ID: 1049788799

View in Genome Browser
Species Human (GRCh38)
Location 8:144463584-144463606
Sequence ATATCCTGGCCTGGCCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049788799_1049788807 10 Left 1049788799 8:144463584-144463606 CCTGCCAGGCCAGGCCAGGATAT 0: 1
1: 0
2: 5
3: 24
4: 224
Right 1049788807 8:144463617-144463639 ACCATGTCCCTGGAGAGTAAGGG No data
1049788799_1049788804 0 Left 1049788799 8:144463584-144463606 CCTGCCAGGCCAGGCCAGGATAT 0: 1
1: 0
2: 5
3: 24
4: 224
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788799_1049788811 17 Left 1049788799 8:144463584-144463606 CCTGCCAGGCCAGGCCAGGATAT 0: 1
1: 0
2: 5
3: 24
4: 224
Right 1049788811 8:144463624-144463646 CCCTGGAGAGTAAGGGCCCAGGG No data
1049788799_1049788806 9 Left 1049788799 8:144463584-144463606 CCTGCCAGGCCAGGCCAGGATAT 0: 1
1: 0
2: 5
3: 24
4: 224
Right 1049788806 8:144463616-144463638 CACCATGTCCCTGGAGAGTAAGG No data
1049788799_1049788809 16 Left 1049788799 8:144463584-144463606 CCTGCCAGGCCAGGCCAGGATAT 0: 1
1: 0
2: 5
3: 24
4: 224
Right 1049788809 8:144463623-144463645 TCCCTGGAGAGTAAGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049788799 Original CRISPR ATATCCTGGCCTGGCCTGGC AGG (reversed) Intronic
900310094 1:2029391-2029413 CTGACCTGGCCTGGCCCGGCTGG - Intronic
900317891 1:2068518-2068540 ATGTCCTGGACTGCCCTGGTGGG - Intronic
901016367 1:6234070-6234092 AACTCCTGGCTTGGCCAGGCTGG + Intronic
901480025 1:9518739-9518761 AGAGACTGGCCTGTCCTGGCAGG - Intergenic
903173948 1:21569751-21569773 CTCTCCAGGCCTGGCCTAGCTGG + Intronic
903343689 1:22671085-22671107 ACAATCAGGCCTGGCCTGGCGGG - Intergenic
904576914 1:31510882-31510904 ACATCCTGGCTTGGCCTGAGTGG - Intergenic
904633974 1:31865391-31865413 ATCTCCTGTCCTGTCATGGCTGG - Intergenic
905936635 1:41829091-41829113 AGTGCCTGGCCTGGCCAGGCAGG - Intronic
906784303 1:48600913-48600935 AGAGCCAGGTCTGGCCTGGCAGG + Intronic
915079495 1:153342056-153342078 AAACCCTGGCCTGGCCTGGCGGG - Intronic
915954315 1:160209909-160209931 TGTTCCTGGCCCGGCCTGGCAGG + Intronic
918095093 1:181327881-181327903 TTGTCCTAGGCTGGCCTGGCTGG + Intergenic
918290297 1:183100892-183100914 AGGTGCTGGCCTGGCCTTGCTGG - Intronic
919909329 1:202101182-202101204 ATTTCCTGCTTTGGCCTGGCTGG + Intergenic
919938070 1:202268150-202268172 ATGTCCTGGCCCTGCTTGGCAGG - Intronic
920498753 1:206473207-206473229 ATCTCCTGCCCTGAGCTGGCTGG - Exonic
1063472409 10:6298690-6298712 AGATCCAGGCCTGGCCTTTCAGG - Intergenic
1066019449 10:31283401-31283423 ATATCCAGGCCAGGCCCGCCAGG + Intergenic
1066342966 10:34553968-34553990 GTATCCTGGCCTGGAATTGCTGG - Intronic
1067568487 10:47354738-47354760 ATGGCCTGGGATGGCCTGGCTGG - Intronic
1069918736 10:71803129-71803151 TACTCCTGGCCTGGGCTGGCAGG - Intronic
