ID: 1049788795

View in Genome Browser
Species Human (GRCh38)
Location 8:144463573-144463595
Sequence TGGCCTGGCAGGTGGCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 329}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049788795_1049788806 20 Left 1049788795 8:144463573-144463595 CCAGAGGGCCACCTGCCAGGCCA 0: 1
1: 0
2: 2
3: 35
4: 329
Right 1049788806 8:144463616-144463638 CACCATGTCCCTGGAGAGTAAGG No data
1049788795_1049788801 -8 Left 1049788795 8:144463573-144463595 CCAGAGGGCCACCTGCCAGGCCA 0: 1
1: 0
2: 2
3: 35
4: 329
Right 1049788801 8:144463588-144463610 CCAGGCCAGGCCAGGATATCTGG No data
1049788795_1049788811 28 Left 1049788795 8:144463573-144463595 CCAGAGGGCCACCTGCCAGGCCA 0: 1
1: 0
2: 2
3: 35
4: 329
Right 1049788811 8:144463624-144463646 CCCTGGAGAGTAAGGGCCCAGGG No data
1049788795_1049788804 11 Left 1049788795 8:144463573-144463595 CCAGAGGGCCACCTGCCAGGCCA 0: 1
1: 0
2: 2
3: 35
4: 329
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788795_1049788809 27 Left 1049788795 8:144463573-144463595 CCAGAGGGCCACCTGCCAGGCCA 0: 1
1: 0
2: 2
3: 35
4: 329
Right 1049788809 8:144463623-144463645 TCCCTGGAGAGTAAGGGCCCAGG No data
1049788795_1049788807 21 Left 1049788795 8:144463573-144463595 CCAGAGGGCCACCTGCCAGGCCA 0: 1
1: 0
2: 2
3: 35
4: 329
Right 1049788807 8:144463617-144463639 ACCATGTCCCTGGAGAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049788795 Original CRISPR TGGCCTGGCAGGTGGCCCTC TGG (reversed) Intronic
900323232 1:2095224-2095246 TGGCCTGGCTGGTTTCCCTGAGG + Intronic
900351189 1:2235454-2235476 TGCCATGCCAGGTGACCCTCAGG + Intronic
900415074 1:2531054-2531076 CGAGCTGGCAGGTGTCCCTCAGG + Intergenic
900466852 1:2829952-2829974 TGGCCTGGGATGTGGCCATCAGG + Intergenic
900605429 1:3521599-3521621 TTGCCTGGGAGGTGGCCCCCAGG + Intronic
901056339 1:6450224-6450246 TGGCTTGGCTGGTGCCCCTGAGG - Intronic
901091355 1:6643710-6643732 TGGCCTGGCAGCTATCCCCCGGG - Intronic
901513232 1:9728584-9728606 TGGCCAGGGAGGTGCCCCGCGGG - Exonic
902549752 1:17212259-17212281 TGGCCTGCCAGGAGCCCCACAGG - Intronic
903054823 1:20628441-20628463 TGGCCTGTGACATGGCCCTCAGG - Intergenic
903071234 1:20727909-20727931 TGCTCTGGTGGGTGGCCCTCAGG - Intronic
903226602 1:21897290-21897312 TGGCCTGGCATGAGGGCCTCAGG + Intronic
903294005 1:22332241-22332263 GGGCCTGGCTGGGGGCCCTTGGG - Intergenic
903658981 1:24965542-24965564 TGGCATGGCAGGGAGCTCTCCGG - Intergenic
903944253 1:26951837-26951859 GGGCTGGGGAGGTGGCCCTCGGG + Exonic
904606636 1:31701499-31701521 TGGCCTTGCTGGGTGCCCTCTGG - Intronic
905646203 1:39626567-39626589 TGGCCTCCCAGCTGGCCCTGGGG + Exonic
905885648 1:41490518-41490540 AGGCCTGGCAGGGAGACCTCTGG - Intergenic
908363204 1:63390318-63390340 GGGCCTGGAATGTGGGCCTCAGG + Intronic
911691959 1:100845020-100845042 TCACCTGGCGGGTGCCCCTCTGG - Intergenic
912431394 1:109630188-109630210 GGGCCTGTCAGGTGGCCCCGAGG - Intronic
917584894 1:176416546-176416568 GCACCTGGCAGGTGCCCCTCTGG - Intergenic
917731731 1:177881358-177881380 TGGCCCTGCAGGAGGCACTCTGG + Intergenic
917735455 1:177915893-177915915 TGGCCTGGCTCGTTGCTCTCAGG + Intergenic
918360307 1:183750942-183750964 GCACCTGGCAGGTGCCCCTCTGG - Intronic
918631994 1:186729976-186729998 GCACCTGGCAGGTGCCCCTCAGG - Intergenic
922019555 1:221689619-221689641 TGGCCAGGCAGGTCGCTGTCAGG + Intergenic
922695624 1:227729535-227729557 TGGCCTTGGATGTGGCTCTCAGG + Intronic
