986-531008 GCCCTGGCAGCTGGTGCTCTGGG + Intronic
1091958844 12:4672991-4673013 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1093544965 12:20335992-20336014 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1093902733 12:24654432-24654454 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1094453388 12:30604917-30604939 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1094781987 12:33802215-33802237 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1095128402 12:38508761-38508783 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1095247786 12:39943133-39943155 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1095488572 12:42708953-42708975 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1095832263 12:46600962-46600984 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1095962575 12:47844686-47844708 GGCCTGGCACGTGGCCCTGGAGG + Exonic
1096215747 12:49796683-49796705 AGCCTGGCCTGTGGGCCTCTGGG + Exonic
1096685913 12:53288207-53288229 GGCCTGGTCACTGGCCCTCTGGG - Exonic
1097435482 12:59548764-59548786 CACATGGCAGGTGCCCCTCTGGG - Intergenic
1097753001 12:63378464-63378486 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1097898713 12:64852868-64852890 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1098183103 12:67869251-67869273 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1098635706 12:72780963-72780985 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1098697141 12:73573175-73573197 CATCTGGCAGGTGCCCCTCTTGG + Intergenic
1098704680 12:73672161-73672183 CGTCTGGCAGGTGTCCCTCTGGG + Intergenic
1098780249 12:74677145-74677167 CATCTGGCGGGTGGCCCTCTGGG + Intergenic
1099435183 12:82634542-82634564 TATCTGGCAGGTGCCCCTCTGGG - Intergenic
1099486170 12:83232200-83232222 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1099697398 12:86040105-86040127 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1099878520 12:88437732-88437754 CATCTGGCAGGTGTCCCTCTGGG + Intergenic
1100136362 12:91557543-91557565 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1100240548 12:92706823-92706845 TGCCTGGCAGGTGACCACCTGGG + Exonic
1100275743 12:93070247-93070269 GTCCTGGCAGGTGTCCAGCTAGG - Intergenic
1100608410 12:96170523-96170545 AGACTGGCAGGCGGCCCTCGGGG + Intergenic
1101225083 12:102680248-102680270 GCCCTGGGAGGAGGCCATCTGGG + Intergenic
1101601171 12:106211835-106211857 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1103939341 12:124493319-124493341 GGGCAGGCAGGTTCCCCTCTGGG + Intronic
1103976204 12:124704579-124704601 GACCTTGCAAGTGGCCCCCTCGG + Intergenic
1104771208 12:131366034-131366056 TGGATGGCAGGTGTCCCTCTCGG + Intergenic
1106326258 13:28693438-28693460 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1106331570 13:28744221-28744243 GGCCGGGGAAGTGGCCCTCATGG - Intergenic
1106335930 13:28783559-28783581 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1106769968 13:32952410-32952432 GGCCTGGCAGGTGTCTGTGTTGG + Intergenic
1107551390 13:41479685-41479707 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1108262710 13:48675004-48675026 CATCTGGCAGGTGTCCCTCTGGG - Intronic
1108383886 13:49880138-49880160 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1108498004 13:51044141-51044163 AGGCTGACAGGTGACCCTCTGGG + Intergenic
1109366685 13:61364975-61364997 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1110199641 13:72833628-72833650 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1110281937 13:73704158-73704180 CGCGTGGCAGGTGTTCCTCTTGG + Intronic
1110824763 13:79958848-79958870 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1112165936 13:96919478-96919500 CACCTGGCAGGTGCCCCTCTGGG + Intergenic
1112546432 13:100376228-100376250 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1112652496 13:101415574-101415596 GGCCTGGCTGGGATCCCTCTGGG - Intronic
1114558390 14:23575538-23575560 GGCCAGGCAGTTGGACCCCTGGG - Intronic
1114844975 14:26309673-26309695 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1115248398 14:31320197-31320219 GGACAGGCAGGTGACCCTCACGG + Intronic
1115511359 14:34140401-34140423 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1115690939 14:35843562-35843584 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1115998127 14:39214475-39214497 GCCCAGGCAGGTGGACCACTTGG + Intergenic
1116572354 14:46534468-46534490 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1116771381 14:49131154-49131176 GATCTGGCGGGTGCCCCTCTGGG - Intergenic
1117670394 14:58100294-58100316 GGACTGCCAGGCAGCCCTCTAGG + Intronic
1118498537 14:66333499-66333521 CATCTGGCGGGTGGCCCTCTGGG + Intergenic
1118516000 14:66529847-66529869 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1119434574 14:74589651-74589673 GGCCTGGCAGGTGGTCAGGTGGG - Intronic
1120271706 14:82321466-82321488 AATCTGGCAGGTGCCCCTCTGGG - Intergenic
1120770190 14:88370630-88370652 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1121625672 14:95384060-95384082 GGCCAGCCAGGCGGGCCTCTGGG + Intergenic
1121641954 14:95490786-95490808 GGCCAGGCCTGTGGCCCTATCGG + Intergenic
1121797436 14:96746753-96746775 GGCCGGGCAGGTGGCCTTGAAGG + Intergenic
1122139999 14:99657391-99657413 GGCCTGGCACAGGACCCTCTGGG + Intronic
1122326033 14:100881149-100881171 GGGCAGGGAGGTGGCCCTCCTGG + Exonic
1122387707 14:101360425-101360447 GCCCTGGTAGGTAGCCCCCTCGG + Intergenic
1122427721 14:101621326-101621348 GGCCTGGCAGGCCGGCCACTCGG + Intergenic
1122640674 14:103157229-103157251 GGCCTTGCGGGAGGCTCTCTGGG + Intergenic
1122920854 14:104879569-104879591 GCCCTGGCCGGGTGCCCTCTCGG + Intronic