1071525157 10:86354170-86354192 GGGTCCTGGCCTGGCCTGGAAGG - Intronic
1072113591 10:92347195-92347217 ATTTCCTGGCCGGGCGTGGTGGG + Intronic
1073311820 10:102548379-102548401 ATCTCCTGGCCTTGCCTCTCGGG + Intronic
1073442413 10:103560242-103560264 TTCTCCAGGCCTGGCCTGGGGGG + Intronic
1076929999 10:133525837-133525859 CTGTCCCGGCCAGGCCTGGCTGG + Intronic
1077068345 11:655129-655151 ATTTTCTGTGCTGGCCTGGCTGG - Intronic
1077367144 11:2165849-2165871 GCATCCTGGCCTGGCCTCCCTGG - Intronic
1077664680 11:4096986-4097008 CTACCTTGGCCTGGCGTGGCAGG + Intronic
1079084812 11:17437730-17437752 ATATCCTGGCCTGGCTTGGTGGG - Intronic
1079156975 11:17956976-17956998 ATATCCAGGTCTGGCCTGCTAGG - Intronic
1079364775 11:19799657-19799679 AAATGCTGGACTGTCCTGGCAGG - Intronic
1081999969 11:47388874-47388896 ATACCATGGCCTGACCTGACTGG - Intergenic
1083386212 11:62312273-62312295 TTATTCTGGGCTGGCCTGGAAGG - Intergenic
1083899910 11:65638549-65638571 AGTCCCTGGCCTGGCCTGGGAGG + Intronic
1083966543 11:66047165-66047187 AAGGGCTGGCCTGGCCTGGCTGG + Intronic
1084158201 11:67327896-67327918 ATATTCTGGCCGGGCGTGGTAGG - Intronic
1084548204 11:69825050-69825072 AAGTCCTGGCCTGGCCCGGCCGG + Intergenic
1084674004 11:70623903-70623925 ACACCCTGCCCTGGCCTGGGAGG - Intronic
1085294399 11:75422824-75422846 ATTATCTGGCCTGGCCAGGCAGG - Intronic
1090798471 11:130155545-130155567 ATATGCTGGCCGGGCGTGGTGGG + Intergenic
1091691690 12:2601603-2601625 AGAGCCTGGCTTGGCCTGGCAGG + Intronic
1091821423 12:3478373-3478395 AAATCCCTGCATGGCCTGGCAGG - Intronic
1093468773 12:19478933-19478955 ATATCCTGGCCAGGCATGGTAGG + Intronic
1095955899 12:47805792-47805814 CTGGTCTGGCCTGGCCTGGCTGG - Intronic
1096080142 12:48827673-48827695 AGATCCTGTCCAGGCTTGGCGGG - Exonic
1098639148 12:72818653-72818675 AAAACCAGGCCTGGCCTGCCTGG - Intergenic
1103726156 12:122998304-122998326 ACAGGCAGGCCTGGCCTGGCAGG - Intronic
1108163410 13:47666625-47666647 AGATGCTGGCCTGGGCTGGAGGG - Intergenic
1113418958 13:110155105-110155127 AAAGCCTGGCCTGCCCTGCCTGG - Intronic
1113810766 13:113141138-113141160 ATGTTCTGGGCGGGCCTGGCAGG + Intronic
1114197336 14:20490588-20490610 GTACTTTGGCCTGGCCTGGCTGG - Intergenic
1114221588 14:20702222-20702244 AGGACCTGGCTTGGCCTGGCTGG - Intergenic
1119104588 14:71912270-71912292 ATGTCCTGTCCTGTCCTGGCTGG + Intergenic
1119586767 14:75843066-75843088 ATATCCTGGACTGGTCAGGCAGG - Intronic
1122632028 14:103111591-103111613 ATATCCAGACCTCCCCTGGCAGG + Intergenic
1125213932 15:37247271-37247293 ATATCAGGGCCTGGCAAGGCAGG + Intergenic
1126738572 15:51755511-51755533 ATGTCCAGGCTTGGCATGGCTGG - Intronic
1128887489 15:71302321-71302343 ATCTCCTGGCCTTCCCTGGTGGG - Intronic