923306996 1:232697448-232697470 TGTCCTGGAAGCTGGCTCTCGGG + Intergenic
923357679 1:233176671-233176693 TGGCCACTTAGGTGGCCCTCAGG - Intronic
923435088 1:233960508-233960530 TCGCCTGGCAGATGGCTCTCTGG + Intronic
924490855 1:244536065-244536087 GGGCCTGGCATGGGGGCCTCAGG + Intronic
1062910797 10:1210777-1210799 AAGCCTGGCAGGTGGGCCTCAGG + Intronic
1063093635 10:2890234-2890256 GCGCCGGGCAGGTGGCCCTCCGG - Intergenic
1063257176 10:4340943-4340965 TGGCCTGGCAGGCAGGCCTCTGG + Intergenic
1064162868 10:12960769-12960791 TGACCTGGCAGGCGGAGCTCAGG - Intronic
1067429877 10:46236030-46236052 TGGCCTGGCAGGAGACCCCTGGG - Intergenic
1067443763 10:46327789-46327811 TGGCCTGGCAGGAGACCCCTGGG + Intronic
1069060000 10:63885421-63885443 TGGCCTGGCAAGTAGTCCTTAGG + Intergenic
1071911395 10:90238388-90238410 TGCCCTGAGAGGTGGGCCTCAGG - Intergenic
1072902366 10:99419688-99419710 TGGCCTGGCATGGGGTCCACAGG + Intronic
1073465639 10:103693244-103693266 CGGGCTGGCAGGGGGCCCGCGGG - Intronic
1075722937 10:124597967-124597989 TGGGCTAGCAGGTGGCCGGCAGG - Intronic
1076138161 10:128058883-128058905 TGGGCAGGCATGTGGCCCTGGGG + Intronic
1076215557 10:128690884-128690906 TGCCCTGGAAGGTGACCATCTGG - Intergenic
1076342660 10:129760157-129760179 AGGCCTGGCAGCTGGGCCGCGGG + Intronic
1076685914 10:132198451-132198473 TGGCTGAGCACGTGGCCCTCGGG - Exonic
1076862095 10:133142696-133142718 TGACCGGGGAGGTGGCCGTCAGG - Intergenic
1077032828 11:477404-477426 GGGCCTGGGGGGTGGCCCTGGGG + Intronic
1077105275 11:839481-839503 TGGGTTGGGAGGTGGCCCTAAGG - Intronic
1077230490 11:1456296-1456318 TGGCCTGGCAGGTCCCACCCTGG - Intronic
1077457685 11:2690765-2690787 TGGCCTGGCAGGGGGTCAGCAGG + Intronic
1078367202 11:10716713-10716735 AGGTCTGGCAGGTTCCCCTCTGG + Intergenic
1079935716 11:26614009-26614031 TGGCCTGACAGCTGGTCCTGTGG - Intronic
1082774727 11:57236399-57236421 GGGCCTGGGAGGTGGGCCTTGGG - Exonic
1083298042 11:61725803-61725825 TGGCCTGGCTGCTGGCCAGCAGG - Intronic
1083619172 11:64040525-64040547 TGTCCTTGCAGATGGGCCTCTGG + Intronic
1083655610 11:64227740-64227762 TGGGCTGGCAGGAGGCCTGCAGG + Intronic
1083724277 11:64620185-64620207 AGGCCTGGCAGCAGGCCCTGGGG + Intronic
1083736265 11:64683083-64683105 TGGCCAGGGAGATGGCCTTCTGG - Intronic
1084188306 11:67486984-67487006 TGACCTCGCATGTGGCCCACAGG + Exonic
1084266591 11:68008332-68008354 TGGCCAGGGAGGGGACCCTCGGG + Intergenic
1084302758 11:68262080-68262102 TGGGCTGGCAGTTGGCTCCCTGG + Exonic
1084459213 11:69286890-69286912 TGGCCTGGCTGGTGGAGCCCTGG + Intergenic
1084514150 11:69626918-69626940 GGGCCAGGAAGGTGGCACTCTGG - Intergenic
1084717683 11:70883952-70883974 TGGCCCAGCAGGTTGGCCTCTGG - Intronic
1084778834 11:71395778-71395800 TGGCCTGGCAGCAGGACCCCTGG + Intergenic
1089160307 11:116432243-116432265 TGGCCTGGGAGGTGGGTCTTCGG - Intergenic
1091219349 11:133920880-133920902 TGGCCTGGAAGGTCGGCTTCAGG - Exonic
1095777186 12:46023384-46023406 TGGCCTGGCAGGGGGAGCTGGGG - Intergenic
1096580532 12:52581833-52581855 TAGCCTGGCAGGTGTGCCTCAGG + Intergenic
1096685914 12:53288208-53288230 TGGCCTGGTCACTGGCCCTCTGG - Exonic
1098704679 12:73672160-73672182 GCGTCTGGCAGGTGTCCCTCTGG + Intergenic
1099573750 12:84357100-84357122 TGCTATGGCTGGTGGCCCTCGGG + Intergenic
1099983032 12:89628852-89628874 TGGCCTGGACTGTGGCCGTCTGG - Intronic
1100046091 12:90382963-90382985 AGTCCTGGCAGGTGGCTTTCAGG - Intergenic
