ID: 1049788798

View in Genome Browser
Species Human (GRCh38)
Location 8:144463581-144463603
Sequence TCCTGGCCTGGCCTGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 8, 3: 75, 4: 531}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049788798_1049788807 13 Left 1049788798 8:144463581-144463603 CCACCTGCCAGGCCAGGCCAGGA 0: 1
1: 0
2: 8
3: 75
4: 531
Right 1049788807 8:144463617-144463639 ACCATGTCCCTGGAGAGTAAGGG No data
1049788798_1049788806 12 Left 1049788798 8:144463581-144463603 CCACCTGCCAGGCCAGGCCAGGA 0: 1
1: 0
2: 8
3: 75
4: 531
Right 1049788806 8:144463616-144463638 CACCATGTCCCTGGAGAGTAAGG No data
1049788798_1049788804 3 Left 1049788798 8:144463581-144463603 CCACCTGCCAGGCCAGGCCAGGA 0: 1
1: 0
2: 8
3: 75
4: 531
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788798_1049788809 19 Left 1049788798 8:144463581-144463603 CCACCTGCCAGGCCAGGCCAGGA 0: 1
1: 0
2: 8
3: 75
4: 531
Right 1049788809 8:144463623-144463645 TCCCTGGAGAGTAAGGGCCCAGG No data
1049788798_1049788811 20 Left 1049788798 8:144463581-144463603 CCACCTGCCAGGCCAGGCCAGGA 0: 1
1: 0
2: 8
3: 75
4: 531
Right 1049788811 8:144463624-144463646 CCCTGGAGAGTAAGGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049788798 Original CRISPR TCCTGGCCTGGCCTGGCAGG TGG (reversed) Intronic
900103382 1:972174-972196 CCATGGCCTGGCCAGGCGGGAGG - Intronic
900126303 1:1070356-1070378 TCCTGGCCGTGCCTGCCTGGTGG + Intergenic
900286060 1:1901276-1901298 GCTTGGCCAGGCCTGGGAGGAGG - Intergenic
900363256 1:2300077-2300099 CCCTGCCCTGCCCTGGCAGGGGG + Intronic
900605427 1:3521591-3521613 GCCTGGCTTTGCCTGGGAGGTGG + Intronic
900624938 1:3603731-3603753 TCCTGGCAAGGCCTGGGCGGAGG - Intronic
900864783 1:5260525-5260547 TCCAGGCCTGCACTGCCAGGGGG + Intergenic
900974669 1:6009486-6009508 TCCAGGCCAGTCCTGGCAAGAGG - Intronic
901051966 1:6429802-6429824 ACCTGGCATGGCCTGGGAGGGGG - Intronic
901070899 1:6517789-6517811 GCCTGGCCTGGCCTGGCCTCGGG - Intronic
901447256 1:9316141-9316163 CCTTGCCCTGGGCTGGCAGGGGG + Intronic
901737868 1:11323791-11323813 CCCAGGCTGGGCCTGGCAGGTGG - Intergenic
901868753 1:12125316-12125338 GCCTGGCCTGGCCTGGGCTGGGG + Intronic
901934092 1:12616316-12616338 GCCTGGCCTGGGCTGGGAGTTGG + Intronic
902080343 1:13816315-13816337 TCCTATCCTGGCCTGGGAAGTGG + Intronic
902217051 1:14940845-14940867 CCTGGGCCTGGCCAGGCAGGTGG + Intronic
902482270 1:16718212-16718234 ACCTGGCATGGCCTGGGAGGGGG + Intergenic
902696208 1:18142660-18142682 TCGTGGCCTGGCCAGGCATTAGG + Intronic
902771165 1:18646475-18646497 TCCTGGCCTCCCCAGGCAGCAGG + Intronic
903343686 1:22671082-22671104 ATCAGGCCTGGCCTGGCGGGGGG - Intergenic
903354751 1:22739809-22739831 TCCAGGCCAGGCCGGGCATGTGG - Intronic
903704021 1:25271791-25271813 TCCTGGGCTGCCCTGTGAGGAGG + Intronic
903723215 1:25421521-25421543 TCCTGGGCTGCCCTGTGAGGAGG - Intronic
903830594 1:26171819-26171841 GCCTGCCCAGGTCTGGCAGGGGG + Exonic
904032139 1:27539923-27539945 TCCTTACCTGTCCTGGGAGGAGG + Intronic
904200653 1:28817068-28817090 GGCTGGCCGGGGCTGGCAGGAGG - Intronic
904349165 1:29893795-29893817 TCCTGGCCAGCCCTGGCAATGGG + Intergenic
904478783 1:30781549-30781571 ACCAGGCCTGGCCTGAGAGGTGG + Intergenic
904501205 1:30913789-30913811 GCCTGGGCTGGCCTTGTAGGAGG + Intergenic
904823547 1:33260024-33260046 CCCTGCCCTGGCCAGGCATGTGG + Intronic
905012147 1:34755028-34755050 TGCTGGCCCAGCCTGGGAGGAGG - Exonic
905631465 1:39521389-39521411 TCCTGGCCTGGCCGGCCTGCTGG + Exonic
905666289 1:39764782-39764804 TCCTGGCCTGGCCGGCCTGCTGG - Exonic
906149150 1:43577629-43577651 TCCTGTCCAGTCCAGGCAGGGGG + Intronic
907021650 1:51072200-51072222 TCCAGGCCTGGCCTGGCTTCGGG + Intergenic
907525714 1:55052826-55052848 TCTGGACCTGGCCTGGGAGGTGG + Intronic
908293175 1:62688145-62688167 CCCAGGCCTGGCCTAGGAGGCGG - Intronic
911998526 1:104798977-104798999 TCCTTGCCTTGCCTTGCAGATGG - Intergenic
912687092 1:111776129-111776151 TTGGGGCCTGGGCTGGCAGGGGG + Exonic
914917795 1:151829093-151829115 TCCTTCCCCGGCCTGGCAGTCGG + Intronic
915217034 1:154347284-154347306 TTCAGCCCTGGCCTGGGAGGAGG + Intronic
915237183 1:154492505-154492527 ACCTGGCCTGGCCTGGGGGTGGG - Intronic
915341396 1:155178711-155178733 GGCTGGCCAGGCCGGGCAGGAGG - Intronic
915603613 1:156937578-156937600 GCCTGGCCTGCTCTGTCAGGTGG - Intronic
915724890 1:158010474-158010496 TCCCAGCCTGCCCTGGAAGGTGG + Intronic
916488879 1:165283953-165283975 TCATGGCCTGGACTGGCAGGAGG + Intronic
919761222 1:201099358-201099380 TACTGGGCTGGCCTGGGAAGGGG + Intronic
919792979 1:201304217-201304239 TTCTGGCGTGGCCAGGAAGGAGG - Intronic
919851171 1:201674042-201674064 TCGCTGCCAGGCCTGGCAGGTGG + Intronic
919914121 1:202129598-202129620 TCCTGACCTGGCCTGGCCTGTGG + Exonic
919938069 1:202268147-202268169 TCCTGGCCCTGCTTGGCAGGAGG - Intronic
920043006 1:203116145-203116167 TCCCGCCCTCTCCTGGCAGGTGG + Intronic
920105072 1:203546775-203546797 TCCATGCCTGGCCTGGCAGAAGG - Intergenic
920301236 1:204990303-204990325 GCCTGGCCTGGCCTGGCCTTTGG - Intronic
922558286 1:226549241-226549263 TCCTGGCGTCCCCGGGCAGGTGG + Intronic
922720157 1:227896184-227896206 GCATGGCCTGGGCTGCCAGGTGG + Intergenic
922750223 1:228066674-228066696 TCCCATCCTGGCCAGGCAGGCGG - Intergenic
923034586 1:230276668-230276690 TCCCAGCCTGTCCTGGCAGTGGG + Intronic
923087207 1:230710753-230710775 GCCTGGGCTGGCCTGGCTGCAGG - Exonic
923105294 1:230849519-230849541 CCCAGCCCTGGCCTGGCTGGAGG - Intronic
923838046 1:237636386-237636408 TCCTGGACTGGTATGTCAGGAGG - Intronic
924624777 1:245688912-245688934 GCCTGGCCTCTCCTTGCAGGTGG + Intronic