1122937778 14:104967870-104967892 GGCCTGGGAGGCGGTGCTCTTGG - Intronic
1123480914 15:20629850-20629872 CATCTGGCAGGTGCCCCTCTAGG + Intergenic
1123637097 15:22370515-22370537 CATCTGGCAGGTGCCCCTCTAGG - Intergenic
1123783591 15:23647520-23647542 GGGCGGGCAGCTGGCCCTGTGGG + Exonic
1123884340 15:24709521-24709543 CGTCTGGCAGGTGCCCCTCTAGG + Intergenic
1124214302 15:27793845-27793867 GGGCTGGGAGATGGCCCTCCTGG + Intronic
1124965956 15:34433935-34433957 GGCCGGCCAGGTGGGCATCTGGG + Intronic
1125329921 15:38572973-38572995 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1125503482 15:40253362-40253384 GGGCAGGCAGGTGGCCCTCCTGG + Intronic
1125647259 15:41283097-41283119 GGCCTGACACCTGCCCCTCTGGG + Intergenic
1125791909 15:42373452-42373474 GGCCTGGCAGCTTGCCCGCTAGG - Intronic
1127056367 15:55135971-55135993 ATCCTGGCAGGTACCCCTCTGGG + Intergenic
1127576024 15:60293273-60293295 GGCTTGGCAGGTGTCACCCTAGG - Intergenic
1128736619 15:70057331-70057353 GGCCAGGCAGCTGCCCCTGTGGG - Intronic
1128839189 15:70835941-70835963 GGCCTGGCAGGTATCTCTCAAGG + Intronic
1129030699 15:72615700-72615722 GTCCTGGCTGGTGTCTCTCTAGG + Intergenic
1129165413 15:73774451-73774473 GGTGTGTCAGGTGGCCCACTGGG + Intergenic
1129477540 15:75796223-75796245 GTCCTGGCTGGTGTCTCTCTAGG + Intergenic
1129507877 15:76098459-76098481 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1129701443 15:77770817-77770839 GGCCTGGCAGGCTGCCATCCAGG + Intronic
1129737501 15:77974376-77974398 AGCCTGGCACGTGGTCATCTTGG + Intergenic
1129835606 15:78703500-78703522 GCCCTGGCTGGTGTCTCTCTAGG + Intronic
1130442004 15:83963768-83963790 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1130984286 15:88834498-88834520 GGCCCAGCAGGTGTCGCTCTTGG - Intronic
1131391963 15:92057050-92057072 TGCCTGGCAGTTGCCCTTCTGGG + Intronic
1132096510 15:98988751-98988773 CATCTGGCAGGTGCCCCTCTAGG + Intronic
1132335911 15:101048667-101048689 GACCTGGCAGGTGGGCTTCCAGG - Intronic
1132870204 16:2112461-2112483 GCCCCGGCAGGTGGACCTTTGGG - Exonic
1133034183 16:3025851-3025873 GCCCTGGCACTTGGCCCTCATGG + Intronic
1133287678 16:4698159-4698181 GTCCTTGCAGCTGGCCCTCATGG + Intronic
1133634662 16:7653858-7653880 GGCCTCGCAGGTGCGCCCCTCGG - Exonic
1133758787 16:8781787-8781809 GGACTGGCAGCTGGGCCTCCTGG + Exonic
1134452282 16:14370903-14370925 AGCCTGGAAGGGGGCCCTCCTGG - Intergenic
1134522339 16:14924495-14924517 GCCCCGGCAGGTGGACCTTTGGG + Intronic
1134710009 16:16323146-16323168 GCCCCGGCAGGTGGACCTTTGGG + Intergenic
1134717224 16:16363146-16363168 GCCCCGGCAGGTGGACCTTTGGG + Intergenic
1134949594 16:18345499-18345521 GCCCCGGCAGGTGGACCTTTGGG - Intergenic
1134957527 16:18389013-18389035 GCCCCGGCAGGTGGACCTTTGGG - Intergenic
1136272368 16:29155971-29155993 GACCTGGGAGGTGGACCTGTCGG + Intergenic
1137610640 16:49814989-49815011 GGCTTGGGAGGTGGCATTCTAGG - Intronic
1137761602 16:50945310-50945332 GGCCTGGGAAGTGGCTCTCGTGG - Intergenic
1137828183 16:51517537-51517559 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1137969907 16:52974946-52974968 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1138552821 16:57756677-57756699 GGCCTGGGTGGTTCCCCTCTGGG + Intronic
1139590647 16:67931097-67931119 GCCCTGGCAGGTGTCCCTGCAGG - Exonic
1139641477 16:68294723-68294745 GGTCCGGTAGGTGGCCCTCCCGG - Exonic
1140469442 16:75206089-75206111 GCCCTGGCAGGTGTCCCTGCAGG - Exonic
1140472342 16:75222850-75222872 GCCCTGGCAGGTGTCCCTGCAGG + Exonic
1141954126 16:87358835-87358857 GTCCTGGCAGGTGAGCATCTGGG + Intronic
1142075929 16:88117782-88117804 GACCTGGGAGGTGGACCTGTCGG + Intronic
1142131190 16:88432290-88432312 GGCCTGGCAGGTGCGCCGTTGGG - Exonic
1142401971 16:89863666-89863688 GTCCTGGGAACTGGCCCTCTCGG - Intronic
1143358381 17:6347904-6347926 GGCCAGGCAGGTGCCACTCTTGG + Intergenic
1144026661 17:11282793-11282815 TGCTTGGCAGCTGCCCCTCTGGG - Intronic
1144131349 17:12250406-12250428 CGCCTGGCAGGCAGCCCTCTTGG + Intergenic
1144682849 17:17206608-17206630 GGCCTAGCGCGTGGCCCTCGGGG - Intronic
1144726233 17:17504058-17504080 GCCCAGGCAGGTGGCCTTCAGGG - Intergenic
1145255474 17:21319881-21319903 GGCTTGGCAGGTGGCTCACTGGG - Intergenic
1145321138 17:21768071-21768093 GGCTTGGCAGGTGGCTCACTGGG + Intergenic
1145760065 17:27420735-27420757 GCCCTGACAGGAGTCCCTCTGGG - Intergenic
1146237128 17:31177179-31177201 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1146746247 17:35333299-35333321 AATCTGGCAGGTGCCCCTCTGGG - Intergenic
1147892915 17:43729938-43729960 GTCCTGGCATGTGGGGCTCTTGG - Intergenic
1148848361 17:50541936-50541958 GGCCTGGCAGGCGGGCCTGTGGG + Exonic
1148981112 17:51575468-51575490 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1149560185 17:57603072-57603094 GGCCTGGCACCTGGACCTCCAGG + Intronic
1151064095 17:71131372-71131394 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1151670815 17:75570827-75570849 GGCCTGGCAGGTGGCTGGCATGG + Intronic
1152676819 17:81645459-81645481 GGCCCTGGTGGTGGCCCTCTGGG + Exonic
1152828659 17:82483831-82483853 GGCCTGGCAGGTGGCTGGCAGGG - Intronic
1152850180 17:82629230-82629252 GGCAAGGGAGGCGGCCCTCTAGG + Intronic
1153798543 18:8647487-8647509 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1154382151 18:13862619-13862641 CATCTGGCAGGTGACCCTCTGGG - Intergenic
1154420052 18:14221915-14221937 AGGCTGGCAGGTGGCACTGTGGG + Intergenic