1100608409 12:96170522-96170544 TAGACTGGCAGGCGGCCCTCGGG + Intergenic
1101225082 12:102680247-102680269 TGCCCTGGGAGGAGGCCATCTGG + Intergenic
1102562056 12:113769393-113769415 TGTCCTTGCAGCTGGCCCTGGGG - Intergenic
1103888611 12:124221654-124221676 TGGCCGGGCGGGCGGGCCTCAGG - Intronic
1104013337 12:124947294-124947316 GGGCCTGGCTGGGGGCCCCCAGG - Exonic
1104811142 12:131621090-131621112 TGGCCTGGGAGGTGGCCCCAGGG - Intergenic
1105284618 13:18994075-18994097 TGGCCTGGCTTCTGGCCTTCTGG - Intergenic
1105446593 13:20462249-20462271 TGGCCTGGTGGGAGGCCCTGGGG + Intronic
1108574856 13:51782217-51782239 TGGGCTGGAAGGGGGCCCTTGGG + Intronic
1112165935 13:96919477-96919499 GCACCTGGCAGGTGCCCCTCTGG + Intergenic
1112325307 13:98439675-98439697 GGGCCTGGGATGTGGCCCTTTGG + Intronic
1112652497 13:101415575-101415597 TGGCCTGGCTGGGATCCCTCTGG - Intronic
1113952729 13:114080712-114080734 TGCCCTGGGAGGTGGCCCCTGGG - Intronic
1114616163 14:24069477-24069499 GGGGCTGGCAGGGGGCCCTGGGG - Exonic
1116222325 14:42104254-42104276 TGTACTGGCAGGTGCCCCTATGG + Intergenic
1117624192 14:57618657-57618679 TGGCATTGCAGGTGCCCCTGGGG - Intronic
1119900684 14:78257040-78257062 TGACCTGCCAGGTGGCTCTGAGG + Intronic
1122125121 14:99574726-99574748 TGACCCGGCTGGTGCCCCTCGGG - Intronic
1122921863 14:104883637-104883659 TGACCAGGCAGGTGGCTCTTAGG - Intronic
1124821018 15:33045342-33045364 CAGCCTGGCAGGCTGCCCTCGGG - Intronic
1126053374 15:44707534-44707556 TGGCCTGGAATGTGGGCCTCAGG + Intronic
1129329348 15:74819060-74819082 TGGGATGGCAGGTGGCCCTAGGG - Intronic
1129543122 15:76367547-76367569 TGACCTGGCAGCAGCCCCTCAGG + Intronic
1130975208 15:88768589-88768611 TGGCCTGTCCAGTGGCCCTCAGG - Intergenic
1131391962 15:92057049-92057071 TTGCCTGGCAGTTGCCCTTCTGG + Intronic
1132298704 15:100763436-100763458 TGGCCTGGCTGGTGGCCATCTGG - Intergenic
1132505784 16:307981-308003 TGGCCTGTCAGGTGGGGCTGTGG - Intronic
1132510815 16:340475-340497 TGGCCCACCAGGTGGCCTTCAGG - Intronic
1132766636 16:1537625-1537647 TGGCATGTGAGGTGGACCTCAGG - Intronic
1132804499 16:1769309-1769331 TGCCCAGGGAGGTGGGCCTCAGG + Exonic
1132940945 16:2507849-2507871 TGGCCTGGGAGGTGGGGCGCAGG + Intronic
1134269428 16:12720692-12720714 TGGCCAGGCTGGTTGACCTCAGG + Intronic
1134291302 16:12904142-12904164 TGGCCTGGCCGGTGGGGCTGGGG - Intronic
1135374541 16:21934325-21934347 TTGCCTGCCAGGTGGCCATAGGG + Intergenic
1136580016 16:31145785-31145807 TCACCTGGCAGGTGTCCCTGCGG + Exonic
1137565921 16:49532443-49532465 TGGCCTGGGAGGGTGCCCCCAGG - Intronic
1137594918 16:49717113-49717135 AGGCCAGGCAGGTGTCCCTGGGG + Intronic
1138488764 16:57363888-57363910 AAGCCTGGCATGTGGCCCTCTGG + Exonic
1139648148 16:68346938-68346960 TGGACTGGAAGGTGGCCTGCAGG + Intronic
1141948758 16:87327282-87327304 TGGCCTGCCTGCCGGCCCTCAGG - Exonic
1141954125 16:87358834-87358856 TGTCCTGGCAGGTGAGCATCTGG + Intronic
1142131191 16:88432291-88432313 TGGCCTGGCAGGTGCGCCGTTGG - Exonic
1144682796 17:17206413-17206435 TGGCCTGGCGCGTGGCCATGGGG - Intronic
1144682850 17:17206609-17206631 CGGCCTAGCGCGTGGCCCTCGGG - Intronic
1144726234 17:17504059-17504081 AGCCCAGGCAGGTGGCCTTCAGG - Intergenic
1144726857 17:17506534-17506556 TGGCCTGGCTGGGTTCCCTCAGG + Intronic
1144756632 17:17683469-17683491 TTTCCTGGGACGTGGCCCTCGGG + Intronic
1145255475 17:21319882-21319904 TGGCTTGGCAGGTGGCTCACTGG - Intergenic