1063708549 10:8454613-8454635 TCCTGGGCTGCCCTGCCATGCGG + Intergenic
1064194456 10:13233891-13233913 TCCTGCCAGGGCCTGGCAGGGGG + Intronic
1064585259 10:16833564-16833586 TCCTGGCCAGGCTGGGCAGAAGG + Intronic
1066703828 10:38156913-38156935 TCCTGGCTCGGCCTGGAATGGGG + Intergenic
1066986922 10:42476057-42476079 TCCTGGCTCGGCCTGGGATGGGG - Intergenic
1067089255 10:43258307-43258329 GGCTGGCCTGGCCTCTCAGGAGG + Intronic
1067089950 10:43261458-43261480 ACCTGGCCTGGCCTCGCCAGTGG + Intronic
1067474634 10:46557326-46557348 TCCTGGCCTGGCCTGGCCCCCGG + Intergenic
1067684806 10:48459739-48459761 GGTTGGCCTGGCCTGGCATGCGG + Exonic
1069832850 10:71291611-71291633 TCTGGGCCAGGCCTGGCAGATGG + Exonic
1070309475 10:75262867-75262889 GCCTGCCCTGGCCAGGGAGGAGG + Intergenic
1070329099 10:75405390-75405412 GCCGGGCCTGACCTGTCAGGCGG - Intergenic
1070895612 10:79981537-79981559 CCCTGGGCTGGGCTGGCGGGAGG - Intronic
1070985608 10:80687140-80687162 TCCTTGCCTGGCATGGCTGTAGG - Intergenic
1071125833 10:82333797-82333819 TCGTGCCCTGGCCAGGGAGGAGG + Intronic
1071284181 10:84129070-84129092 TCCTGGCTTTACCTGGAAGGAGG - Intergenic
1072899382 10:99393869-99393891 CCCTTGCCTGGCCTGGCCTGAGG + Exonic
1073176052 10:101558424-101558446 TCCTGGCCCAGCCTGGGAGTAGG - Intergenic
1073363705 10:102919573-102919595 TCCCGGCATGGCCTGGCTGTGGG + Exonic
1075177699 10:120181341-120181363 TCCTCTACTGGCCTGGCAGGGGG - Intergenic
1075324875 10:121523364-121523386 TCCTGGTCAGGCCTAGCAGCTGG + Intronic
1075729047 10:124625542-124625564 TCCTGGCCAGGCCTGGACGATGG + Intronic
1076847634 10:133077105-133077127 TCCTGGGCTGGGCTGGGTGGGGG - Intronic
1077074923 11:696002-696024 GCCTGGCCTGGCCTGGGTGGCGG + Intronic
1077077819 11:709229-709251 GACTGGCCTGGCCTGGGTGGGGG - Intronic
1077182495 11:1222998-1223020 GCGTGGCCTGGCCTGGCTTGGGG + Intergenic
1077324403 11:1957516-1957538 TCCTAGCCTGGCCTGGCCTGTGG + Intronic
1077340522 11:2024338-2024360 TTCTCGCCTGGCCAGGCAGAAGG + Intergenic
1077367141 11:2165846-2165868 TCCTGGCCTGGCCTCCCTGGGGG - Intronic
1077504147 11:2922420-2922442 TCCAGGCCTGGGACGGCAGGCGG - Exonic
1078476225 11:11632689-11632711 TCCTGCCCTGGGCTGGCTGCAGG + Intergenic
1078565985 11:12414796-12414818 TCCTGGCCTAGCCCTGCAGATGG - Intronic
1078667888 11:13341214-13341236 TCCTGGCAAGGCCAGGCAGTGGG - Intronic
1079328089 11:19511700-19511722 TTCTGTTCTGGCCTGGCAGGTGG + Intronic
1079340411 11:19607018-19607040 TCCTTCCCTGGCCTGGGAGCTGG - Intronic
1081667473 11:44925018-44925040 TCCTGGCCTGGCCTGGCCTGGGG + Intronic
1081685009 11:45036212-45036234 ACCAGCCATGGCCTGGCAGGAGG - Intergenic
1081935752 11:46902918-46902940 TGCTGGCCAGGCCTGGGCGGAGG + Exonic
1081984340 11:47290668-47290690 TCCTGGCCTAGCTGGGCGGGGGG + Exonic
1082768198 11:57184974-57184996 TCCTGGCCTGGGCAGGACGGGGG + Intronic
1083176274 11:60951993-60952015 TCCTGGCCTGCCCTGGGCGTGGG + Intronic
1083598512 11:63931909-63931931 ACCTGGCCTTGGGTGGCAGGAGG + Intergenic
1083637423 11:64128129-64128151 TCCTGCCCTGGCAGGACAGGAGG - Intronic
1083655609 11:64227732-64227754 TACAGGTCTGGGCTGGCAGGAGG + Intronic
1083751429 11:64763010-64763032 GCCTGGCAAGGCCTGGCAAGAGG - Intergenic
1084008706 11:66336147-66336169 TCCTGGGCTGGCCTGGGGGCAGG + Exonic
1084150570 11:67286162-67286184 TACTGGCCTCGCCTGGCCTGAGG + Exonic
1084307593 11:68297163-68297185 TCCTGGCCTGAGCTCGAAGGAGG - Intergenic
1084526334 11:69700760-69700782 GCCTGGCCTGGCCTGGGGGAGGG - Intronic
1084526338 11:69700765-69700787 GCCTGGCCTGGCCTGGCCTGGGG - Intronic
1084864137 11:72041822-72041844 TCCTGGCCTTGCCACGCAGAAGG - Intronic
1085229121 11:74949430-74949452 TCCTGGGGAGGCCTGGGAGGCGG + Intronic
1085269167 11:75260033-75260055 TGCTGCCCTGGACTGGCAGATGG - Intergenic
1085405702 11:76260473-76260495 TCCTGGCCTGGCACGGCCTGGGG - Intergenic
1087119020 11:94553444-94553466 TCCTGGTGTGGCCTAGCTGGGGG - Intronic
1088738990 11:112751492-112751514 GCCTGGCCTGGCCTGGAACCTGG + Intergenic
1089093533 11:115898786-115898808 TCAGGGCCTGGCCTGCCAGGAGG - Intergenic
1089326900 11:117663616-117663638 TTCTGGCCTGGCCGGGCACTTGG - Intronic
1089588317 11:119523977-119523999 CGCTGTCCTGGCCTGGCAGGAGG - Intergenic
1089772702 11:120815019-120815041 GCCTGGCCTGGCCTGCAGGGGGG - Intronic
1089879861 11:121763061-121763083 CCCTGGCCTGGCCTGGCGCCAGG - Intergenic
1202807384 11_KI270721v1_random:12693-12715 TCCTAGCCTGGCCTGGCCTGTGG + Intergenic
1202823507 11_KI270721v1_random:79527-79549 TTCTCGCCTGGCCAGGCAGAAGG + Intergenic
1092156352 12:6284264-6284286 GCCCGGCCTGGCTGGGCAGGGGG - Intergenic
1092290440 12:7156999-7157021 TCCAGGCCTGGGCTGGCTGCAGG - Intronic
1096620576 12:52862187-52862209 TGCTGGCCTGACCTGACAGGTGG + Intergenic
1096788325 12:54030372-54030394 TCAGGGCCCGGCCTGGCAGCCGG + Exonic
1096809140 12:54158631-54158653 TCCAGGTCTGGCCTGGCTTGGGG - Intergenic
1099399278 12:82181981-82182003 ACCTGACCTGGACTGGGAGGAGG + Intergenic
1099572970 12:84348589-84348611 TCCTGGGCTGGCATGGGAGCAGG - Intergenic
1101903947 12:108811668-108811690 GCCTGGCCTGTCCTGGGTGGCGG + Intronic
1102025296 12:109711187-109711209 TCCGGGGCTGGCCTGCCTGGTGG + Intergenic
1102569857 12:113820821-113820843 TCCAGGCCAGGCCTGGCGAGTGG + Intronic
1102989698 12:117306079-117306101 ACCTTGCCTGGCCTGGCCCGTGG + Intronic
1104726157 12:131076930-131076952 TCCTCCCCTGGGCTGGCATGGGG - Intronic
1104855567 12:131900877-131900899 GCCTGGCCTGGTCTGGCCGGGGG + Intronic
1104870015 12:131988359-131988381 GCCTGGCTTTGCCTGGCAGTTGG + Intronic
1105274288 13:18905758-18905780 TCCTGCACTGTCATGGCAGGGGG + Intergenic