1155006771 18:21736137-21736159 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1156166662 18:34429368-34429390 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1156626788 18:38919636-38919658 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1157066464 18:44356567-44356589 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1159254802 18:65931698-65931720 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1159385874 18:67725160-67725182 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1159661147 18:71097504-71097526 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1160242525 18:77133302-77133324 CGGCTGGCAGGTGCTCCTCTGGG + Intronic
1160775280 19:852602-852624 GGGGTCGCAGGTCGCCCTCTGGG + Intronic
1161454401 19:4362902-4362924 GTCCAGGCTGGAGGCCCTCTGGG - Intronic
1161651732 19:5489981-5490003 GTCCTGACAGGGGTCCCTCTGGG - Intergenic
1162964858 19:14150935-14150957 GGGCTGCCAGGTAGCCCTCGTGG + Exonic
1162965702 19:14155059-14155081 GGCCTGACTCGTGGCCCTCATGG + Intronic
1163438972 19:17312075-17312097 ACCCTGGGAGGTGGCCCTGTTGG + Intronic
1163572621 19:18091257-18091279 GGCCTGCCAAGAGGCCCTGTGGG + Intronic
1163668622 19:18614525-18614547 GACCTGGGAGGTTGCCCCCTGGG - Intronic
1163830932 19:19546876-19546898 GCCCTGGCAGGGGAGCCTCTGGG + Intergenic
1165062314 19:33210858-33210880 GGCTGGGCAGGTGCCCCTCGCGG + Exonic
1165958508 19:39516262-39516284 GGCCTGGCACTTGGCCCGCGGGG - Intronic
1166001057 19:39877706-39877728 GGCCTGGCAGGCGGCCACGTAGG + Exonic
1166831787 19:45643696-45643718 GGCCGCGCAGCTGGCCCTCTGGG + Intronic
1167974022 19:53209679-53209701 CACCTGGCGGGTGCCCCTCTGGG - Intergenic
926943895 2:18167571-18167593 TATCTGGCAGGTGCCCCTCTGGG - Intronic
927021238 2:19019872-19019894 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
927117256 2:19917007-19917029 CATCTGGCAGGTGCCCCTCTGGG + Intronic
927650342 2:24909182-24909204 GTCCTGGTGGGTGGCCCTCATGG + Intronic
927842404 2:26454048-26454070 GGCCTGGGAGGTGGCACTGGTGG + Intronic
928205695 2:29281724-29281746 GATCTGGGAGGTGGCCATCTGGG + Intronic
929534211 2:42770369-42770391 GGCCTGGCAGTGGGCTCTCTGGG + Intronic
931004173 2:57828715-57828737 CACCTGGCGGGTGCCCCTCTGGG + Intergenic
931074042 2:58689252-58689274 CGTCTGGCAGGTGCCCCTCTGGG + Intergenic
931566525 2:63620779-63620801 CATCTGGCAGGTGCCCCTCTGGG + Intronic
931907519 2:66858636-66858658 TATCTGGCAGGTGCCCCTCTGGG - Intergenic
931950287 2:67354495-67354517 GGCCTGGGAGGTGGAGGTCTTGG - Intergenic
932051890 2:68405955-68405977 CATCTGGCAGGTGCCCCTCTAGG + Intergenic
932605003 2:73159346-73159368 GGCTGGGCAGGTGGCTCTTTTGG + Intergenic
932701876 2:73997690-73997712 AGACAGGCAGGTGGCCCTCCTGG + Intronic
932913965 2:75834751-75834773 CATCTGGCAGGTGCCCCTCTTGG + Intergenic
936475451 2:112835798-112835820 GGCCTGGCAGGTGGGCACCCTGG + Intronic
936999885 2:118456660-118456682 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
938135882 2:128756043-128756065 TGCCTGGCAGGTGGTCCCGTGGG - Intergenic
938952235 2:136266128-136266150 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
939381958 2:141447793-141447815 ACCCTGGCAGTTGGCCTTCTGGG - Intronic
940593927 2:155766483-155766505 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
940946595 2:159624453-159624475 CCTCTGGCAGGTGCCCCTCTGGG + Intergenic
940954346 2:159712144-159712166 GGCCCTGCAGGTGGGCCTGTGGG + Intergenic
941571428 2:167175516-167175538 CATCTGGCAGGTGCCCCTCTGGG - Intronic
942459436 2:176159280-176159302 GGCCTGGCCAGAGGCCCACTCGG - Intronic
942491605 2:176495069-176495091 GGGCTGGCAGGGTGCCCTATGGG - Intergenic
942576901 2:177373579-177373601 CATCTGGCAGGTGCCCCTCTGGG - Intronic
942722313 2:178966378-178966400 CGTCTAGCAGGTGCCCCTCTGGG + Intronic
943350795 2:186793762-186793784 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
944292122 2:198018992-198019014 CATCTGGCAGGTGCCCCTCTGGG + Intronic
944608016 2:201370384-201370406 CACCTGGCAGGTGCCCCTTTTGG + Intergenic
944972640 2:205011603-205011625 GGCTTGCTAGGTGGCCGTCTTGG + Intronic
945467120 2:210182073-210182095 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
945628170 2:212237458-212237480 CATCTGGCAGGTGGCCCTCTGGG - Intronic
946913081 2:224485870-224485892 CATCTGGCAGGTGCCCCTCTGGG + Intronic
947143649 2:227043115-227043137 GGCCTTCCAGGTGATCCTCTGGG + Exonic
947364759 2:229382026-229382048 CATCTGGCAGGTGACCCTCTGGG + Intronic
948653925 2:239465157-239465179 GGCCTGTGAGGCGGCCCTGTGGG - Intergenic
948878258 2:240841544-240841566 GGGCTGGGAGCTGGCCCTCAGGG + Intergenic
948912708 2:241012353-241012375 GGCCTGGCAGTGGGCCCACCAGG - Intronic
1168921960 20:1545998-1546020 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1169274105 20:4221568-4221590 GGCCTGGCAGGTGGCGCCCTCGG + Exonic
1169396969 20:5241122-5241144 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1169646183 20:7812538-7812560 CATCTGGCAGGTGTCCCTCTGGG - Intergenic
1169911374 20:10650308-10650330 GTCCTGGCAGGTGCCCCCGTGGG + Exonic
1170294320 20:14807202-14807224 CGTCTAGCAGGTGCCCCTCTGGG + Intronic
1170606995 20:17882181-17882203 GGCCAGGCAGGTGGGCCTGGAGG + Intergenic
1170727251 20:18941228-18941250 CACCTGGCAGGGGCCCCTCTGGG - Intergenic
1171406907 20:24917870-24917892 GGCCTGCCTGGTGGCCACCTGGG - Intergenic
1171958416 20:31476517-31476539 GGCCAGGCTGGTGGCCCCGTGGG - Exonic
1174366136 20:50057641-50057663 GGGCTGGCGGGGTGCCCTCTGGG - Intergenic
1174406928 20:50308870-50308892 GGCCTGGGGGATGGCCGTCTGGG - Intergenic
1175332986 20:58177562-58177584 GCCCTGGCAGGTGGGGGTCTTGG - Intergenic
1175929784 20:62488247-62488269 GGCTTGGCAGGAGGCCCTCCTGG + Intergenic
1177050359 21:16225364-16225386 CATCTGGCAGGTGACCCTCTGGG + Intergenic
1177313306 21:19424926-19424948 CATCTGGCAGTTGGCCCTCTGGG + Intergenic
1177541072 21:22494250-22494272 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1177694654 21:24555597-24555619 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1179494664 21:41764094-41764116 TGCCTGCCAGGGGGCCCTCCTGG - Intronic