1129460306 15:75697082-75697104 AGACCCGGCCCTGGCCTGGCTGG - Intronic
1129701439 15:77770805-77770827 AACTCCCAGCCTGGCCTGGCAGG + Intronic
1129978492 15:79844816-79844838 ATGACCTGGTCTGTCCTGGCAGG - Intronic
1130783115 15:87066079-87066101 ATGGCCTGGACTGGCCAGGCTGG + Intergenic
1132596157 16:751261-751283 ACATCCTGCTCTGGCCTGGCGGG + Intronic
1132603182 16:782919-782941 ACCTCCATGCCTGGCCTGGCAGG + Intronic
1132603310 16:783436-783458 TTCTCCTGCCCTGGCCTGCCTGG - Intergenic
1132710668 16:1265713-1265735 CTCTCCTGGCCTCACCTGGCTGG - Intergenic
1133202472 16:4212645-4212667 AGTCCCGGGCCTGGCCTGGCCGG - Intronic
1133418501 16:5625194-5625216 ATATCCTGCCCTGTTCTGGGGGG - Intergenic
1133915686 16:10107521-10107543 ATTTGCTAGCTTGGCCTGGCAGG - Intronic
1134069288 16:11250607-11250629 ATCTCCTGGCTTTGCCGGGCTGG + Intronic
1134132519 16:11659280-11659302 AGGCCCTGGCCTGTCCTGGCTGG - Intergenic
1135197577 16:20407336-20407358 ATTTCCTGGCCTGGCCAGTTTGG - Intergenic
1137353512 16:47735357-47735379 ATCACCTGGGCTGGCTTGGCTGG + Intergenic
1137605802 16:49786198-49786220 AGAGCCTGGCCTTGCCTGGCAGG - Intronic
1140806105 16:78533611-78533633 AAATCCTGGGCTGGCCTGAGAGG + Intronic
1141064600 16:80903826-80903848 GAATCCCAGCCTGGCCTGGCTGG + Intergenic
1141140211 16:81492587-81492609 ATAGCCTGGCCTGGCCAGCAAGG - Intronic
1142197804 16:88746757-88746779 AGCTCCTCCCCTGGCCTGGCTGG + Intronic
1142211536 16:88810944-88810966 AAACCCTGCCCCGGCCTGGCAGG + Intronic
1142355571 16:89600048-89600070 GGATCCAGGCCTGGCCAGGCAGG + Intergenic
1142560249 17:805285-805307 AGATGCTGGCCCTGCCTGGCAGG + Intronic
1144428803 17:15171574-15171596 AGCTGCTGGCTTGGCCTGGCCGG - Intergenic
1144485794 17:15663207-15663229 CCAGTCTGGCCTGGCCTGGCAGG + Intronic
1144833262 17:18143487-18143509 GTAAGCTGGCCTGGCCTGCCTGG + Intronic
1145094093 17:20009629-20009651 ACGTCCTGGCCTGTCCTGCCCGG + Intronic
1146272791 17:31495312-31495334 CTAGCCTGGCCTAGCCTGGCTGG + Intronic
1146610607 17:34301828-34301850 AAATATAGGCCTGGCCTGGCAGG + Intergenic
1146941486 17:36846862-36846884 ATAGCCGGGCCTGGCGTGGGGGG - Intergenic
1149169629 17:53793243-53793265 TTATGCTGACTTGGCCTGGCAGG - Intergenic
1149372625 17:56010368-56010390 ATTTCCTGGCCTGGGATGTCAGG + Intergenic
1149978349 17:61288818-61288840 AAATCCTGGCCTAGCCAGGATGG + Intronic
1150007199 17:61477154-61477176 CTGTCCTGGCCAGGCCAGGCGGG - Intronic
1151118448 17:71765706-71765728 ATACCCTTGCCAGGTCTGGCAGG - Intergenic
1151267783 17:72969876-72969898 ATATTCTGCCCAAGCCTGGCAGG + Intronic
1151426329 17:74033170-74033192 AGAACCTGGCCTGGCAGGGCAGG - Intergenic
1151756358 17:76077365-76077387 CTGTCCTGGCCCGTCCTGGCAGG + Exonic
1153174085 18:2351271-2351293 ATTGCCTGGCCAGGCCGGGCTGG + Intergenic