1105313735 13:19237143-19237165 TCCTGTGCTGGCATGGCAGCTGG - Intergenic
1105472248 13:20704308-20704330 TCCTGGCGGGGCCCGGCAGGTGG + Intronic
1106393187 13:29355535-29355557 GCCTGGCCAGGCCTGGCTGTTGG - Intronic
1107350059 13:39504547-39504569 TCCTTGGCTGGCATTGCAGGTGG + Intronic
1110719805 13:78748382-78748404 GCCTGGCCTTGCCTTGCAGACGG + Intergenic
1110726164 13:78827075-78827097 TTCTTCCCTGTCCTGGCAGGAGG - Intergenic
1113855906 13:113445405-113445427 TCCTGGCATGGCCAGGCACCAGG - Intronic
1114055768 14:18965958-18965980 CCCTGGCTTGGACAGGCAGGGGG + Intergenic
1114056108 14:18968010-18968032 ACCAGGCCTGGGCTGGGAGGAGG + Intronic
1114106443 14:19433743-19433765 ACCAGGCCTGGGCTGGGAGGAGG - Intronic
1114106779 14:19435806-19435828 CCCTGGCTTGGACAGGCAGGGGG - Intergenic
1114212629 14:20628228-20628250 TCCTGGCCTGACTGGGGAGGAGG - Intergenic
1116097216 14:40386100-40386122 TCCTACCATGGCCTTGCAGGTGG - Intergenic
1117986372 14:61389831-61389853 TCTTGGCCTGGTCTAGTAGGGGG + Intronic
1118256693 14:64211589-64211611 GCCTGGCCTGGCCCCTCAGGGGG + Intronic
1119775903 14:77248669-77248691 TCCAGGCCTGAGCTGCCAGGAGG + Intronic
1120135771 14:80866366-80866388 TCTGGGGCTGGCCTGGCACGAGG - Intronic
1121118632 14:91361434-91361456 TGCTGGCCTCTCCTGGCATGCGG - Intronic
1121280099 14:92691888-92691910 CCCTGGCCTCTCCTGGCAGGTGG + Intergenic
1121623702 14:95369485-95369507 TCCTGCCCTGGCTTGGGAGTTGG + Intergenic
1122094992 14:99364076-99364098 TCCTGGCCTGACCCAGGAGGGGG - Intergenic
1122133361 14:99618898-99618920 GCAGGGCCTGGCCGGGCAGGAGG + Intergenic
1122308307 14:100779261-100779283 TCCTGCTCTGGCCTTCCAGGGGG - Intergenic
1122750147 14:103927490-103927512 TCCTGCCCTGGCCAGTGAGGGGG + Intronic
1122865115 14:104600235-104600257 TCCTGGCCTGGCCTTGGTGAGGG - Intronic
1122870364 14:104635537-104635559 GACTGGCCGGGCCTGCCAGGAGG + Intergenic
1122878741 14:104680489-104680511 GCCTGGCCTGGCCTACCTGGAGG - Intergenic
1122922508 14:104885814-104885836 GCCTGGGCTGGGCAGGCAGGGGG + Intronic
1125389718 15:39178910-39178932 TCCTGGCCAAGCTTGTCAGGTGG + Intergenic
1125489466 15:40136205-40136227 TCCTGCCCTGCCCTGCCATGTGG - Intergenic
1125489478 15:40136253-40136275 TCCTGCCCTGCCCTGCCATGTGG - Intergenic
1125512324 15:40298742-40298764 TCCTGTCCTGCCTTGGCAGCGGG - Intronic
1125589881 15:40847461-40847483 TACTGGCCTGGCCTGGCCACAGG - Intronic
1125601631 15:40918742-40918764 TAATGGACTGGCCGGGCAGGAGG + Intergenic
1125753969 15:42049711-42049733 GCCAGGCCTCGGCTGGCAGGAGG + Intronic
1126069494 15:44853330-44853352 TTCAGGTCTGGCCTGGCTGGAGG - Intergenic
1127265918 15:57361434-57361456 TCATGGTTTGGCCTGGCATGAGG - Intergenic
1127383410 15:58448630-58448652 TCCTAGCCAGGCCTGGCATATGG - Intronic
1128133261 15:65244933-65244955 TCCTGGCCTGGCTTTGCAGTTGG - Intronic
1128771182 15:70283682-70283704 CCCTGGCCATGCCTGGCAGATGG + Intergenic
1129161819 15:73751961-73751983 GCCTGGGCAGGCCTGGCTGGGGG - Intronic
1129325870 15:74800056-74800078 TACTGGCCTGGCTTGGCCTGTGG + Intronic
1129474870 15:75778242-75778264 TCCTGCCCTGGCAAGGCAGCAGG + Intergenic
1129834275 15:78692173-78692195 CCCTGGCCTGGACTGGGAGCAGG - Intronic
1129852146 15:78799437-78799459 TCCTGGCTTCGCCTGGCTGAAGG - Intronic
1129957258 15:79650415-79650437 TCCAGGCCAGGCCTAGCAAGAGG + Intergenic
1130230849 15:82095377-82095399 GCCTGGCCTAGGCTGGAAGGAGG - Intergenic
1130331223 15:82923762-82923784 TCCTGGCAGGGCCTGACAGCTGG + Intronic
1130519105 15:84648699-84648721 TCAGGTCCTAGCCTGGCAGGAGG + Intronic
1130783118 15:87066082-87066104 GCCTGGACTGGCCAGGCTGGGGG + Intergenic
1131122201 15:89829615-89829637 CCCTGGCCTGGCCTGTCAGTGGG - Intergenic
1132089411 15:98935716-98935738 CGCTGGCCTGGCTTGGCAGGTGG - Intronic
1132147306 15:99436527-99436549 ACCTGCCCTGGCCGGGGAGGGGG - Intergenic
1132147750 15:99438438-99438460 TCTTGGGCTGCCCTGGCCGGGGG - Intergenic
1132224329 15:100128721-100128743 CGCTGGCCTGGCCTGCCATGGGG - Intronic
1132576721 16:667680-667702 TCCTGGCCTGTCCCAGCATGAGG - Exonic
1132583803 16:697191-697213 TCCCGGGCTGCCCTGGCTGGGGG - Exonic
1132596158 16:751264-751286 TCCTGCTCTGGCCTGGCGGGTGG + Intronic
1132603184 16:782922-782944 TCCATGCCTGGCCTGGCAGGCGG + Intronic
1132603309 16:783433-783455 TCCTGCCCTGGCCTGCCTGGTGG - Intergenic
1132605937 16:793768-793790 TCCTGGCCTGGACCCGGAGGGGG + Intronic
1132676935 16:1124790-1124812 TCCTAGCCTGAATTGGCAGGAGG + Intergenic
1132697303 16:1207678-1207700 GTCTGGGCTGGCCTGGGAGGTGG - Intronic
1132701599 16:1224544-1224566 TGCAGGCAAGGCCTGGCAGGAGG - Intronic
1132714378 16:1283557-1283579 ACCTCGCCTGGCCTGTGAGGAGG + Intergenic
1132853625 16:2035391-2035413 CCCTGGCCTGGCCTGGCCTGTGG + Intronic
1133001856 16:2855879-2855901 GCCAGGCCTGGTCTGGGAGGAGG + Intronic
1133015600 16:2938089-2938111 TCCTGGTGGGGCCTGGCTGGGGG + Intronic
1134063566 16:11212992-11213014 TCCTGTCCTGGCCAGGGATGTGG - Intergenic
1134249066 16:12561781-12561803 ACCACGCGTGGCCTGGCAGGGGG + Intronic
1134492083 16:14703087-14703109 TCCTAGCCTTTCCTGGCACGGGG + Intergenic
1134497464 16:14742209-14742231 TCCTAGCCTTTCCTGGCACGGGG + Intronic
1135026861 16:19005566-19005588 TCCTGGGGTGGCTTGGCTGGTGG + Intronic
1136153135 16:28365123-28365145 TCCTGGCCATTCCTGGCACGGGG - Intergenic
1136209950 16:28750150-28750172 TCCTGGCCATTCCTGGCACGGGG + Intergenic
1136297409 16:29311573-29311595 TCATTGCCTGGGCAGGCAGGTGG + Intergenic
1136536680 16:30903697-30903719 TCCTGTTCTGGGCTGGCAGAGGG - Intergenic
1137391129 16:48082323-48082345 CCCTGCCCAGGCCTGGCCGGAGG + Intergenic
1137573968 16:49586112-49586134 TCCTGGCCTCACCTGGAAGAAGG + Intronic