1179821536 21:43940037-43940059 GGCCACGCAGGTGGCACCCTGGG + Intronic
1179955046 21:44733894-44733916 GGCCTGGCAGTGGGTCTTCTGGG + Intergenic
1180176654 21:46093802-46093824 GCTCTGGCAGGTGGCACGCTGGG + Intergenic
1180189284 21:46154894-46154916 GGCCTTCCAGGTGGCCCTTAGGG + Intronic
1180598397 22:16995572-16995594 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1180862960 22:19097757-19097779 GGCAGGGCAGGTGGCACTCATGG - Intronic
1182547315 22:31083695-31083717 GGCCTGGCAGGGGGCAGGCTGGG + Intronic
1183019451 22:35015523-35015545 GGACTCTCAGGTGACCCTCTTGG + Intergenic
1183177495 22:36235079-36235101 TGCCTGGCTGGATGCCCTCTTGG - Intronic
1183481019 22:38065617-38065639 GGCCTGGGAGGGGGGTCTCTGGG - Intronic
1183546948 22:38459396-38459418 GGCCAGGCAGGTGGACAGCTGGG + Intergenic
1184101732 22:42344488-42344510 GGCCAGGCAGGTGGGCCTGGTGG - Intergenic
1184468619 22:44683354-44683376 GGGCTGCCAGGTGGCCCTCAAGG - Intronic
1184690781 22:46116422-46116444 GGCAGGGCATGTGGCCCTCCTGG - Intergenic
1185231714 22:49687598-49687620 GGCCTGGGAGGTGGCGCTCCGGG - Intergenic
1185265585 22:49900985-49901007 GGCATGGCAGGGCGTCCTCTTGG - Exonic
949155093 3:817258-817280 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
949222623 3:1653961-1653983 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
949583443 3:5413280-5413302 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
950619612 3:14194139-14194161 CATCTGGCAGGTGCCCCTCTGGG - Intronic
951254411 3:20432504-20432526 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
951324384 3:21285116-21285138 CGTCTGGCAGGTGACCCTCTGGG - Intergenic
951347140 3:21560523-21560545 CATCTGGCAGGTAGCCCTCTGGG - Intronic
951503581 3:23417429-23417451 CATCTGGCAGGTGCCCCTCTGGG - Intronic
951795405 3:26533376-26533398 CATCTGGCAGGTGCCCCTCTAGG - Intergenic
952125092 3:30290861-30290883 GGCCTGTCAACGGGCCCTCTAGG + Intergenic
953070524 3:39515205-39515227 GGCCTTGCAGGAGCCCCTTTTGG + Exonic
953254729 3:41278561-41278583 GTACAGGCAGGTGCCCCTCTGGG + Intronic
954224120 3:49171795-49171817 CCCCTGGCAGGAGGGCCTCTTGG - Intronic
954503852 3:51049419-51049441 GACCTGGAAGTTGGTCCTCTAGG + Intronic
954978611 3:54722773-54722795 CATCTGGCAGGTGCCCCTCTGGG - Intronic
955439828 3:58943332-58943354 CGTCTGGCAGGTGCCCCTCTGGG + Intronic
956220170 3:66893788-66893810 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
956301819 3:67780961-67780983 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
956355805 3:68390614-68390636 CATCTGGCAGGTGGCCCTGTGGG + Intronic
956382976 3:68685833-68685855 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
956748248 3:72326622-72326644 GGCCTGGGAGTTGGGCCTCCAGG + Intergenic
957776578 3:84761772-84761794 TGTCTGGCAGGTGATCCTCTGGG + Intergenic
957930863 3:86876543-86876565 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
957993165 3:87653250-87653272 CACCTGGCGGGTGCCCCTCTGGG - Intergenic
959091727 3:101910844-101910866 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
959382154 3:105654082-105654104 TGGCTGACAGGTGGCCTTCTTGG + Intergenic
959534687 3:107471123-107471145 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
960226828 3:115178993-115179015 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
960278251 3:115751632-115751654 CATCTGGCAGGTGCCCCTCTAGG + Intergenic
961323964 3:126098826-126098848 CTGCTGGCAGGTGGCCCTCTGGG + Intronic
961555590 3:127694868-127694890 GACCTGGGAGGTGGCCCTCGAGG + Intronic
961903220 3:130235208-130235230 GGACTTACAGGTTGCCCTCTTGG - Intergenic
962640053 3:137376678-137376700 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
962666128 3:137654957-137654979 CATCTGGCAGGTGTCCCTCTGGG + Intergenic
962990472 3:140573055-140573077 AACCTGGCAGGTGGCCTTCCTGG - Exonic
963976400 3:151484560-151484582 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
964010457 3:151885901-151885923 CATCTGGCAGGTGTCCCTCTGGG + Intergenic
964501688 3:157354996-157355018 GGACTGGAAGTTGGCCCCCTGGG - Intronic
964649007 3:158990949-158990971 CATCTGGCAGGTGCCCCTCTGGG - Intronic
965600445 3:170448809-170448831 GGCTTTGGAGGTGGCCCTCCAGG - Intronic
965618647 3:170621031-170621053 CATCTGGCAGGTGCCCCTCTGGG - Intronic
965621855 3:170650523-170650545 CATCTGGCAGGTGCCCCTCTGGG - Intronic
965654961 3:170974653-170974675 GCTCTGGCAGGTGCCCCTCTGGG - Intergenic
966533217 3:181003887-181003909 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
967181410 3:186908915-186908937 CATCTGGCAGGTGTCCCTCTGGG - Intergenic
967971532 3:195003143-195003165 GGCCTGGCAGTTGGGAGTCTGGG + Intergenic
968271409 3:197406411-197406433 GTCCTGGCAGGGAGCCATCTTGG - Intergenic
968582804 4:1402781-1402803 GGCCGGGCAGGTGGCTCCCGCGG - Intergenic
968816654 4:2824950-2824972 GTCCTGGGAGGTGCCCCTGTGGG + Intronic
968829011 4:2922518-2922540 CATCTGGCAGGTGCCCCTCTGGG - Intronic
968908119 4:3463772-3463794 GGGCTGCCTGGTGGCCCTGTAGG + Intronic
968962524 4:3752783-3752805 GGCCTGGCAGGGAGGGCTCTGGG + Intergenic
969164737 4:5298164-5298186 CATCTGGCCGGTGGCCCTCTGGG - Intronic
969694961 4:8729265-8729287 GGCCTTGCAGGGGGACCTCATGG + Intergenic
969909107 4:10427479-10427501 CATCTGGCAGGTGTCCCTCTGGG - Intergenic
970727263 4:19060901-19060923 CCTCTGGCAGGTGCCCCTCTGGG + Intergenic
971697966 4:29930399-29930421 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
971804777 4:31341772-31341794 GGCCTGGCTGGTGGTTCCCTGGG + Intergenic
972259757 4:37396312-37396334 GCCCTGGCATGTGGCCCTGTTGG + Intronic
972261112 4:37408789-37408811 CATCTGGCAGGTGCCCCTCTGGG + Intronic
972962832 4:44474472-44474494 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