1153954158 18:10081985-10082007 TCATCCGGGCATGGCCTGGCTGG - Intergenic
1154496713 18:14966586-14966608 ATAGCCAGGCCAGGACTGGCAGG + Intergenic
1155436216 18:25815680-25815702 AGTTCCTGGCCTTGCCTTGCAGG - Intergenic
1157472260 18:47998993-47999015 AGATCCTGGAGAGGCCTGGCAGG - Intergenic
1157473753 18:48008496-48008518 GTAGGCTGGGCTGGCCTGGCCGG - Intergenic
1158935341 18:62359664-62359686 ATATTCTGGCCGTGCCTGGGTGG - Intronic
1159963032 18:74570317-74570339 AAATCCTGGCTTGGCCCGGGTGG + Intronic
1160496274 18:79377637-79377659 ATGCCCTGGGCTTGCCTGGCAGG - Exonic
1160865648 19:1254804-1254826 ATCTCCTGACCTGGGCTGGTGGG + Intronic
1161073503 19:2273921-2273943 AAATCAGGGCCAGGCCTGGCCGG + Intronic
1161478253 19:4498139-4498161 ACATCCTCGGCCGGCCTGGCCGG + Intronic
1161480207 19:4506534-4506556 ATATCCAGGCCTGCCCTTGGGGG - Intronic
1161575526 19:5052481-5052503 ACAGCCTGGCTTGGCCTGGGTGG - Intronic
1161583568 19:5093360-5093382 GTGACCTTGCCTGGCCTGGCTGG + Intronic
1161627534 19:5335958-5335980 ACATCGTGGCCTGGCCAGACTGG - Intronic
1162032902 19:7925096-7925118 ATGTCCCTTCCTGGCCTGGCCGG - Exonic
1163598494 19:18233974-18233996 ATATCCCTGCCTGGCATGGGTGG - Intronic
1163744401 19:19036531-19036553 ATTTCCTGGCCTGGCCGGGGTGG + Intronic
1164620721 19:29694702-29694724 TGGGCCTGGCCTGGCCTGGCCGG + Intergenic
1165326821 19:35118839-35118861 ATGTCCTGGCAGGGCCGGGCAGG + Intronic
1165778518 19:38418649-38418671 ATGTCCTAGCCTGGTCTAGCCGG + Intronic
1166666836 19:44685171-44685193 TTATCCTGGATTGCCCTGGCAGG + Intergenic
1166682955 19:44779170-44779192 AGAACTTGGCCTGGTCTGGCTGG + Intronic
1167608939 19:50496871-50496893 CTGGCCTGGCCTGGCCTGGAGGG + Intergenic
925376848 2:3392327-3392349 CTGTCCTGGTCTGGGCTGGCGGG - Intronic
925998159 2:9308612-9308634 TTAGCTTAGCCTGGCCTGGCAGG + Intronic
926122998 2:10254973-10254995 ATACCCTGGGGTGCCCTGGCCGG + Intergenic
926400498 2:12491600-12491622 CTATCCTGGCCAGGCCAGTCCGG - Intergenic
926929799 2:18025211-18025233 ATATTCTGGCTTGTCCTGGTGGG + Intronic
928404380 2:31003494-31003516 GGATCCAGGCTTGGCCTGGCTGG - Intronic
930161211 2:48157783-48157805 CTATTCTGTCCTGGCCTGGAAGG - Intergenic
931189169 2:59983028-59983050 ACCTCCTGGCCTGGGCTGTCTGG - Intergenic
931239765 2:60441648-60441670 ATATCCTCTCCTGGCCTAGGGGG - Intergenic
933891831 2:86778955-86778977 AGACCTTGGCCTGGCCTGCCAGG - Intergenic
934521700 2:95024076-95024098 ATGTCCTTACCTGGCCTGGAGGG - Intergenic
934755726 2:96823406-96823428 CTGGCCTGGCCTGGCCTGACAGG + Intronic
934770992 2:96907533-96907555 CTGGCCTAGCCTGGCCTGGCTGG - Intronic
936251176 2:110869571-110869593 AGAGCCTGGCCTGGCCTTGCTGG - Intronic
936251652 2:110872599-110872621 AAAGCCTGGCATGGCCTTGCTGG - Intronic