1138530534 16:57631952-57631974 TGCCAGCCTGCCCTGGCAGGAGG + Intronic
1139473727 16:67192186-67192208 GCCTGGCCTGGCCTGGCTGAGGG + Exonic
1139505301 16:67395498-67395520 TGCTGGCCCGGCCTGGCCAGGGG + Exonic
1140092007 16:71846265-71846287 CTCTGGCCTGTCCTGGAAGGTGG + Intronic
1141154162 16:81585482-81585504 GGCTGTCATGGCCTGGCAGGAGG - Intronic
1141397184 16:83715708-83715730 TCCTGGCCTGGGCTGACAGTTGG - Intronic
1141842930 16:86585919-86585941 TCCCAGCCTGCCCGGGCAGGAGG - Intergenic
1142066019 16:88063302-88063324 TTCTGCCCTGGCCTGGGAGCTGG + Intronic
1142196967 16:88743414-88743436 TCGTGGCCGGGCGTGGCTGGTGG - Intronic
1142211538 16:88810947-88810969 CCCTGCCCCGGCCTGGCAGGAGG + Intronic
1203138920 16_KI270728v1_random:1747444-1747466 GCCTGGCTTGGCCAGCCAGGTGG - Intergenic
1142499510 17:324328-324350 TCAGGGCCTGGCCTGGCAGCAGG - Intronic
1142560250 17:805288-805310 TGCTGGCCCTGCCTGGCAGGAGG + Intronic
1142623091 17:1177375-1177397 TCCTGGGGTGGCCTGGATGGTGG - Intronic
1142757282 17:2023908-2023930 TCCTGGCCGGGCCAGGCGCGGGG + Intronic
1143012343 17:3872852-3872874 GCCTGGCCTGGCCTGGCCGCGGG - Intronic
1143112583 17:4560583-4560605 CCCTGCCCAAGCCTGGCAGGTGG + Exonic
1143645229 17:8225655-8225677 GCCTGGCCTGGCCTGGCACCAGG - Intergenic
1144480170 17:15622366-15622388 ACCTGGCCTGGCCAGCCAGCAGG + Intronic
1144786871 17:17836933-17836955 TCCTGCCCTGGCCTCAGAGGCGG + Exonic
1144918135 17:18741372-18741394 ACCTGGCCTGGCCAGCCAGCAGG - Intergenic
1145273490 17:21416878-21416900 TCGTGGCCTGGCCCCCCAGGAGG - Exonic
1145824570 17:27867077-27867099 TCCTGGGCTAGCCTCTCAGGAGG - Intronic
1146133517 17:30298046-30298068 TCCTGGCCTTGCTTGGCACTGGG - Intergenic
1146637888 17:34519537-34519559 CCCTGTCCTGGCCTGGATGGGGG - Intergenic
1147429352 17:40362044-40362066 TCCTGTGATGCCCTGGCAGGTGG + Intronic
1147558872 17:41496903-41496925 TCCTGCCCAGGCCCTGCAGGGGG - Intergenic
1147646668 17:42038352-42038374 TCATGGCCAGGGCTGACAGGAGG + Intronic
1147813850 17:43193915-43193937 TCCTGGCCTGGGCTGGCCTGTGG + Intronic
1148048343 17:44757705-44757727 TCTGGGCCTGGCATGGCAGGTGG + Intergenic
1148116387 17:45177782-45177804 CTCAGGCCTGGCCTGTCAGGGGG + Intergenic
1148323283 17:46770110-46770132 TCACGTCCTGGCCTGGGAGGTGG - Intronic
1149492391 17:57094496-57094518 TGCTGGCCTGGCCTGGCGGAAGG - Intronic
1149658892 17:58324403-58324425 GCCAGGCCTGGCCAGCCAGGCGG + Intronic
1149978350 17:61288821-61288843 TCCTGGCCTAGCCAGGATGGTGG + Intronic
1150285161 17:63950123-63950145 AGCTGGCCTGGCCCAGCAGGAGG - Intronic
1150320948 17:64213928-64213950 GCCTCGCCTGTCCTGGCAGATGG - Exonic
1151312193 17:73300134-73300156 TCCTGGCATGGATTGGCACGCGG - Intronic
1151338815 17:73456727-73456749 TCCTGGCTCTGCCTGCCAGGAGG + Intronic
1151468231 17:74301522-74301544 TCCTGGCCCTGCCTGGCACGGGG + Intronic
1151661596 17:75521882-75521904 CCCTGGCCCGGCCAGGGAGGGGG + Exonic
1151668344 17:75558221-75558243 CCCTCACCTGGCCGGGCAGGAGG - Exonic
1151957057 17:77385709-77385731 TCCAGGCCTGGGGTGTCAGGTGG + Intronic
1151958195 17:77391116-77391138 AGCTGGTCTAGCCTGGCAGGAGG - Intronic
1151983819 17:77529273-77529295 GGCTGGCGTGGCCCGGCAGGAGG + Intergenic
1152283385 17:79398398-79398420 AACTGGCGAGGCCTGGCAGGAGG + Intronic
1152482350 17:80563048-80563070 TGCTGGTCTGGCTTGGCAGGTGG + Intronic
1152603565 17:81277713-81277735 TCATGTCCTTGCCTGGCTGGTGG - Intronic
1152632360 17:81415939-81415961 TCCCAGCCTGGCCTGCCTGGAGG - Intronic
1152647896 17:81478359-81478381 TCCTGGGCTTGCATGGGAGGGGG + Intergenic
1152812101 17:82386936-82386958 GCCTGGCCTGGCCTCACAAGGGG + Intergenic
1152888502 17:82866624-82866646 CTGTGGCCTGGCCTGGAAGGAGG + Intronic
1153805028 18:8704158-8704180 TCCAGCCCTGGCGTTGCAGGAGG - Intergenic
1154070822 18:11149736-11149758 ACCCGGCCTGGCCTGCCAGTGGG + Intergenic
1154400605 18:14033357-14033379 GCCTGGCCTGTGCTGGCAGAAGG + Intergenic
1155436213 18:25815677-25815699 TCCTGGCCTTGCCTTGCAGGGGG - Intergenic
1156466675 18:37352201-37352223 TCCTGGCCTTGCCCAGAAGGAGG - Intronic
1157009376 18:43628072-43628094 TCATTTGCTGGCCTGGCAGGGGG - Intergenic
1157574874 18:48736807-48736829 GCCTGGCCTGCCCTGACAGGAGG - Intronic
1157680936 18:49605521-49605543 TCCTGTCCTGGACATGCAGGTGG - Intergenic
1157685698 18:49640798-49640820 GCCTGGCCTGGGCTTGAAGGAGG + Intergenic
1159945849 18:74444407-74444429 TGCTGGGCTGCCCTGGCAGAAGG - Intronic
1160272859 18:77403613-77403635 GCCTGCCCTGGCCTTGCTGGAGG + Intergenic
1160398397 18:78589174-78589196 ACCTGACCTTCCCTGGCAGGAGG + Intergenic
1160964854 19:1742855-1742877 TCCTGGACAGGCCTGGCGTGTGG - Intergenic
1161007890 19:1945410-1945432 CCCTGGGCAGGGCTGGCAGGGGG - Intronic
1161144799 19:2671153-2671175 TCCTGGCATGGACTGGGTGGAGG - Intronic
1161156515 19:2734651-2734673 TCCTGGCCTGGAGTGGGTGGAGG - Intronic
1161166378 19:2790040-2790062 ACCAAGCCTGGCCGGGCAGGGGG + Intronic
1161349084 19:3782717-3782739 TCAAGGCCTGGGCTGGAAGGGGG + Intronic
1161403269 19:4078252-4078274 TTCTGGCCTGGCCGGGGCGGGGG + Intergenic
1161478254 19:4498142-4498164 TCCTCGGCCGGCCTGGCCGGCGG + Intronic
1161543582 19:4866982-4867004 TCCCGGCTAGGCCTGGCAGTGGG - Intronic
1161928722 19:7321380-7321402 TTTTGGCCTTGCCTGGCGGGTGG - Intergenic
1162482489 19:10936431-10936453 TCCTGGGCTAGCCTGGAAAGCGG - Intergenic
1162499295 19:11042356-11042378 ACCTGCCCTGGGCTGGCAGAAGG - Intronic
1163008068 19:14408603-14408625 GCCCTGCCTGGCCGGGCAGGAGG + Exonic
1163113807 19:15177737-15177759 CCCGCGCTTGGCCTGGCAGGCGG + Exonic
1163241662 19:16067463-16067485 TCCAAGACTCGCCTGGCAGGAGG + Intronic