973556746 4:52091652-52091674 CATCTGGCAGGTGCCCCTCTGGG - Intronic
973798477 4:54451952-54451974 GCTCTGGCAGGTGCCCCTCTAGG + Intergenic
974106157 4:57472253-57472275 CATCTGGCAGGTGTCCCTCTGGG - Intergenic
974161836 4:58150302-58150324 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
974326224 4:60418740-60418762 CCTCTGGCAGGTGCCCCTCTGGG - Intergenic
974793090 4:66714665-66714687 CGTCTGGCAGGTGCCCCTCTGGG + Intergenic
974975453 4:68886056-68886078 CATCTGGCAGGTGGCCCTCTGGG + Intergenic
975149324 4:71004338-71004360 CCTCTGGCAGGTGCCCCTCTGGG - Intronic
976061174 4:81130369-81130391 CATCTGGCAGGTGCCCCTCTGGG - Intronic
976092798 4:81474433-81474455 CATCTGGCAGGTGCCCCTCTGGG + Intronic
976193691 4:82513199-82513221 CATCTGGCAGGTGCCCCTCTGGG + Intronic
976394994 4:84545716-84545738 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
976438381 4:85044408-85044430 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
976698358 4:87942219-87942241 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
977154562 4:93555867-93555889 CATCTGGCAGGTGTCCCTCTGGG + Intronic
977986265 4:103386143-103386165 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
978185978 4:105857788-105857810 CATCTGGCAGGTGCCCCTCTGGG - Intronic
978664375 4:111164793-111164815 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
978838896 4:113186162-113186184 CATCTGGCAGGTGCCCCTCTGGG + Intronic
979414993 4:120426167-120426189 GGCTTGGCAGCTGGGACTCTAGG - Intergenic
979457685 4:120944835-120944857 TATCTGGCAGGTGCCCCTCTGGG + Intergenic
979698209 4:123638631-123638653 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
980157555 4:129125907-129125929 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
980330306 4:131402964-131402986 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
980643673 4:135613520-135613542 GGAGTTGCAGGTGGCCCTCAAGG + Intergenic
981748509 4:148072618-148072640 GGTCCTGCAGGTGGCCGTCTAGG - Exonic
983958724 4:173727326-173727348 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
984008993 4:174347989-174348011 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
985193932 4:187407810-187407832 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
985757201 5:1726026-1726048 GGCCCGTCAGGAGGCACTCTTGG + Intergenic
985818145 5:2141851-2141873 GGCCTGGGAGCTGGCATTCTGGG + Intergenic
986477661 5:8152275-8152297 GGCCTGGGAGGTGGCGATGTGGG - Intergenic
986838752 5:11672161-11672183 CATCTGGCAGGTGTCCCTCTGGG - Intronic
987228839 5:15871071-15871093 CATCTGGCAGGTGTCCCTCTGGG + Intronic
987528121 5:19080058-19080080 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
987924000 5:24317346-24317368 CACCTGGCAGGTGCCCCTCTGGG - Intergenic
988021542 5:25627701-25627723 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
988627946 5:32898261-32898283 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
988772503 5:34447170-34447192 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
989267016 5:39486624-39486646 GACCTGGCAGCTGACCCGCTGGG - Intergenic
990098939 5:52157397-52157419 CAACTGGCAGGTGCCCCTCTGGG + Intergenic
990668946 5:58105520-58105542 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
991026586 5:62037026-62037048 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
991128213 5:63091057-63091079 CATCTGGCAGGTGCCCCTCTAGG + Intergenic
992077952 5:73207830-73207852 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
992254790 5:74911145-74911167 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
993041676 5:82821959-82821981 GGCTTTGCAGGTGGGTCTCTTGG - Intergenic
993119217 5:83754223-83754245 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
993455373 5:88120994-88121016 CATCTGGCAGGTGTCCCTCTGGG + Intergenic
993895072 5:93523613-93523635 GATCTGGCAGGTGCCCCTCTGGG + Intergenic
994005085 5:94828332-94828354 CATCTGGCAGGTGCCCCTCTGGG - Intronic
994378168 5:99038366-99038388 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
994622400 5:102178959-102178981 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
994991225 5:106999634-106999656 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
995093840 5:108212693-108212715 CATCTGGCAGGTGCCCCTCTGGG - Intronic
995136490 5:108685493-108685515 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
995464493 5:112436697-112436719 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
995695824 5:114876984-114877006 GATCTGGCAGGTGCCCCTCTGGG + Intergenic
996130030 5:119770290-119770312 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
996270869 5:121602910-121602932 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
996427831 5:123334726-123334748 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
996549768 5:124717864-124717886 GGCCAGGCAAGTGTCCCTATAGG + Intronic
996953217 5:129152857-129152879 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
997004528 5:129803105-129803127 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
997609590 5:135206212-135206234 GGCTGGCCAGGTGGCCCTGTTGG - Intronic
997902839 5:137783715-137783737 CAACTGGCAGGTGCCCCTCTGGG + Intergenic
998003396 5:138641739-138641761 GGCCTGGCAGCCTGGCCTCTGGG - Intronic
998132000 5:139655968-139655990 GGCCTGCCTGGTGGCCCCCGGGG + Intronic
998139071 5:139689897-139689919 GGCCTGGGAGGTGGCCACCTGGG - Intergenic
998203475 5:140143512-140143534 GGCCTAGCAGGGGACCCTATAGG - Intergenic
998752008 5:145333149-145333171 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
999468742 5:151831908-151831930 CACCTGGCAGGTGCCCCTCTGGG + Intronic