936992980 2:118385866-118385888 AGACCCCTGCCTGGCCTGGCTGG + Intergenic
937291915 2:120787106-120787128 AGACCCCTGCCTGGCCTGGCAGG + Intronic
938343357 2:130549642-130549664 AGAGCCAGACCTGGCCTGGCTGG + Intronic
938346476 2:130571080-130571102 AGAGCCAGACCTGGCCTGGCTGG - Intronic
938384867 2:130858089-130858111 ATCTCCTGGCCAGGCGTGGTGGG - Intronic
938385248 2:130861566-130861588 ATCTCCTGGCCAGGCGTGGTGGG - Intronic
939108472 2:137977795-137977817 ATGCCCTGGCCTGGCCCTGCTGG + Intronic
944712341 2:202345990-202346012 ATAGTCTGGCCTGGACTGGAAGG - Intergenic
946175738 2:217921090-217921112 TTCCCCTGGCCAGGCCTGGCAGG + Intronic
948464455 2:238145570-238145592 AGATCATGGCCTGGCATGGGAGG + Intronic
1170269328 20:14506662-14506684 ATGTTCTGGCCAGGCCTGGTGGG + Intronic
1170885442 20:20336853-20336875 TTATGATGGCCTGGCATGGCAGG - Intronic
1172304405 20:33871085-33871107 AGCCCCTGGCCTGGCCTGGCAGG - Intergenic
1173546734 20:43903651-43903673 AAATCCGGGCCTAACCTGGCAGG + Intergenic
1175247073 20:57588672-57588694 ATGTCCTGGGGAGGCCTGGCAGG + Intergenic
1176041646 20:63068853-63068875 CTATCCTGACCAGGGCTGGCAGG - Intergenic
1178942213 21:36915493-36915515 AACACCTGGCCAGGCCTGGCAGG + Intronic
1180732279 22:17991107-17991129 ACGTCCTGGCAGGGCCTGGCTGG - Intronic
1181116789 22:20636515-20636537 GTGCCCTGGCCAGGCCTGGCTGG - Intergenic
1181461067 22:23086282-23086304 ATTTCCCGGGGTGGCCTGGCTGG - Intronic
1181516970 22:23420109-23420131 GTGTCCTGGCAGGGCCTGGCTGG - Intergenic
1181519152 22:23435408-23435430 CTATCCTGGCTTGGCCTGCATGG + Intergenic
1181820536 22:25472117-25472139 ATCTCCTGGCAAGGCCTGTCAGG + Intergenic
1182353616 22:29712372-29712394 CTCTGCTGGCCTCGCCTGGCAGG - Intergenic
1182797293 22:33000288-33000310 ACATCCTTGCCTAGCCAGGCTGG + Intronic
1183654352 22:39176291-39176313 ATATCCTGTTCTGGGCTGGCGGG + Intergenic
1184257270 22:43294430-43294452 AGGCCCTGGCCAGGCCTGGCAGG + Intronic
1184687922 22:46104760-46104782 CGCTCCTGGCCTGGCCCGGCCGG + Intronic
1184974581 22:48051980-48052002 TTAACCTGGGCTGGCCTGGCCGG - Intergenic
949865243 3:8541914-8541936 TGATCCTGGCCTTGCCTGGCTGG - Intronic
949953226 3:9246759-9246781 ATATCCTGACCTGACCTTGTGGG + Intronic
952496741 3:33922659-33922681 TTCTCCTGACCTGGCATGGCTGG + Intergenic
954040124 3:47879719-47879741 ATTACCTGGCCTGGAGTGGCTGG + Intronic
958991757 3:100854214-100854236 TTATCCAGGCCTGGGATGGCGGG + Intronic
959632128 3:108518622-108518644 ATCCCCAGGCCTGACCTGGCTGG + Intronic
962332980 3:134496482-134496504 ATATTCTGGCCTGATCTGGACGG + Intronic
962512898 3:136120118-136120140 ATATCCAGGCCTGTCCGGGGGGG + Intronic
964753967 3:160078014-160078036 ACTTCCTGGCATTGCCTGGCTGG + Intergenic
967919142 3:194601592-194601614 TTAGCCTGGCATGGCCAGGCGGG - Intronic