1163436810 19:17300974-17300996 TCCTGACCTGGCCGGCCACGGGG - Exonic
1163744402 19:19036534-19036556 TCCTGGCCTGGCCGGGGTGGTGG + Intronic
1164037298 19:21466310-21466332 TCCCAGCCTGTCCTGGCAGCCGG + Intronic
1164145508 19:22510282-22510304 TCCTGGCCAGCCCTGGCTTGTGG - Intronic
1164990867 19:32682533-32682555 AGCTGGCCAGGCCTTGCAGGAGG - Intergenic
1165230016 19:34381047-34381069 TGTTTGCCTGGCCTGGTAGGTGG + Intronic
1165803847 19:38568421-38568443 TCCAGGCCTGGCCCGATAGGAGG + Intronic
1165827533 19:38713843-38713865 TCCTGCCCTGTCCTGCTAGGGGG - Intronic
1166329850 19:42071472-42071494 TCCTGTGCTGGGCTGGCATGTGG - Intronic
1166945458 19:46393544-46393566 TCCAGGGCTGGCCGGGCACGGGG + Intergenic
1167289974 19:48619151-48619173 TCCGGACCTGGCCGAGCAGGAGG - Exonic
1167367832 19:49064224-49064246 CCCTGGCCTGTCCTGTGAGGAGG - Intronic
1167647028 19:50711475-50711497 TCCTGCCCAGGCCTGCCAGCGGG - Exonic
1167649512 19:50721702-50721724 TCCCGCCCAGGCCTGGCTGGTGG - Intergenic
1167672054 19:50859119-50859141 ATCTGGCCAGGCCTGGGAGGAGG + Intronic
1167674798 19:50877532-50877554 ACCTGCCCAGGCCTGGGAGGAGG + Intronic
1167744884 19:51344936-51344958 ACCTGGCCTGGCCCAGCCGGTGG - Intergenic
925115025 2:1371404-1371426 TCCTGCCCTGCCCTTGCTGGTGG + Intergenic
925156555 2:1652602-1652624 TCCTGGCCTCTCGTGGCTGGGGG - Intronic
926008800 2:9392736-9392758 TCCTGGCTTTTCCTGGCAGAGGG + Intronic
926767121 2:16331156-16331178 TCCTGCCAAGCCCTGGCAGGTGG - Intergenic
927416670 2:22887417-22887439 TCCTGGCTGGGCCTTGCAGACGG + Intergenic
927494195 2:23541529-23541551 GCCTGGCCAGGGCTGGCTGGTGG + Intronic
927934375 2:27067684-27067706 ACCTGGCCTGGCCATGGAGGAGG - Intronic
929596448 2:43179177-43179199 TCAGGGCCTGGCCAGGCAGTTGG - Intergenic
929810435 2:45185009-45185031 GCCTGGCCTGGGATGGCAGAGGG - Intergenic
930534512 2:52629907-52629929 GCCCGGCCTGGCCCGGCGGGAGG + Intergenic
930897700 2:56464488-56464510 TCCTGGACTAGCCTTGCAGAGGG - Intergenic
931874654 2:66498669-66498691 TCCTGGCCTGGAGTGACTGGAGG + Intronic
932165214 2:69499142-69499164 TCCAGGCCTGCCCTGGGAAGTGG + Intronic
932321150 2:70822956-70822978 TCCTGGCCCGGCCTCAGAGGAGG - Intergenic
932455994 2:71850446-71850468 TCCTGGCCTGGGAGGCCAGGAGG - Intergenic
934664270 2:96158807-96158829 TCTTGTCCTAGCTTGGCAGGAGG + Intergenic
934858900 2:97747793-97747815 ACCTGGCCTGTACTGGCACGAGG + Intergenic
935017919 2:99201691-99201713 AGCTGGCCTGGCCTCACAGGTGG + Intronic
935808152 2:106769241-106769263 TCCTGTCCTGGACTGTCAGCAGG + Intergenic
937097848 2:119247449-119247471 AGTTGGCCTGGCTTGGCAGGTGG + Intronic
937291919 2:120787109-120787131 CCCCTGCCTGGCCTGGCAGGGGG + Intronic
938081204 2:128371110-128371132 TCTTGGGATGGCCTGGCAGGAGG + Intergenic
938286207 2:130119969-130119991 ACCAGGCCTGGGCTGGGAGGAGG - Intronic
938296412 2:130182169-130182191 TCCCGGGCTGCCCTGGCGGGAGG - Exonic
938336849 2:130508689-130508711 ACCAGGCCTGGGCTGGGAGGAGG - Intronic
938352974 2:130611946-130611968 ACCAGGCCTGGGCTGGGAGGAGG + Intronic
938429402 2:131218927-131218949 ACCAGGCCTGGGCTGGGAGGAGG + Intronic
938474228 2:131592108-131592130 ACCAGGCCTGGGCTGGGAGGAGG + Intergenic
942459439 2:176159289-176159311 ACCTGGCCGGGCCTGGCCAGAGG - Intronic
943639682 2:190344155-190344177 GCCTGGCCGGGCCCGGCCGGGGG - Intronic
943676131 2:190717953-190717975 GCCTGGCCAGGGCTGGCAGCTGG - Intergenic
944874106 2:203944137-203944159 TCCTGGCCTGAACTGGGGGGAGG - Intronic
945319704 2:208407037-208407059 TCCGGGCATGGCCGGGCTGGGGG + Exonic
946181819 2:217953568-217953590 TCATAGCCTGCCCTGGCTGGGGG + Intronic
947641978 2:231712024-231712046 TCCTGGCCTTGTCTGGCAGAAGG + Intronic
947791865 2:232873268-232873290 TCATGGCCTGGCTGGACAGGAGG + Intronic
948088157 2:235267687-235267709 CCCTGGCCTGGGCTGGGAGGAGG - Intergenic
948464456 2:238145573-238145595 TCATGGCCTGGCATGGGAGGAGG + Intronic
948523137 2:238554277-238554299 GACAGGCCTGGCCTGGGAGGGGG - Intergenic
948788932 2:240367421-240367443 TCTTGGCCTTGCATGGCAGCTGG - Intergenic
948796195 2:240403074-240403096 GCGGAGCCTGGCCTGGCAGGAGG + Intergenic
1168878185 20:1185346-1185368 TCCGGGCCGGGCCGGGAAGGGGG - Intronic
1169375858 20:5066164-5066186 TCCCAGCCTGGTCTGGAAGGAGG - Intergenic
1170245830 20:14220525-14220547 TCCTGGCCAGAACTGGAAGGAGG - Intronic
1171151016 20:22826574-22826596 TCTGGGCCTGTCCTGGCAAGTGG + Intergenic
1171347755 20:24478760-24478782 TCCTGGCCTGGCCTAGGAACTGG - Intronic
1172163526 20:32884941-32884963 GGCAGGCCTGGCCTCGCAGGAGG - Intronic
1172848428 20:37944188-37944210 TCCTTGCCTGGCTTGGGGGGCGG - Exonic
1172990154 20:39029818-39029840 TCCTGGGCTGTCCTACCAGGGGG - Intronic
1173861389 20:46286058-46286080 TCCTGGAGAGGGCTGGCAGGTGG + Intronic
1174845917 20:53943085-53943107 TTCTGGGCTGCCCTGGGAGGTGG - Intronic
1175247076 20:57588675-57588697 TCCTGGGGAGGCCTGGCAGGGGG + Intergenic
1175332239 20:58173273-58173295 TCCTGGCCCCGCCTCTCAGGTGG - Intergenic
1175482467 20:59321239-59321261 CCCTGGCCTGGCCTTGCCGAGGG - Intronic
1175540662 20:59745748-59745770 TCCATGCCTGCCCTGGCAGGTGG + Intronic
1175816741 20:61886991-61887013 GCCTGGGCTGGCTTGGCTGGAGG - Intronic
1175826984 20:61941807-61941829 TCCTGGGATGGCCAGGCAGGAGG + Intergenic
1175893285 20:62324710-62324732 TCCTGGCCTCGGCCGGCTGGAGG + Intronic
1176027751 20:62994548-62994570 TCTGGGCCTGGCCTGGGAGGTGG + Intergenic
1176516625 21:7789191-7789213 TCCTGGCCTTGACTCTCAGGGGG + Intergenic
1176808602 21:13515583-13515605 TCCTGCACTGTCATGGCAGGGGG - Intergenic
1178376066 21:32068355-32068377 TCCCAGGCTGGCCTGGCAGAGGG - Intergenic
1178487960 21:33030768-33030790 GTCTTGCCTGGCCTGGCTGGTGG - Intergenic