999489759 5:152038700-152038722 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
999502293 5:152159691-152159713 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
999608109 5:153338835-153338857 CATCTGGCAGGTGTCCCTCTGGG - Intergenic
1000250215 5:159487378-159487400 GCCTTGGCAGGTGGCTCTCACGG + Intergenic
1001330660 5:170760197-170760219 GGTCTGGCAGGGGCCCCTGTGGG + Intergenic
1001643866 5:173265493-173265515 CACCTGGCAGGGGCCCCTCTGGG + Intergenic
1002164971 5:177338421-177338443 GGCATGGCTGCTGGCCCCCTAGG - Intronic
1002662244 5:180799368-180799390 TGGCTGGCAGGTGGCGCTGTGGG - Intronic
1002896516 6:1383189-1383211 GGCCTGGGGCGTGGCCCTCGAGG - Intergenic
1002934802 6:1662352-1662374 GACATGGCAGGAGGGCCTCTGGG + Intronic
1003416804 6:5917226-5917248 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1003472636 6:6451579-6451601 GGGCATGCAGGTGCCCCTCTGGG - Intergenic
1004593301 6:17074194-17074216 TATCTGGCAGGTGCCCCTCTGGG + Intergenic
1004896056 6:20148807-20148829 TGCCTGGCTGATGCCCCTCTTGG - Intronic
1004929127 6:20444864-20444886 GGACTGGGATGTGGACCTCTGGG + Intronic
1005716240 6:28551459-28551481 GGCCTGGAATGTGGTCCTCATGG - Intergenic
1007368573 6:41411708-41411730 GGGCTGGCAGGCGGCCCGATGGG + Intergenic
1008509707 6:52264758-52264780 GGCATTCAAGGTGGCCCTCTTGG - Exonic
1008864068 6:56188736-56188758 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1009264195 6:61532554-61532576 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1009290181 6:61870635-61870657 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1009305818 6:62088581-62088603 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1009458838 6:63888399-63888421 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1009652145 6:66489825-66489847 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1009880584 6:69561221-69561243 CATCTGGCAGGTGCCCCTCTAGG + Intergenic
1010006317 6:70998771-70998793 CATCTGGCAGGTGCCCCTCTAGG + Intergenic
1010033013 6:71289219-71289241 GGCTTGGCACTTGCCCCTCTGGG - Intronic
1010039061 6:71360699-71360721 CATCTGGCGGGTGGCCCTCTGGG - Intergenic
1010521977 6:76849334-76849356 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1010575023 6:77519284-77519306 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1011065568 6:83321912-83321934 CATCTGGCAGGTGCCCCTCTTGG + Intronic
1011199774 6:84822932-84822954 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1012207385 6:96478283-96478305 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1012597034 6:101053530-101053552 CACCTGGCAGGTGCCCCTCTGGG - Intergenic
1012778093 6:103522656-103522678 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1013390334 6:109679715-109679737 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1013453083 6:110303926-110303948 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1014058407 6:117043471-117043493 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1014070455 6:117175634-117175656 TGTCTGGCGGGTGCCCCTCTGGG + Intergenic
1014323188 6:119957615-119957637 GGCCTGGAAGCTGGTCATCTAGG - Intergenic
1015291163 6:131539325-131539347 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1015435321 6:133179650-133179672 GGCCTGGCAGATGTCCCACTTGG + Intergenic
1016111549 6:140230878-140230900 CATCTGGCAGGTGCCCCTCTAGG + Intergenic
1016229756 6:141788763-141788785 GGCCTGGAAGGGGGGCCTCCCGG - Intergenic
1017820292 6:158044216-158044238 AACCTGGCAGATGGCACTCTGGG - Intronic
1017968617 6:159289915-159289937 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1018143745 6:160864138-160864160 GGACTGGCAGGAGGCCCGCTGGG - Intergenic
1018393977 6:163362938-163362960 GTCCTGGCCGGAGGCACTCTGGG + Intergenic
1018815130 6:167324913-167324935 GGACTGGCAGGAGGCCCACTGGG + Intergenic
1019077136 6:169396721-169396743 GGCATGGCAGCTGGCCTGCTGGG - Intergenic
1019421192 7:952094-952116 GGCCTGGCAGGTGGGCGAGTTGG - Intronic
1019603173 7:1895428-1895450 GGCCTGGCATGGGGAGCTCTGGG - Intronic
1020000673 7:4753940-4753962 GGCGTGGCAGGTGGCTCTCCTGG - Intronic
1020262148 7:6536568-6536590 GGCTCGGCTGGAGGCCCTCTCGG - Intronic
1020333493 7:7042896-7042918 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1020358192 7:7300689-7300711 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1020487583 7:8738502-8738524 TATCTGGCAGGTGTCCCTCTGGG - Intronic
1020693741 7:11390975-11390997 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1020694123 7:11393148-11393170 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1020716137 7:11676025-11676047 AATCTGGCAGGTGCCCCTCTAGG + Intronic
1021014751 7:15518431-15518453 CATCTGGCAGGTGGCCCTCTGGG + Intronic
1021065230 7:16164886-16164908 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1021347593 7:19547627-19547649 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1021749262 7:23779219-23779241 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1022884517 7:34628868-34628890 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1022903365 7:34832297-34832319 GCCTAGGCAGGTGGACCTCTTGG + Intronic
1023598193 7:41854473-41854495 GGTCAGGCATGTGGCCATCTTGG - Intergenic
1024582295 7:50809858-50809880 GGCCCTGCAGGTGTCCCTCCTGG - Intergenic
1024925119 7:54604511-54604533 AGCCAGGAAGGTGGCCCTCCGGG + Intergenic
1026856569 7:73758990-73759012 GGCCTGGCAGGGGGCTTTGTGGG + Intergenic
1027778134 7:82492107-82492129 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1027790476 7:82634140-82634162 CATCTGGCAGGTGTCCCTCTGGG + Intergenic
1027843428 7:83342386-83342408 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1028627890 7:92898145-92898167 CGTCTGGCAGGGGCCCCTCTGGG - Intergenic