968463022 4:735209-735231 ACAGCCTGGGCAGGCCTGGCAGG - Intronic
969352614 4:6606437-6606459 CTCTCCTGGCCTAACCTGGCAGG - Intronic
970421242 4:15907231-15907253 CTAGGCTGGCCTGGCCTGGTTGG - Intergenic
979301582 4:119093218-119093240 TCCTCCTGGGCTGGCCTGGCTGG + Intergenic
985999183 5:3616714-3616736 ATCTCCTGGCCTGGCCACACTGG + Intergenic
986041142 5:3995194-3995216 CCATCCTGACCGGGCCTGGCAGG - Intergenic
987148769 5:15017812-15017834 ACCTCCCGGCCTGCCCTGGCCGG - Intergenic
988592472 5:32561103-32561125 ATATCCTGGTCTGGCCTGGGAGG + Intronic
996484279 5:124012909-124012931 TGAGCCTGGCCTGGCCTGTCTGG + Intergenic
997210353 5:132073475-132073497 ACTTCCTGGCCTGGAATGGCTGG - Intergenic
998181904 5:139951823-139951845 GCAGCCTGGCCTGGCCTGGCAGG + Intronic
998410895 5:141910391-141910413 CTCTGTTGGCCTGGCCTGGCTGG + Intergenic
999238818 5:150115686-150115708 ATCTCCTGGCCTGGCCTGACCGG - Exonic
1000357916 5:160418821-160418843 AGACGCAGGCCTGGCCTGGCAGG + Intronic
1000581321 5:163038375-163038397 ATATCCTGGTCTGGCCCAGGTGG + Intergenic
1002183116 5:177441631-177441653 AGCTCCTGGCCTGCCCTGGCAGG + Intronic
1004177247 6:13350510-13350532 CTATGGTGGCCTTGCCTGGCAGG - Intergenic
1004974810 6:20952766-20952788 ATATGCAAGCGTGGCCTGGCAGG + Intronic
1005998255 6:30945335-30945357 CTGGCCTGGCCTGGCCTGGCAGG - Intronic
1006473099 6:34238863-34238885 AGAGCCTGGCCCGGCCTGCCTGG - Intronic
1006600428 6:35221990-35222012 ATATCCTGGGCTAGCCTGGCTGG + Intronic
1007776863 6:44228782-44228804 ACCTCCTGGCCTGCCCTGGGTGG + Intronic
1008000569 6:46355875-46355897 ATTTCCAGGCCTGGCCTGTGTGG + Intronic
1008825680 6:55690155-55690177 ATACCCTGTACTGGCATGGCTGG - Intergenic
1010935811 6:81860047-81860069 AAATGCTGGCGTGGCCTGGGAGG - Intergenic
1012505605 6:99943029-99943051 TTATCCTGGCATTGCCTGTCTGG - Exonic
1012824339 6:104127619-104127641 ATATCCTTTCCTGGACTGACTGG + Intergenic
1012872455 6:104688109-104688131 ATATTCTGGCATCACCTGGCTGG + Intergenic
1012957775 6:105589692-105589714 ATATGCTGGCCTGACCTTACTGG + Intergenic
1014786098 6:125621226-125621248 ATCTCCTGGCCTCTCTTGGCAGG - Intergenic
1018784872 6:167100237-167100259 ATGTCCTGGCCTGGCCCGGGCGG + Intergenic
1019162247 6:170076463-170076485 TCGCCCTGGCCTGGCCTGGCTGG - Intergenic
1019592129 7:1840918-1840940 CTATCCTGGCTTGGCCTGCGTGG - Intronic
1023865384 7:44235851-44235873 ATTTCATGGCCTGGCCAGCCAGG - Intronic
1024042961 7:45569054-45569076 GTAGCCTGGCCAGGCCGGGCAGG + Intergenic
1024217855 7:47263100-47263122 ACACCCTGGCCTGGGCAGGCAGG - Intergenic
1025004239 7:55342758-55342780 TTCCCCAGGCCTGGCCTGGCAGG + Intergenic
1026247283 7:68632523-68632545 ATATTTTGGCCTGGGCTGGGTGG - Intergenic
1026943548 7:74302472-74302494 ATCTTCTGGCCAGGCCTGGTGGG - Intronic