1178650653 21:34419203-34419225 TCCTGGCCTTGACTCTCAGGGGG + Exonic
1179796860 21:43789869-43789891 ACGTGGCCGGGCCGGGCAGGCGG + Intronic
1179995636 21:44972807-44972829 GCCTGCCCTGGCCAGGCAGGTGG + Intronic
1180000830 21:44994817-44994839 TGTTGGGCTGGCCTGCCAGGCGG - Intergenic
1180260052 21:46662496-46662518 TGATGGCCTGGCCTGGCATGTGG + Intronic
1180474245 22:15688509-15688531 CCCTGGCTTGGACAGGCAGGGGG + Intergenic
1180474600 22:15690713-15690735 ACCAGGCCTGGGCTGGGAGGAGG + Intronic
1181086137 22:20440274-20440296 TATTGCCCTGGCCTGCCAGGTGG + Intronic
1181116787 22:20636512-20636534 CCCTGGCCAGGCCTGGCTGGTGG - Intergenic
1181257594 22:21573909-21573931 TCCAAGGCTGGCCTGGCAGAGGG - Intronic
1181522399 22:23457114-23457136 GGCTGGCCTGGCCTGGCCTGGGG - Intergenic
1182120651 22:27784237-27784259 GCCTGGCCTGGCCTGGGAGGAGG - Intronic
1182376949 22:29855637-29855659 TCCAGACCTTTCCTGGCAGGAGG + Intergenic
1182485425 22:30636011-30636033 CCGTGACCAGGCCTGGCAGGGGG - Exonic
1182903991 22:33920874-33920896 TCCTGGCCGGGCGCGGGAGGCGG - Intronic
1183331179 22:37222469-37222491 GCCAGGCCTGGGCTGGCAGCAGG - Intergenic
1183481046 22:38065707-38065729 TCCAGGACTGGAATGGCAGGCGG + Intronic
1183654355 22:39176294-39176316 TCCTGTTCTGGGCTGGCGGGGGG + Intergenic
1183672926 22:39283553-39283575 CCCTGGCCTGTCCAGGGAGGCGG + Intergenic
1183922192 22:41178054-41178076 TGCTGACCTGGCATGGTAGGTGG - Exonic
1183947671 22:41335922-41335944 TGCTGGCCTGGGCTGGCGTGAGG + Intronic
1184092851 22:42301469-42301491 TCCTGTCCTCACCTTGCAGGTGG - Intronic
1184115367 22:42418849-42418871 CGCTGGCCTGGCCTGGCTGAAGG + Intronic
1184436929 22:44484825-44484847 TCCTGGCTGGCCCTGGCTGGTGG + Intergenic
1184457088 22:44616896-44616918 TCCCGGGCTGGCCTGGGTGGGGG - Intergenic
1184688182 22:46105739-46105761 TGCGGGCCTGGCCTGGCATGTGG - Exonic
1184692990 22:46125787-46125809 CGCTGGCCTGGCCTTGCAGTGGG - Intergenic
1184860111 22:47168750-47168772 TCCTGGGAAGGCCTGGCACGCGG + Intronic
1185065817 22:48631217-48631239 CCCTGGCCTGGCCTGGCAGAGGG - Intronic
1185076114 22:48683598-48683620 TCCTAGGCTGTCCTGGCAGTGGG - Intronic
1185332105 22:50256511-50256533 CCCTGCCCAGGCCTGACAGGTGG + Intronic
949839081 3:8300958-8300980 ACCTGGCTAGGCCTGGCATGTGG - Intergenic
950368653 3:12508110-12508132 TGGAGGCCTGGCCTGGGAGGTGG + Intronic
950503036 3:13376518-13376540 CCTTGGCCTGGCCTGGCTGCTGG - Intronic
950614289 3:14146866-14146888 TCCAAGCCTGGCCTGGCACATGG + Intronic
950718322 3:14865125-14865147 TGCAGGCATGGCCTGGCAGATGG - Intronic
952251682 3:31662302-31662324 TCCTACCCTGGCATGGCAGGAGG + Intronic
952252065 3:31664972-31664994 TCCTACCCTGGCATGGCAGGAGG + Intronic
953387823 3:42516587-42516609 CCCTGGCCTGTGCTGGCAGCCGG + Intronic
953890835 3:46750623-46750645 TCCGTGCCTGGCCTTGGAGGCGG - Intronic
954105751 3:48409059-48409081 TGCTGGCCAGGCGTGGCAGTAGG - Intronic
954811500 3:53251138-53251160 GCCTGGCCAGTCCTGGCTGGTGG - Intronic
955977080 3:64489649-64489671 TCCTGTCCTGGCCCGACATGCGG - Intergenic
961005955 3:123405524-123405546 CCCTGCTCAGGCCTGGCAGGAGG - Intronic
961096178 3:124158687-124158709 TCCTGACATGGCTTGGCGGGTGG - Intronic
961186766 3:124921920-124921942 ACCTGGCCTGGCATGGCAGAGGG - Intronic
961358419 3:126352922-126352944 TGCTGGCCTGGCCGTGCCGGTGG + Exonic
961665033 3:128489306-128489328 CCCTGAACTGGCCTGGGAGGGGG - Intronic
963054990 3:141179084-141179106 CCCTGGCCTGGCCAGGGAAGTGG - Intergenic
963268944 3:143266817-143266839 TCCAGACCTAGCCTTGCAGGAGG + Exonic
963778676 3:149465205-149465227 GGCTGGGCTGGCCTGGCAGTAGG - Intergenic
965862063 3:173159972-173159994 ACCTGGCTTGGCCTGGCGAGGGG + Intergenic
966122356 3:176536728-176536750 TCCTGGCCAGAACTTGCAGGAGG + Intergenic
967858437 3:194134810-194134832 TCCTGGCCCGGCGGGGCCGGAGG + Intergenic
968047361 3:195631734-195631756 TCCTGGCCTGCCCGGGGTGGCGG - Intergenic
968307252 3:197658190-197658212 TCCTGGCCTGCCCGGGGTGGCGG + Intergenic
968307733 3:197660221-197660243 TTCTGGCCTTGCCTGGCCCGTGG - Intergenic
968521115 4:1035253-1035275 TCCTGGCCTGGCATGGTAGACGG + Intergenic
968672333 4:1858229-1858251 TCCCGGCAAGGCCAGGCAGGAGG + Intergenic
968914644 4:3492144-3492166 GAGGGGCCTGGCCTGGCAGGCGG + Intronic
969430186 4:7149454-7149476 TCCTGACTTGGCATGGGAGGTGG + Intergenic
969538962 4:7773995-7774017 TACTGGCCTGGGCTGGGACGGGG - Intronic
969592680 4:8130856-8130878 TCCTTGCCTTGCCTGGCTGCTGG + Intronic
969657622 4:8507258-8507280 CCCTGGCCTCGCCTGGTCGGGGG - Intergenic
969961780 4:10952015-10952037 CCCTGCCATGGCCTGGGAGGTGG - Intergenic
971133618 4:23840915-23840937 TGCTTGCCTGGCCTGTCAGCTGG - Intronic
971756865 4:30718230-30718252 CCCTGCCCTGGCCTCGGAGGAGG + Intergenic
975144539 4:70953226-70953248 ACCTTGCCTGGCCTGTCAGTTGG + Intronic
976856413 4:89609921-89609943 TCCTGGCCAGAACTGGGAGGAGG + Intergenic
985512111 5:318783-318805 TCCTGACCTGGCCTGCCTGTGGG + Intronic
985744249 5:1637430-1637452 TCCTGGCCTGCCCGGGGTGGCGG + Intergenic
985744693 5:1639320-1639342 TTCTGGCCTTGCCTGGCCCGTGG - Intergenic
987071113 5:14337861-14337883 TCCTGCCCCGGGCTGGCAGCTGG + Intronic
987090944 5:14507328-14507350 TCCTGGCCTGGCTTCAGAGGGGG - Intronic
988519320 5:31931663-31931685 GCCCACCCTGGCCTGGCAGGAGG + Intronic
989151703 5:38306419-38306441 GCCTGGCCTGGCCTGGCCTCTGG + Intronic
989323671 5:40165544-40165566 TCCTGGACTGGTCTTGCAGAGGG - Intergenic
989653017 5:43714535-43714557 TTTTGGCCTGGCGTGGCAGCTGG + Intergenic
991363197 5:65842357-65842379 TCCTGGCCGGGCGTGGCGGCGGG - Intronic
992145239 5:73840369-73840391 TTCTGGCCAGGCGTGGTAGGAGG - Intronic