1145321137 17:21768070-21768092 TGGCTTGGCAGGTGGCTCACTGG + Intergenic
1145909297 17:28533335-28533357 TGGGCGGGCAGGGGGCCCACTGG + Intronic
1148555530 17:48576746-48576768 GGGCCGGCCAGGGGGCCCTCCGG + Exonic
1148589456 17:48804956-48804978 TGGCCTGGGAGGAGGCTCTGGGG + Exonic
1148848360 17:50541935-50541957 GGGCCTGGCAGGCGGGCCTGTGG + Exonic
1151563758 17:74885532-74885554 TGGTCTGGCAGGAGGGCTTCCGG - Intronic
1151694131 17:75705467-75705489 TGGGCATGCTGGTGGCCCTCTGG + Intronic
1151807417 17:76414738-76414760 TGGCCTGGCAGGGGGCCAGCGGG + Intronic
1152576771 17:81144525-81144547 GGGCCGGGCAGGGGGCCCGCAGG + Intronic
1152828660 17:82483832-82483854 GGGCCTGGCAGGTGGCTGGCAGG - Intronic
1152868620 17:82738514-82738536 TGGCCAGCCTGGAGGCCCTCAGG + Exonic
1153903617 18:9640630-9640652 TAGCCTGGAAAGAGGCCCTCAGG + Intergenic
1154207186 18:12347279-12347301 TGGCCTGGCAGATGGACTTGAGG - Intronic
1155403644 18:25464894-25464916 TGGCCTGGCTGGAGTCGCTCAGG + Intergenic
1157595100 18:48859568-48859590 GGGCCTGGCAGGCGGCCCACGGG + Exonic
1160727447 19:623638-623660 TGGGAGGGCAGGTCGCCCTCTGG - Intronic
1161651733 19:5489982-5490004 TGTCCTGACAGGGGTCCCTCTGG - Intergenic
1161971306 19:7582438-7582460 TGGCCTCCTTGGTGGCCCTCCGG + Intergenic
1163113810 19:15177745-15177767 TGGCCTGGCAGGCGGCGCGCGGG + Exonic
1163668623 19:18614526-18614548 TGACCTGGGAGGTTGCCCCCTGG - Intronic
1163673352 19:18642273-18642295 TGGTCAGGCAGGTGGCTCTGAGG - Intronic
1164692631 19:30222588-30222610 CGGCCGGGCAGGGGGCTCTCCGG - Intergenic
1165328692 19:35128877-35128899 CAGCCTGGCCGGTGGCCCTGAGG - Intronic
1165333852 19:35155640-35155662 TGGCCTGGCTGGGGGCTCTGGGG - Intronic
1165463381 19:35958061-35958083 TGCTCTGGCAGGTGACCCCCGGG + Intergenic
1165728730 19:38130613-38130635 TCGCCTGGCAGGCCGGCCTCCGG + Exonic
1165958509 19:39516263-39516285 AGGCCTGGCACTTGGCCCGCGGG - Intronic
1166831786 19:45643695-45643717 AGGCCGCGCAGCTGGCCCTCTGG + Intronic
1167090536 19:47340975-47340997 TGGCTGGGAAGGTGGCCCGCCGG + Exonic
1167485956 19:49763118-49763140 TGGCCCGGCTGGTCACCCTCCGG + Exonic
1167515692 19:49921971-49921993 TGGCCTGGCCTGGGGCCCTAGGG - Intronic
925578537 2:5385355-5385377 TGGCGTAGCAGGTGGCCTGCTGG - Intergenic
927948036 2:27149150-27149172 TGGCATGGCTGGTGGCCCTCTGG - Exonic
928381739 2:30823953-30823975 TGGCATGGCATGTGCCCCACAGG - Intergenic
929534210 2:42770368-42770390 CGGCCTGGCAGTGGGCTCTCTGG + Intronic
931074041 2:58689251-58689273 GCGTCTGGCAGGTGCCCCTCTGG + Intergenic
932815248 2:74856030-74856052 TGCCCTGGCAGCTGCCCCTTGGG - Intronic
934612522 2:95751813-95751835 TGGCCTGGCCAGTGTCCCTCAGG - Intergenic
934841629 2:97627631-97627653 TGGCCTGGCCAGGGTCCCTCAGG + Intergenic
937097851 2:119247457-119247479 TGGCTTGGCAGGTGGGCCAGAGG + Intronic
937295741 2:120808797-120808819 TGGCCTGGCATGTGGGCAGCGGG + Intronic
937393084 2:121509508-121509530 TGGCCTGGCATGTGGACTCCTGG - Intronic
940004523 2:148998704-148998726 TGGCATGGCAGGTGGCAGGCGGG + Intronic
940261292 2:151782070-151782092 TGGCCAGGAAGGTGGTCCTGGGG + Intergenic
945628171 2:212237459-212237481 GCATCTGGCAGGTGGCCCTCTGG - Intronic
945977111 2:216279635-216279657 TGGCCTGGCCAGTGGCCTCCAGG + Intronic
946161742 2:217839863-217839885 TGGCCCAGCAGGTGGCCTCCCGG - Intronic
947143648 2:227043114-227043136 TGGCCTTCCAGGTGATCCTCTGG + Exonic
947530444 2:230905759-230905781 TGGCCTGGGAGGGAGCGCTCAGG + Intergenic