1029473143 7:100767094-100767116 ATGTCCTGACCCGGCCTTGCTGG + Exonic
1030199740 7:106890755-106890777 ATATCCAGGCTTGGCCTGCTAGG + Intronic
1031933579 7:127712444-127712466 ATACCCTGGCCAGGCATGGTGGG - Intronic
1032429509 7:131849446-131849468 TGGTTCTGGCCTGGCCTGGCAGG + Intergenic
1034449688 7:151130642-151130664 ACTTCCAGGCCTGGCCTTGCAGG - Intronic
1035025175 7:155820342-155820364 TTCTCCTGACCTGGCATGGCTGG - Intergenic
1036280684 8:7397927-7397949 ACAGCCTGGCCCGGCCTTGCAGG + Intergenic
1036340782 8:7913646-7913668 ACAGCCTGGCCCGGCCTTGCAGG - Intergenic
1037304419 8:17490567-17490589 AGATCCTGGCCTCACCTGGAGGG - Intergenic
1046783083 8:118236579-118236601 AAAACCTCGCCTGGGCTGGCTGG + Intronic
1048185591 8:132237623-132237645 ATATCCTGGACTGCCCTCGTGGG - Intronic
1048442428 8:134469790-134469812 TTGTCCTGTCCTGGCCTTGCAGG - Intergenic
1048969997 8:139640087-139640109 CTATCCGAGCCTGGCCTGGGAGG - Intronic
1048996816 8:139799729-139799751 ATGTCCTACCCCGGCCTGGCAGG + Intronic
1049246424 8:141565222-141565244 CTTTCCAGGCCTTGCCTGGCAGG + Intergenic
1049530682 8:143153328-143153350 AGACCCAGGGCTGGCCTGGCTGG - Intergenic
1049788799 8:144463584-144463606 ATATCCTGGCCTGGCCTGGCAGG - Intronic
1053201411 9:36153967-36153989 AGATGCTGGCCTGGCCTGGGTGG - Intronic
1054973496 9:71116163-71116185 ATATCCTGGCCTTGCTTGCCAGG + Intronic
1056100359 9:83294964-83294986 GTATCCTAGCCTGGCCTGGAGGG - Intronic
1057078474 9:92154162-92154184 ATGCCCTGGCCTTGCCTGGGTGG - Intergenic
1057726333 9:97571149-97571171 GAATCCCAGCCTGGCCTGGCAGG + Intronic
1057938384 9:99259364-99259386 ATATCGGGGCCAGGCCTTGCTGG + Intergenic
1059334928 9:113563057-113563079 CTCTCCTATCCTGGCCTGGCAGG + Intronic
1060219571 9:121757200-121757222 CCATCCTCTCCTGGCCTGGCTGG + Intronic
1060297167 9:122350715-122350737 TTTTCCAGGGCTGGCCTGGCAGG - Intergenic
1061201666 9:129141742-129141764 ACCTCCTGGCCAGGCCAGGCTGG + Intronic
1061264855 9:129499022-129499044 ATTTCCTAGTCTGGCCTGGCTGG - Intergenic
1061452078 9:130673160-130673182 AGACTCAGGCCTGGCCTGGCTGG - Intronic
1061711298 9:132489793-132489815 TCATCCTGGCCTGGGCTGGTGGG + Intronic
1061873746 9:133534030-133534052 AGCTCCAGGCCTGGCCTGCCAGG + Intronic
1062190745 9:135246705-135246727 GAAGCCTGGGCTGGCCTGGCTGG + Intergenic
1062400557 9:136370790-136370812 CCACCCTCGCCTGGCCTGGCGGG - Intronic
1189234295 X:39475757-39475779 AAGTCCTGGGGTGGCCTGGCAGG + Intergenic
1192496309 X:71618401-71618423 GAATTCTGGCCTGGCCTGGCTGG + Intronic
1194689633 X:96967701-96967723 ATATCCTGGCCAGGCATGGTGGG - Intronic
1195060779 X:101191717-101191739 CTATCCTGGGCCGGCCGGGCGGG - Intergenic
1201179715 Y:11332989-11333011 CTCTCCTGGCGCGGCCTGGCTGG - Intergenic