994183260 5:96790995-96791017 TCCTGCCCTGGAATGGCAGTGGG - Intronic
996052765 5:118951276-118951298 ACCTGGCTCGGCCTGGCAAGGGG + Intronic
996099988 5:119436126-119436148 GCCTTGCCTGCCCTGGGAGGTGG - Intergenic
997466102 5:134089147-134089169 TCCTTGCCTGTCCCTGCAGGTGG - Intergenic
998140358 5:139696652-139696674 TCCTGGCCTGGTCCGGTAGCGGG + Intergenic
998158303 5:139798381-139798403 GCCTGGCCTGGGCTGGCCTGTGG + Intronic
998416959 5:141953020-141953042 TCTGGGCCTGGGCTGGGAGGTGG - Intronic
999157003 5:149465107-149465129 TCCTGGTTTGGCCTGGCTGTGGG - Intergenic
999727085 5:154446231-154446253 TCCGGGCCTGGGTTGCCAGGGGG - Exonic
1001092158 5:168749578-168749600 ACCTGGCCTGGCTCGGCAAGTGG - Exonic
1001591381 5:172867604-172867626 TCCTGGCTGGGCTGGGCAGGAGG + Intronic
1002427005 5:179182379-179182401 TGCTGGCCTGACGTGGCAGCAGG - Intronic
1003019866 6:2500450-2500472 ACCAGGCCTGGCCTGAAAGGTGG + Intergenic
1003080695 6:3018592-3018614 TCCAGGCCTGCCCTGTCAGGTGG - Intronic
1005821674 6:29604267-29604289 TCCAGTGTTGGCCTGGCAGGTGG - Intronic
1005989123 6:30892367-30892389 CCCTGCCATGGCCTGGGAGGGGG + Exonic
1006389904 6:33752079-33752101 CACTGTCCTGGCCTGGGAGGTGG - Intergenic
1006796564 6:36735902-36735924 CCCTGGCCTGGCCTGCAGGGCGG + Intergenic
1006838034 6:37011035-37011057 CACTGGCCTGGTCTAGCAGGTGG - Exonic
1007180730 6:39927452-39927474 CCCTGGTCTGTCCTCGCAGGAGG - Exonic
1007400359 6:41599444-41599466 CCCTGCCCTGGCCTGGGTGGAGG + Exonic
1007693577 6:43718037-43718059 GCCAGGCCAGGCCAGGCAGGTGG - Intergenic
1008536366 6:52509172-52509194 TTCTGGCCTGCCATGGCTGGTGG - Intronic
1011692822 6:89886070-89886092 TCCTGGCCATGCCAGGCAGGAGG - Intergenic
1012789539 6:103676004-103676026 TCCTGATCTGGCAGGGCAGGAGG + Intergenic
1013300105 6:108797075-108797097 TGCAGGCCTGGCCTGGCAAAAGG + Intergenic
1015933144 6:138382691-138382713 TCCAGGCCAGGCCGGGCAGGAGG - Exonic
1016568409 6:145485441-145485463 TCTTGGCCTTTACTGGCAGGGGG + Intergenic
1016867122 6:148778573-148778595 GCCTGACGTGGCCTGGGAGGAGG - Intronic
1017718085 6:157225771-157225793 CCCTGGCCTGGGCTAGCAGGTGG - Intergenic
1018712869 6:166509203-166509225 TCCTGGGCTTGGCAGGCAGGTGG + Intronic
1018961938 6:168455427-168455449 GCCCGGGCTGGCCTGGCAGCTGG + Intronic
1019162245 6:170076460-170076482 CCCTGGCCTGGCCTGGCTGGAGG - Intergenic
1019174675 6:170154070-170154092 TGCAGGCCTGGGCTGGGAGGAGG - Intergenic
1019271902 7:154191-154213 CCCTGGCAGGGACTGGCAGGAGG - Intergenic
1019307645 7:343478-343500 GTCTGGCCTGGTCTGGCAGGCGG - Intergenic
1019331578 7:463120-463142 TTCTGGGCTGGCCTGGCCCGGGG - Intergenic
1019418703 7:938979-939001 CCCTCTCCTGGCCTGGAAGGAGG + Intronic
1019562553 7:1665835-1665857 CCCGGGGCTGGCCGGGCAGGCGG - Intergenic
1019733180 7:2638483-2638505 TCCAGGAATGGCCTGGAAGGAGG - Intronic
1020017219 7:4838157-4838179 ACCCGGCCCAGCCTGGCAGGCGG + Intronic
1020107915 7:5430757-5430779 TCCTTCCCTGACCTGGCATGAGG + Intergenic
1020111526 7:5450767-5450789 TCTGGGCCTGGTCTGGCTGGAGG + Intronic
1022880745 7:34584698-34584720 TCCTGGCCGGGGCGGGGAGGGGG - Intergenic
1023583358 7:41704956-41704978 TGGTAGGCTGGCCTGGCAGGTGG - Intergenic
1023763812 7:43492103-43492125 TCCTGGCCTGGCCAGTAAAGAGG - Exonic
1023937243 7:44748773-44748795 TGCTGCTCTGGCCTGGGAGGCGG + Intronic
1023967370 7:44969950-44969972 GCCCGGGCTGGCCTGACAGGTGG - Intronic
1025834440 7:65081539-65081561 TCCGGGCGTGGCCAGGAAGGAGG + Intergenic
1026255482 7:68707603-68707625 TTCTGGCCTGGACAGGCAGGTGG - Intergenic
1026791052 7:73332236-73332258 ACCTGCCTTGGCCTGGCATGAGG - Intronic
1026943547 7:74302469-74302491 TTCTGGCCAGGCCTGGTGGGAGG - Intronic
1027187124 7:75979364-75979386 CACTGGGCAGGCCTGGCAGGCGG - Intronic
1028983142 7:96989425-96989447 TCCTCTCCTGCCCTGGCTGGAGG + Intergenic
1029437985 7:100573318-100573340 CAGTGGCCGGGCCTGGCAGGTGG + Exonic
1029563809 7:101321643-101321665 TCCTGGCCCGGCGCGGCAGAGGG - Intronic
1030689421 7:112517342-112517364 TCCTGGCTCAGCATGGCAGGAGG - Intergenic
1031888265 7:127263242-127263264 TTTTGGCCTTGCCTGGCAGTGGG - Intergenic
1032017096 7:128387298-128387320 TCCTTGCTTGGCCTGGTGGGGGG - Intergenic
1032671266 7:134084613-134084635 ACCTTGCAAGGCCTGGCAGGTGG + Intergenic
1033209865 7:139452880-139452902 TCCTGGCTTCTCCTGCCAGGTGG + Exonic
1033218733 7:139513498-139513520 TCTTCGCCTGGCCTGGGAGGAGG + Intergenic
1033661879 7:143408321-143408343 CCCTGGCCTAGGTTGGCAGGAGG + Intronic
1034163387 7:149008126-149008148 TCCAGGGCTGGCATGGCAGAGGG + Intronic
1034400867 7:150860673-150860695 TCCTGGGCTGAGCTGGAAGGAGG - Intronic
1034900244 7:154903732-154903754 TCCTAGCCTGAGATGGCAGGGGG + Intergenic
1035048770 7:155986163-155986185 ACCTGGCCTGGCTGGGCAGCTGG - Intergenic
1035058108 7:156050361-156050383 TGCAGGCCAGGCCTGGCTGGAGG + Intergenic
1035288067 7:157818956-157818978 GCCTGGCCTGTCCTGAGAGGTGG - Intronic
1035377999 7:158419593-158419615 TCCTGGCGTGACATGGAAGGAGG - Intronic
1035444797 7:158932919-158932941 TCCTATCCTCGCCTGGCAAGTGG - Intronic
1035708583 8:1695765-1695787 ACCTGGCCTGGCCTGCCCTGAGG + Intronic
1036280685 8:7397930-7397952 GCCTGGCCCGGCCTTGCAGGAGG + Intergenic
1036283732 8:7424401-7424423 GGCTGGCCTGGTCTTGCAGGAGG + Intergenic
1036337739 8:7887128-7887150 GGCTGGCCTGGTCTTGCAGGAGG - Intergenic
1036340781 8:7913643-7913665 GCCTGGCCCGGCCTTGCAGGAGG - Intergenic
1036710102 8:11072759-11072781 ACCTTGCCTGGCCTAGCATGTGG - Intronic
1037602051 8:20405473-20405495 CCATGGCCTGGCATGGTAGGGGG + Intergenic
1037786451 8:21906156-21906178 TCCTGGCTTAGCCCGGCAGGGGG - Intergenic