947989508 2:234475590-234475612 TGGCCTGCCAGGATGACCTCAGG + Intergenic
948256101 2:236568929-236568951 TGGGCTGGCGGGTGGCCTTTGGG + Intronic
948464481 2:238145666-238145688 TCTCCCGGCAGGTGGCTCTCGGG + Exonic
948796197 2:240403082-240403104 TGGCCTGGCAGGAGGCCCCGCGG + Intergenic
948878257 2:240841543-240841565 TGGGCTGGGAGCTGGCCCTCAGG + Intergenic
948888518 2:240895944-240895966 TGGCCGTGCAGGTGCCCCTGTGG - Exonic
1169355221 20:4899616-4899638 TGAGCTGGCTGGTGGCCCACTGG + Exonic
1170727252 20:18941229-18941251 TCACCTGGCAGGGGCCCCTCTGG - Intergenic
1171345475 20:24462597-24462619 TGGCATGGCAGCTGGTCCTTAGG - Intergenic
1171406908 20:24917871-24917893 TGGCCTGCCTGGTGGCCACCTGG - Intergenic
1171769965 20:29314721-29314743 TGGCCGCGCTGGAGGCCCTCAGG + Intergenic
1175189107 20:57199256-57199278 TGGGCTGACAGGTACCCCTCGGG - Intronic
1175883188 20:62272217-62272239 GGGGCTGGCAGGAGGCCCTGTGG - Exonic
1175955724 20:62608148-62608170 TGGCCATGCAGGGGACCCTCAGG + Intergenic
1176125760 20:63473748-63473770 TGTCCTGGGAGGGGTCCCTCTGG + Intergenic
1179821535 21:43940036-43940058 TGGCCACGCAGGTGGCACCCTGG + Intronic
1179955366 21:44735310-44735332 TGGCCTGCCAGTCGGGCCTCAGG - Intergenic
1180189283 21:46154893-46154915 AGGCCTTCCAGGTGGCCCTTAGG + Intronic
1180605737 22:17057704-17057726 TGACCTGGCCAGTGGCCTTCAGG + Intergenic
1180843350 22:18969431-18969453 TGGCCATGGAGGTGGCCCTGAGG - Intergenic
1180917696 22:19500218-19500240 TGTCCTGGTTGGTGGCCCTTTGG + Intronic
1181058123 22:20269304-20269326 TGGCCATGGAGGTGGCCCTGAGG + Intronic
1181514665 22:23403753-23403775 TGGCCATGGAGGTGGCCCTGAGG + Intergenic
1181804363 22:25366145-25366167 TGCCCAGGCTGGTGGCTCTCGGG - Intronic
1182603879 22:31489204-31489226 TGGCCTGGCGAGGGGCGCTCGGG - Intronic
1182614186 22:31575345-31575367 TGGCCAGGAAGATGGCCCTGCGG + Exonic
1183120874 22:35729032-35729054 TGGCGTGGCAGGTGGCCGGATGG - Intronic
1183481020 22:38065618-38065640 TGGCCTGGGAGGGGGGTCTCTGG - Intronic
1183486412 22:38089524-38089546 TGTCCAGGCAGGTGGGCGTCAGG + Exonic
1184747769 22:46465927-46465949 TGCTCTGCCAGGTGGCCTTCAGG + Intronic
1185152053 22:49169422-49169444 CACCCTGGCAGCTGGCCCTCTGG - Intergenic
1185182828 22:49372963-49372985 CGGCCTGGCAGTCGGCACTCAGG - Intergenic
1185231715 22:49687599-49687621 GGGCCTGGGAGGTGGCGCTCCGG - Intergenic
1185332126 22:50256569-50256591 CTGCCTGGCAGGGGGCCCTGAGG - Intronic
1185402717 22:50627079-50627101 TGGGCTGGCAGGTGGGGCTGCGG + Intronic
950024123 3:9809272-9809294 GGGCCTGGCAGATGGGCCTAGGG - Intronic
950400389 3:12765385-12765407 TGGCCTTGCAGGCAGCCCTTGGG + Intronic
950572796 3:13812314-13812336 TGGGCAAGCAGGCGGCCCTCAGG + Intergenic
950576527 3:13835372-13835394 TGGCCAGGCGGGTGGTCCTCTGG - Intronic
951324385 3:21285117-21285139 GCGTCTGGCAGGTGACCCTCTGG - Intergenic
951437031 3:22676699-22676721 GGGCCTGGCATGGGGTCCTCAGG + Intergenic
953021835 3:39119493-39119515 TGGCCTGGCAGGCTGCACTGTGG + Intronic
954199131 3:49013889-49013911 TGGCACCCCAGGTGGCCCTCAGG + Exonic
954384437 3:50236881-50236903 GGGCCTGGCAGGGGCCCCGCGGG - Intronic
954875556 3:53800750-53800772 TGGGCTGGCTGGTGGCCCCAAGG - Intronic
955439827 3:58943331-58943353 GCGTCTGGCAGGTGCCCCTCTGG + Intronic
958264384 3:91420719-91420741 TGGCCAGGCTGGTGGGCCTCAGG - Intergenic
958419502 3:93914523-93914545 TGGTCCTGCAGGTGCCCCTCTGG + Intronic
961323963 3:126098825-126098847 ACTGCTGGCAGGTGGCCCTCTGG + Intronic