1028648343 7:93122098-93122120 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1028945521 7:96575346-96575368 CATCTGGCAGGTGACCCTCTGGG - Intronic
1029424686 7:100488418-100488440 GGCCTGGCTGGGCCCCCTCTTGG + Exonic
1029732278 7:102446437-102446459 TGCCTGGCAGGTGGCCCTGGTGG + Intronic
1030245244 7:107378030-107378052 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1030287859 7:107844991-107845013 AGCCTGGCAGGTGGTACTTTGGG + Intergenic
1031397661 7:121292899-121292921 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1031857720 7:126942272-126942294 GGCCTGCCAGGTGGTTATCTTGG - Intronic
1032659661 7:133969718-133969740 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1034335973 7:150323623-150323645 GGCCCAGCAGGTGGCCCCCCGGG - Intronic
1034394257 7:150808295-150808317 GTACAGGCAGGTGCCCCTCTGGG + Intergenic
1034629120 7:152516787-152516809 TGCCTGGCGGGAGTCCCTCTGGG + Intergenic
1036553857 8:9839436-9839458 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1036695204 8:10969805-10969827 GGCTTGGCAGGAAGCTCTCTTGG - Intronic
1036769797 8:11571186-11571208 GGCCTGTCCAGTGGCCCTCAGGG + Intergenic
1037766385 8:21774901-21774923 GGCATGGCAGATGGAGCTCTGGG - Intronic
1038083224 8:24163901-24163923 CACCTGGCAGGTGCCCCTCTGGG - Intergenic
1038211663 8:25523802-25523824 CATCTGGCAGGTGGCCCTCTGGG + Intergenic
1038401521 8:27287942-27287964 CGCCTGGGAGGTGGCCCTTGGGG - Exonic
1038936369 8:32256664-32256686 CATCTGGCAGGTGTCCCTCTGGG - Intronic
1039311588 8:36322438-36322460 AGCCAGGCTGGTGGCCCTCAAGG - Intergenic
1039785097 8:40827731-40827753 CACCTGGCAGGTGGCCCAATTGG + Intronic
1040355078 8:46609185-46609207 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1041583886 8:59494506-59494528 CACCTGGAAGGTGCCCCTCTGGG - Intergenic
1041838252 8:62241620-62241642 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1041900551 8:62978094-62978116 CATCTGGCAGGTGCCCCTCTGGG - Exonic
1042195667 8:66229293-66229315 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1043532521 8:81166421-81166443 CATCTGGCAGGTGTCCCTCTGGG + Intergenic
1044624879 8:94227294-94227316 GGCCTGGCAGATGGCCCATGTGG - Intergenic
1044819383 8:96145383-96145405 GGCCCGGCTGGTGGCCCCCAGGG + Exonic
1044915786 8:97111487-97111509 TGCATTGCAGCTGGCCCTCTGGG - Intronic
1045493129 8:102685647-102685669 GGCATAGCTGGTGGCCATCTGGG + Intergenic
1045599238 8:103694141-103694163 GGCCTGGAGGGTGGGCCTCAGGG + Intronic
1046277891 8:111986337-111986359 CTTCTGGCAGGTGTCCCTCTGGG + Intergenic
1046497848 8:115037115-115037137 GCCCTGGCAGGGGACCCACTAGG + Intergenic
1046886895 8:119377126-119377148 CGTCTGGCAGGTGTCCCTCTTGG + Intergenic
1046906678 8:119581372-119581394 GGCCTGGGAGGCTGACCTCTAGG + Intronic
1046947388 8:119987410-119987432 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1046972459 8:120237993-120238015 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1047381918 8:124372251-124372273 TGCCTGGCAGGAGGACCTCGGGG - Exonic
1048287629 8:133154136-133154158 GGCCTGGCAAGGGGGCCTCCAGG - Intergenic
1048467128 8:134674754-134674776 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1048751474 8:137681724-137681746 GTCATGGCAGGAGGCTCTCTTGG - Intergenic
1049674415 8:143883344-143883366 GGCCTGGGACGTGTCCCCCTGGG + Intergenic
1049763597 8:144342514-144342536 GGTCAGGCAGTTGGACCTCTTGG - Intergenic
1049788794 8:144463572-144463594 GGCCTGGCAGGTGGCCCTCTGGG - Intronic
1050031851 9:1394142-1394164 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1050492470 9:6203295-6203317 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1050637484 9:7627242-7627264 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1051230552 9:14950492-14950514 CGTCTGGCAGGTGCCCTTCTGGG + Intergenic
1051308892 9:15747511-15747533 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1051321858 9:15914023-15914045 TATCTGGCAGGTGTCCCTCTGGG - Intronic
1051353999 9:16224117-16224139 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1051548801 9:18305968-18305990 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1051611556 9:18967125-18967147 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1051695733 9:19766672-19766694 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1052052635 9:23865983-23866005 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1052134167 9:24889540-24889562 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1052241459 9:26278179-26278201 CACCTGGCAGGTGCACCTCTGGG + Intergenic
1052326572 9:27221538-27221560 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1052329469 9:27252247-27252269 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1052366114 9:27614313-27614335 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1052752825 9:32509360-32509382 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1053297008 9:36922408-36922430 GGGCAGGCAGGAGGCCCGCTCGG - Intronic
1054719794 9:68593526-68593548 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1054884829 9:70185261-70185283 CATCTGGCAGGTGGCCCTCTGGG - Intronic
1054889215 9:70233259-70233281 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1054985902 9:71261883-71261905 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1055210393 9:73783771-73783793 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1055677575 9:78680393-78680415 GCCCTCCCAGGTGGCCCTCTCGG - Intergenic
1055987066 9:82063023-82063045 GGCCTGGTGGGAGGCCCTCGGGG + Intergenic
1057482514 9:95456440-95456462 GGGCGGGCAGGTCACCCTCTGGG + Intronic
1058408548 9:104704221-104704243 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1059299262 9:113299116-113299138 GGGCTGCCAGGTGGCCCAGTCGG + Exonic