1038021376 8:23554342-23554364 TCCTGCCCTGCCCTGGTAAGAGG - Intronic
1039581994 8:38674638-38674660 TGCTGGCCTTGCTTGGCTGGAGG + Intergenic
1039884814 8:41648804-41648826 TGCTGCCCTGGCCAGGCTGGGGG - Intronic
1041172856 8:55163052-55163074 TCTTGGCCTTGCCTGTCACGAGG + Intronic
1043880426 8:85536075-85536097 ACCTGGGCCTGCCTGGCAGGAGG + Intergenic
1044620617 8:94187749-94187771 TCCTGCCCTCTCCTGGCAGAGGG + Intronic
1045272109 8:100670828-100670850 TCCTGGCCTCTGCTGGCAGAGGG + Intergenic
1045840731 8:106577766-106577788 TACTGGCAGGGCCTAGCAGGTGG - Intronic
1046375603 8:113376639-113376661 TCCAGACCTGGCCAGGCAGGAGG + Intronic
1046732840 8:117744227-117744249 TCCTGGACTGGCATGGCAGCAGG - Intergenic
1047306401 8:123656404-123656426 TGTTGGCCTGGCCTACCAGGAGG + Intergenic
1047747795 8:127857783-127857805 TCCTGGCATTGCCTGGCACTTGG + Intergenic
1048082545 8:131144739-131144761 TCATGTCCCGGACTGGCAGGGGG + Intergenic
1048122643 8:131599070-131599092 TCCAGGCCTGGACTGGAAGATGG + Intergenic
1048665671 8:136658131-136658153 TCTTGGTGAGGCCTGGCAGGTGG - Intergenic
1048851306 8:138647703-138647725 TTCTGGCAGGACCTGGCAGGGGG - Intronic
1049002380 8:139834215-139834237 GCCTGGCCAAGCCTAGCAGGTGG - Intronic
1049202205 8:141345881-141345903 GGGTGGACTGGCCTGGCAGGTGG - Intergenic
1049272034 8:141701076-141701098 TCTGGGCCTGGGCGGGCAGGAGG - Intergenic
1049419701 8:142511202-142511224 CCGTGGCCTGGCCCGGCCGGCGG + Intronic
1049606695 8:143532901-143532923 TCCTGGCCTGGTCACTCAGGCGG - Intronic
1049612658 8:143562643-143562665 TCCTGCCCTGTCTTGGCAGGTGG + Exonic
1049687573 8:143945060-143945082 CCCTGGCTTGGCAGGGCAGGTGG - Intronic
1049788798 8:144463581-144463603 TCCTGGCCTGGCCTGGCAGGTGG - Intronic
1051598634 9:18850187-18850209 TCCTGCCCTTTCCTGGCAGCAGG + Intronic
1056118473 9:83463856-83463878 TCCTTGCCCTGCCTGGCAGAAGG - Intronic
1056233618 9:84570763-84570785 TCCTGGCCCAGCCTGCAAGGAGG + Intergenic
1056235337 9:84588426-84588448 GCTGTGCCTGGCCTGGCAGGTGG + Intergenic
1056975582 9:91250147-91250169 TCCAGGCTCGCCCTGGCAGGTGG - Intronic
1057267949 9:93631175-93631197 TGGAGGCCTGGCCTGGCAGCTGG + Intronic
1057440108 9:95077035-95077057 TCCTCCCCAGGCCTGGAAGGTGG - Intronic
1057790192 9:98119359-98119381 TCCCGGCCTGGGCGGGCAGAGGG - Intergenic
1058995168 9:110292345-110292367 TCCTGGACTGGCCGGGGTGGCGG - Intergenic
1060266720 9:122115959-122115981 TTCTGTCCTGGGCTGGCTGGTGG - Intergenic
1060550951 9:124485232-124485254 GCCTGGCCTTGCCTGGGATGGGG + Intronic
1060771950 9:126338242-126338264 GCCGGGCCTGGCCTGCCAGAGGG - Intronic
1060827698 9:126696048-126696070 GGCCTGCCTGGCCTGGCAGGGGG - Intronic
1060876826 9:127089900-127089922 TCCTGACTGGGCCTGGCAAGGGG + Intronic
1061580036 9:131530954-131530976 CCCTGCCCCTGCCTGGCAGGGGG + Intronic
1061743886 9:132725954-132725976 CCATGGCCTGGCCTGGAAGCAGG + Intronic
1061922473 9:133789564-133789586 TCCTGGCCAGCCCTGCCAAGGGG + Intronic
1061943940 9:133898042-133898064 TCGTGGCCTTCCCTGGTAGGAGG - Intronic
1062009293 9:134258594-134258616 TCCTGGCATGGCCGGGCCGAGGG + Intergenic
1062061016 9:134495011-134495033 CCCTGGCCAGGCCTGGCTGCTGG + Intergenic
1062062249 9:134502797-134502819 TCCTGGCCCGTCCTGGAAGGGGG - Intergenic
1062098872 9:134717614-134717636 ACCTCCCCTGTCCTGGCAGGCGG - Intronic
1062198639 9:135288672-135288694 TGCGGGCCAGGCCTGGCAGGGGG - Intergenic
1062425021 9:136502155-136502177 CCCGGGCCTGGCGTGGGAGGTGG + Intronic
1062496985 9:136836570-136836592 TCTGGGGCTGGCCTGGCAGCTGG - Intronic
1062590965 9:137274488-137274510 TCTGGGGCTGGCCTGGCTGGTGG + Intergenic
1062600110 9:137315749-137315771 GCCTGCCCTGGGCGGGCAGGAGG + Intronic
1186436067 X:9544031-9544053 TCCTGGTAGGGTCTGGCAGGGGG + Intronic
1188371820 X:29378931-29378953 TTCTGGACTGGCCTTGCAGAGGG + Intronic
1188815274 X:34705409-34705431 TCCTGGCCAGGGGTGGCAGTGGG - Intergenic
1189234296 X:39475760-39475782 TCCTGGGGTGGCCTGGCAGGAGG + Intergenic
1189298495 X:39935785-39935807 TCCTGGGAGGGCCTGGCTGGAGG - Intergenic
1190474696 X:50814449-50814471 CCCTCGCCTGGGCTGGCTGGAGG - Intergenic
1190717335 X:53115249-53115271 ACATGGCCTGGCCTGGCACTGGG + Intergenic
1191870643 X:65742221-65742243 TCCTGGACTTGCCTGGCATTGGG + Intergenic
1192869403 X:75172058-75172080 GCCTGCCATGTCCTGGCAGGAGG - Intergenic
1194049488 X:89052034-89052056 TTCTGGAGTGGCTTGGCAGGGGG + Intergenic
1194888398 X:99347944-99347966 TCTTGGACTGGCCTTGCAGAGGG + Intergenic
1195129630 X:101839999-101840021 ACCTGTCCTGGGCTGGCATGGGG - Intronic
1195176608 X:102319830-102319852 ACCTGTCCTGGGCTGGCATGGGG + Intronic
1195182256 X:102367263-102367285 ACCTGTCCTGGGCTGGCATGGGG - Intronic
1195743680 X:108091977-108091999 TCCTGACCTGCAGTGGCAGGCGG + Intronic
1196585024 X:117419307-117419329 ACCTGGCTTGGCCTGGCAAGGGG - Intergenic
1197962641 X:132023218-132023240 TGCTCGCCTGGCCTGGGAGGCGG - Intergenic
1199493989 X:148432767-148432789 TCCTGGCCTTTGTTGGCAGGAGG - Intergenic
1199951058 X:152706513-152706535 TCCTGGCCTGTCTCGGCAGTTGG - Intergenic
1199953363 X:152723137-152723159 TCCTGGCCTGTTTTGGCAGTTGG - Intergenic
1199956319 X:152745313-152745335 TCCTGGCCTGTTTTGGCAGTTGG + Intergenic
1199958626 X:152761948-152761970 TCCTGGCCTGTCTCGGCAGTTGG + Intergenic
1200181481 X:154153456-154153478 TCCTGGCCAGGCCAAGCAAGTGG + Intronic
1200187127 X:154190570-154190592 TCCTGGCCAGGCCAAGCAAGTGG + Intergenic
1200192776 X:154227708-154227730 TCCTGGCCAGGCCAAGCAAGTGG + Intronic
1200198531 X:154265512-154265534 TCCTGGCCAGGCCAAGCAAGTGG + Intronic
1200247796 X:154535119-154535141 GCCTGGGCCAGCCTGGCAGGCGG + Intronic