961808152 3:129503849-129503871 TGGCCTGACAGGTGGTTCTGGGG + Intronic
962981136 3:140491161-140491183 TGGCCAGTCTGGTGCCCCTCCGG + Intronic
963908203 3:150791641-150791663 GGGCCTGGAAGCTGGCTCTCAGG - Intergenic
964582940 3:158260365-158260387 TGGCCTGGAATGGGGGCCTCAGG + Intronic
965654962 3:170974654-170974676 AGCTCTGGCAGGTGCCCCTCTGG - Intergenic
967114160 3:186321623-186321645 TTGCCTTGCAGTTGGCCCTCAGG - Intronic
967303119 3:188036399-188036421 TTGCATGGCATCTGGCCCTCAGG + Intergenic
968704031 4:2069824-2069846 TGCCCTGGCAGGTCCCCGTCAGG + Intergenic
968816653 4:2824949-2824971 TGTCCTGGGAGGTGCCCCTGTGG + Intronic
968962523 4:3752782-3752804 TGGCCTGGCAGGGAGGGCTCTGG + Intergenic
969265912 4:6063985-6064007 TGCCGGGGCAGCTGGCCCTCAGG - Intronic
969301501 4:6299995-6300017 TGGCCTGGCAGCTGCTTCTCAGG + Intronic
969488448 4:7485469-7485491 AGGCCCGGCAGGGGGCCCTGGGG - Intronic
969578996 4:8052973-8052995 TGGCCTGGCCTGTGGGCCTTAGG + Intronic
969675599 4:8612718-8612740 TGGTCTGGCGGGTACCCCTCAGG - Intronic
969756478 4:9153381-9153403 TCCCCTGGCAGGTGGCCGGCGGG + Intergenic
971197887 4:24486773-24486795 TGGCCTAGGAGATGGCCTTCTGG - Intergenic
971804776 4:31341771-31341793 TGGCCTGGCTGGTGGTTCCCTGG + Intergenic
972316702 4:37933797-37933819 TGGGATGCCTGGTGGCCCTCTGG + Intronic
972772595 4:42211481-42211503 TGGCCTGGCAGTGGGACCTGAGG - Intergenic
974793089 4:66714664-66714686 GCGTCTGGCAGGTGCCCCTCTGG + Intergenic
974975452 4:68886055-68886077 ACATCTGGCAGGTGGCCCTCTGG + Intergenic
976716674 4:88130235-88130257 TGACCTGACAGGTGGAGCTCAGG - Intronic
986477662 5:8152276-8152298 TGGCCTGGGAGGTGGCGATGTGG - Intergenic
986547039 5:8908675-8908697 TGACTTGACAGGTGGCCCACTGG + Intergenic
987018574 5:13846455-13846477 TGCCCTGGGAGGTTGCCATCAGG - Intronic
987924001 5:24317347-24317369 GCACCTGGCAGGTGCCCCTCTGG - Intergenic
989267017 5:39486625-39486647 TGACCTGGCAGCTGACCCGCTGG - Intergenic
990611497 5:57461464-57461486 TGGCCTGTCACCTGGGCCTCTGG - Intergenic
993895071 5:93523612-93523634 GGATCTGGCAGGTGCCCCTCTGG + Intergenic
995695823 5:114876983-114877005 GGATCTGGCAGGTGCCCCTCTGG + Intergenic
997466099 5:134089139-134089161 TGTCCCTGCAGGTGGCCATCTGG - Intergenic
998131999 5:139655967-139655989 AGGCCTGCCTGGTGGCCCCCGGG + Intronic
998139072 5:139689898-139689920 AGGCCTGGGAGGTGGCCACCTGG - Intergenic
998307918 5:141096978-141097000 TGCCCTGGAAAGGGGCCCTCGGG - Exonic
998308554 5:141102831-141102853 TGCCCTGGAAAGGGGCCCTCGGG - Exonic
998310461 5:141124177-141124199 TGCCCTGGAAAGGGGCCCTCGGG - Exonic
998311618 5:141137613-141137635 TGCCCTGGAAAGGGGCCCTCGGG - Exonic
998313593 5:141158182-141158204 TGCCCTGGAAAGGGGCCCTCGGG - Intergenic
998315662 5:141180219-141180241 TGCCCTGGAAAGGGGCCCTCAGG - Exonic
998319027 5:141211089-141211111 TGTCCTGGAAAGGGGCCCTCAGG - Exonic
998319593 5:141216305-141216327 TGCCCTGGAAGGGGGCCCTCGGG - Exonic
998322804 5:141247760-141247782 TGCCCTGGAAAGGGGCCCTCGGG - Exonic
999125013 5:149240132-149240154 GGGGCTGGCAGGTGGCCCTGTGG + Intronic
999468741 5:151831907-151831929 GCACCTGGCAGGTGCCCCTCTGG + Intronic
999709232 5:154301801-154301823 CAGCCTGGCAGATGGACCTCTGG + Intronic
1001330659 5:170760196-170760218 TGGTCTGGCAGGGGCCCCTGTGG + Intergenic
1001577513 5:172773790-172773812 TCGCCGGGCAGGTGACCCACTGG - Intergenic
1002416829 5:179125169-179125191 TGCCCTGGCAGGTGGGTCACAGG - Exonic