1059513442 9:114870469-114870491 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1059954672 9:119502937-119502959 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1060031906 9:120221946-120221968 TGCCTCCCAGGTGCCCCTCTGGG + Intergenic
1060215721 9:121737208-121737230 GCCATGGCAAGTCGCCCTCTGGG - Intronic
1060695597 9:125706854-125706876 GGCCCGGCAGGCGGCCCGCCGGG + Intronic
1060696361 9:125712146-125712168 GGCCTGTCTGGTGGCTATCTTGG + Intergenic
1061452791 9:130677682-130677704 GGCCTGGCAGGCAGGCCCCTTGG + Intronic
1061454286 9:130686029-130686051 TGCCTTGCAGGTGGCCTGCTGGG + Intergenic
1061546508 9:131307872-131307894 GGCCTGGCTGGTGGCCCTGATGG + Intronic
1061591791 9:131602728-131602750 GGCCTGAGAGCTGGCCCTTTGGG - Intronic
1061677630 9:132227427-132227449 AGGCTGGCAGGTGGCCCCCATGG + Intronic
1062461496 9:136664339-136664361 GACCAAGCTGGTGGCCCTCTCGG + Intronic
1062473697 9:136717570-136717592 GGCCTGGGAGCCGGCCCTGTGGG - Exonic
1062658127 9:137614630-137614652 GGCCTGGCCGGGGGCTCACTGGG - Exonic
1186369932 X:8936770-8936792 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1186621476 X:11245352-11245374 GGCCTTGTAGGAAGCCCTCTGGG + Intronic
1186960868 X:14735614-14735636 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1187660946 X:21545680-21545702 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1187728977 X:22234170-22234192 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1187784399 X:22867441-22867463 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1188201770 X:27300277-27300299 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1188296443 X:28455945-28455967 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1188561158 X:31470527-31470549 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1189619011 X:42816055-42816077 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1190341373 X:49299389-49299411 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1190533860 X:51407390-51407412 GGCGTGGCCAGTGGCCTTCTGGG - Exonic
1191005157 X:55703184-55703206 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1191133211 X:57037412-57037434 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1191208183 X:57855746-57855768 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1191237969 X:58151377-58151399 CTTCTGGCAGGTGCCCCTCTGGG + Intergenic
1191725753 X:64278949-64278971 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1191787826 X:64935584-64935606 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1191788679 X:64945460-64945482 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1191795743 X:65019295-65019317 CGTCTGTCAGGTGCCCCTCTGGG + Intronic
1191872864 X:65764771-65764793 TATCTGGCAGGTGCCCCTCTGGG - Intergenic
1192128901 X:68529855-68529877 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1192228540 X:69246670-69246692 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1192755746 X:74045981-74046003 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1192922661 X:75723976-75723998 GATCTGGCAGGTGCCCCTTTGGG - Intergenic
1192964258 X:76160073-76160095 CATCTGGCAGGTGTCCCTCTAGG + Intergenic
1193010719 X:76671798-76671820 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1193081500 X:77411418-77411440 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1193525205 X:82580713-82580735 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1193613341 X:83658979-83659001 GGCTTTGCAGGTGGACCTCCTGG + Intergenic
1193646858 X:84080133-84080155 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1193830088 X:86279303-86279325 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1193906669 X:87253310-87253332 CATCTGGCAGGTGTCCCTCTGGG - Intergenic
1194203629 X:90984292-90984314 CATCTGGCAGGTGGCCCTCTGGG + Intergenic
1194643308 X:96428952-96428974 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1195414305 X:104603088-104603110 CATCTGGCAGGTGACCCTCTGGG + Intronic
1195434614 X:104828508-104828530 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1196133474 X:112181942-112181964 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1196159080 X:112462565-112462587 ATACAGGCAGGTGGCCCTCTGGG + Intergenic
1196269715 X:113697288-113697310 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1196435675 X:115672333-115672355 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1197004002 X:121474264-121474286 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1197098259 X:122621227-122621249 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1197157310 X:123284008-123284030 CATCTGGCAGGTGGCCCTATGGG + Intronic
1198295307 X:135281869-135281891 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1199469734 X:148181420-148181442 CACCTGGCAGATGACCCTCTGGG - Intergenic
1199477284 X:148259786-148259808 CATCTGGCAGGTGCCCCTCTGGG - Intergenic
1200096971 X:153669083-153669105 GGGCTGGCAGCTGGGGCTCTGGG - Intergenic
1200333314 X:155320319-155320341 CATCTGGCAGGTGCCCCTCTGGG + Intronic
1200388413 X:155917686-155917708 CATCTGGCAGGTGCCCCTCTGGG - Intronic
1200549461 Y:4559731-4559753 CATCTGGCAGGTGGCCCTCTGGG + Intergenic
1201422213 Y:13812088-13812110 CATCTGGCAGGTGTCCCTCTGGG - Intergenic
1201543268 Y:15132272-15132294 CACCTGTCAGGTGCCCCTCTGGG + Intergenic
1201705180 Y:16928755-16928777 CATCTGGCAGGTGCCCCTCTGGG + Intergenic
1201850861 Y:18478420-18478442 CACCTGGCAGGTGCCCCTCTGGG - Intergenic
1202330689 Y:23749298-23749320 CACCTGGCAGGTGCCCCTGTGGG + Intergenic
1202540080 Y:25920763-25920785 CACCTGGCAGGTGCCCCTGTGGG - Intergenic