1002435830 5:179230209-179230231 TGGGCAGGCAGGGTGCCCTCGGG + Intronic
1002934801 6:1662351-1662373 TGACATGGCAGGAGGGCCTCTGG + Intronic
1003057088 6:2831684-2831706 TGGACTGGCAGATGGCCCTGGGG + Intergenic
1003174837 6:3746738-3746760 TGGCTTTGCAGTTGGCCATCGGG + Intronic
1003472637 6:6451580-6451602 TGGGCATGCAGGTGCCCCTCTGG - Intergenic
1006599239 6:35214535-35214557 TGTCCTGGCTGCTGGGCCTCAGG + Intronic
1006699854 6:35963221-35963243 TGGCCTGTCAGATGGTCATCAGG - Intronic
1006807743 6:36799526-36799548 TGGCCTGGCTGATGGGGCTCAGG - Intronic
1006898413 6:37484912-37484934 TGGCATGCCAGCTGCCCCTCGGG - Intronic
1008991059 6:57602265-57602287 TGGCCAGGCTGGCGGGCCTCAGG + Intronic
1009179581 6:60500502-60500524 TGGCCAGGCTGGCGGGCCTCAGG + Intergenic
1012597035 6:101053531-101053553 GCACCTGGCAGGTGCCCCTCTGG - Intergenic
1013285723 6:108679743-108679765 GGCCTTGACAGGTGGCCCTCAGG + Intronic
1014737670 6:125113058-125113080 TGGCCTGACAGCTGGTCCTGTGG - Intergenic
1016761142 6:147738943-147738965 TAAACTGGCAGGTGGCCCACAGG - Intergenic
1018143746 6:160864139-160864161 GGGACTGGCAGGAGGCCCGCTGG - Intergenic
1018179122 6:161205240-161205262 TGGCTTGGCACAAGGCCCTCTGG - Intronic
1018815129 6:167324912-167324934 GGGACTGGCAGGAGGCCCACTGG + Intergenic
1019077137 6:169396722-169396744 TGGCATGGCAGCTGGCCTGCTGG - Intergenic
1020001923 7:4761130-4761152 TGGCCAGCCAGATGGCCCCCGGG + Exonic
1020186406 7:5962559-5962581 TTCCCTGGCAGGTGCCCCTGGGG - Intronic
1020296508 7:6762215-6762237 TTCCCTGGCAGGTGCCCCTGGGG + Intronic
1021014750 7:15518430-15518452 GCATCTGGCAGGTGGCCCTCTGG + Intronic
1021801214 7:24308781-24308803 TGCCCTGGCACTTGGCCTTCAGG + Intergenic
1022421378 7:30226690-30226712 GGGCTTGGCAGGTGCCTCTCTGG - Intergenic
1023489164 7:40719480-40719502 TCCCCTGGCATGTGGCTCTCCGG - Intronic
1023583356 7:41704948-41704970 TGGCCTGGCAGGTGGGCACTCGG - Intergenic
1024228079 7:47343504-47343526 TGGGCTGGCATCTAGCCCTCTGG - Intronic
1024231983 7:47369529-47369551 TGGCATCCCAGGTGGCCCCCAGG - Exonic
1024925118 7:54604510-54604532 GAGCCAGGAAGGTGGCCCTCCGG + Intergenic
1026521804 7:71124211-71124233 TTGCCAGGCAGGTGGGCCTTGGG + Intergenic
1026654653 7:72246471-72246493 TAGCCTGGCAGGTGACACTGGGG - Intronic
1030097079 7:105909966-105909988 TGGCCTGACACGTGACCCACTGG + Intronic
1034192277 7:149221853-149221875 TGGCCTGGGAAGTGGCCTCCGGG + Intronic
1034335974 7:150323624-150323646 TGGCCCAGCAGGTGGCCCCCCGG - Intronic
1034447494 7:151121065-151121087 TGGCCTGGCTGGCCGCACTCGGG - Intronic
1035029485 7:155848246-155848268 GGCCCTGGCAGGAGGCCCTGAGG + Intergenic
1035524122 8:298906-298928 TGGCCTGGAAGGTGGTCCCGTGG - Intergenic
1036626036 8:10472346-10472368 AGGAGTGGCAGGTGACCCTCAGG - Intergenic
1036633875 8:10534287-10534309 TGGCCTGGCTGGAGATCCTCAGG + Intronic
1036769796 8:11571185-11571207 GGGCCTGTCCAGTGGCCCTCAGG + Intergenic
1036798256 8:11771125-11771147 TGGTGTGGCAGGTGCCGCTCAGG + Intronic
1037766386 8:21774902-21774924 TGGCATGGCAGATGGAGCTCTGG - Intronic
1038083225 8:24163902-24163924 GCACCTGGCAGGTGCCCCTCTGG - Intergenic
1038211662 8:25523801-25523823 GCATCTGGCAGGTGGCCCTCTGG + Intergenic
1038401522 8:27287943-27287965 ACGCCTGGGAGGTGGCCCTTGGG - Exonic
1038452345 8:27647922-27647944 TGGCATGGCATTTGGGCCTCAGG + Intronic
1040934532 8:52768612-52768634 TGGCCAGGGAGGAGGACCTCAGG - Intergenic
1041543002 8:59008505-59008527 TGGCCTGCCACGTGGACCTCCGG - Intronic
1044717368 8:95112927-95112949 TGGCCTGGCAGTGGGCCATCTGG - Intronic
1044819382 8:96145382-96145404 CGGCCCGGCTGGTGGCCCCCAGG + Exonic
1045599237 8:103694140-103694162 TGGCCTGGAGGGTGGGCCTCAGG + Intronic
1047381919 8:124372252-124372274 CTGCCTGGCAGGAGGACCTCGGG - Exonic
1047539225 8:125748040-125748062 TGGTGGGGCAGGTGGCCCACAGG + Intergenic
1049202203 8:141345873-141345895 TGGCCTGGCAGGTGGGCACAAGG - Intergenic
1049371177 8:142268139-142268161 TGGAATGGCAGGTGGCACGCAGG - Intronic
1049679319 8:143910599-143910621 TGGGGTGGCACGTGGTCCTCAGG - Intergenic
1049788795 8:144463573-144463595 TGGCCTGGCAGGTGGCCCTCTGG - Intronic
1049998468 9:1052098-1052120 TGGCCGCCCAGGTGGCGCTCCGG + Exonic
1054333860 9:63785285-63785307 TGTCCTGGCTCGTGCCCCTCAGG + Intergenic
1054884830 9:70185262-70185284 GCATCTGGCAGGTGGCCCTCTGG - Intronic
1055091152 9:72365414-72365436 TGGCCTGGCAGTCGGCCCCTAGG + Intergenic
1055390863 9:75821127-75821149 GGATCTGGCAGGTGCCCCTCTGG - Intergenic
1055987065 9:82063022-82063044 GGGCCTGGTGGGAGGCCCTCGGG + Intergenic
1057482513 9:95456439-95456461 TGGGCGGGCAGGTCACCCTCTGG + Intronic
1057844771 9:98514961-98514983 TGGCGTGGCACCTGGGCCTCAGG + Intronic
1059555517 9:115276616-115276638 TGGCCTGGAATGGGGACCTCAGG + Intronic
1060695596 9:125706853-125706875 GGGCCCGGCAGGCGGCCCGCCGG + Intronic
1061226743 9:129284859-129284881 GGGCTTGGCAGGTGGGCATCAGG + Intergenic
1061227755 9:129290655-129290677 TGACCTGCCAGGTGATCCTCGGG - Intergenic
1061868805 9:133509227-133509249 TGGCCTGGCAGGGGGCCCCAGGG + Intergenic
1062044452 9:134418574-134418596 TGGCCTGGAACTGGGCCCTCTGG + Intronic
1062076213 9:134591337-134591359 TTGCCTGGCACCTGGCCCTGGGG - Intergenic
1062387601 9:136319190-136319212 GGGACTGGCATGTGCCCCTCTGG + Intergenic
1062450682 9:136614500-136614522 TGGCCTGGCTGGTGACTCACAGG - Intergenic
1062461123 9:136662972-136662994 AGGCCAGGCAGGTGGGCCTCAGG + Intronic
1187697821 X:21939228-21939250 TGGCAGCACAGGTGGCCCTCGGG - Intergenic
1187940434 X:24375835-24375857 TGGGCTGGCTGGGTGCCCTCCGG - Intergenic
1188716436 X:33464540-33464562 GGGCCTGGAATGTGGGCCTCAGG + Intergenic
1189555071 X:42134828-42134850 TGATCTGTCTGGTGGCCCTCTGG + Intergenic
1190119734 X:47650325-47650347 TGGCTTGGCCGGTGGCCTGCTGG - Intronic
1191714365 X:64184194-64184216 TGGCCTGGGAAGGGGCCCTAGGG + Intergenic
1194203628 X:90984291-90984313 GCATCTGGCAGGTGGCCCTCTGG + Intergenic
1196159079 X:112462564-112462586 TATACAGGCAGGTGGCCCTCTGG + Intergenic
1197024944 X:121737657-121737679 GGGCCTGGCATGGGGGCCTCAGG - Intergenic
1197099604 X:122636910-122636932 GGGCCTGGAATGTGGACCTCAGG + Intergenic
1197382795 X:125765949-125765971 AGGCCTGGAATGGGGCCCTCAGG + Intergenic
1198286294 X:135194873-135194895 GGAGCTGGCAGGTGTCCCTCTGG + Intergenic
1198299153 X:135317617-135317639 TGGCCTGGAAACTGGCCCACAGG + Intronic
1198544949 X:137681564-137681586 TGGCCTGGAAGGTGGCCAGGAGG - Intergenic
1199685431 X:150260981-150261003 AGGCCTGGGAGGTGGCTCTGAGG + Intergenic
1199736933 X:150693719-150693741 TGGCCTCGCGCGGGGCCCTCGGG - Intronic
1200096972 X:153669084-153669106 TGGGCTGGCAGCTGGGGCTCTGG - Intergenic
1200123781 X:153803838-153803860 GAGCTTGGCCGGTGGCCCTCGGG - Exonic
1200549460 Y:4559730-4559752 GCATCTGGCAGGTGGCCCTCTGG + Intergenic
1201850862 Y:18478421-18478443 GCACCTGGCAGGTGCCCCTCTGG - Intergenic