ID: 1049788800

View in Genome Browser
Species Human (GRCh38)
Location 8:144463588-144463610
Sequence CCAGATATCCTGGCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049788800_1049788809 12 Left 1049788800 8:144463588-144463610 CCAGGCCAGGCCAGGATATCTGG 0: 1
1: 0
2: 1
3: 26
4: 235
Right 1049788809 8:144463623-144463645 TCCCTGGAGAGTAAGGGCCCAGG No data
1049788800_1049788804 -4 Left 1049788800 8:144463588-144463610 CCAGGCCAGGCCAGGATATCTGG 0: 1
1: 0
2: 1
3: 26
4: 235
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788800_1049788811 13 Left 1049788800 8:144463588-144463610 CCAGGCCAGGCCAGGATATCTGG 0: 1
1: 0
2: 1
3: 26
4: 235
Right 1049788811 8:144463624-144463646 CCCTGGAGAGTAAGGGCCCAGGG No data
1049788800_1049788807 6 Left 1049788800 8:144463588-144463610 CCAGGCCAGGCCAGGATATCTGG 0: 1
1: 0
2: 1
3: 26
4: 235
Right 1049788807 8:144463617-144463639 ACCATGTCCCTGGAGAGTAAGGG No data
1049788800_1049788806 5 Left 1049788800 8:144463588-144463610 CCAGGCCAGGCCAGGATATCTGG 0: 1
1: 0
2: 1
3: 26
4: 235
Right 1049788806 8:144463616-144463638 CACCATGTCCCTGGAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049788800 Original CRISPR CCAGATATCCTGGCCTGGCC TGG (reversed) Intronic
900094067 1:933302-933324 CGACACAGCCTGGCCTGGCCCGG - Intronic
900609833 1:3539825-3539847 CCTGGGACCCTGGCCTGGCCCGG - Intronic
901070901 1:6517796-6517818 CGGGATAGCCTGGCCTGGCCTGG - Intronic
901144858 1:7057936-7057958 CAAAATGGCCTGGCCTGGCCTGG - Intronic
901422256 1:9159010-9159032 AAAGAAATTCTGGCCTGGCCTGG + Intergenic
901441577 1:9281492-9281514 CCAGGGCTCCTGGCCTGGCGGGG + Intergenic
901761029 1:11471740-11471762 CCAGCTGTGCTGTCCTGGCCTGG + Intergenic
901829923 1:11886138-11886160 CCTAATGTCCTGGCCTGGGCAGG + Intergenic
902578853 1:17395846-17395868 CCAGATGTTCTGGGATGGCCTGG + Intronic
902919038 1:19655742-19655764 CCCGAGAACCTGGCATGGCCTGG + Intronic
903265782 1:22157136-22157158 CCAGACACCCTGGCTGGGCCCGG - Intergenic
903684376 1:25120169-25120191 CCTGATCTCCTGGCCCTGCCTGG + Intergenic
904049294 1:27628892-27628914 CCAGAGAGCCAGGCCTGGCCAGG - Intronic
904598959 1:31663423-31663445 CCAGATGCCCTGGCCAGGCCAGG - Intronic
904705183 1:32384638-32384660 ACAGATAGCCTTGCCTTGCCTGG + Intronic
904713637 1:32450154-32450176 CTTGAAATCTTGGCCTGGCCGGG + Intergenic
904719820 1:32499755-32499777 CGAAATATCCTGGCCGGGCGCGG + Intronic
905219253 1:36432811-36432833 CCAGAAATCCTGGTTTGCCCAGG - Intronic
905403230 1:37717677-37717699 CCAAAAGTCCTGGCCAGGCCGGG - Exonic
905435395 1:37952038-37952060 CCAGGGATCCTGGCCTTTCCTGG - Intergenic
905602420 1:39264962-39264984 CAAGAAATCCTGGCCGGGCGCGG - Intronic
905884735 1:41485536-41485558 CAAGACATCCTGTCATGGCCAGG - Intergenic
907289380 1:53403067-53403089 CCAGGGCTCCTGGGCTGGCCTGG - Intergenic
912396101 1:109345222-109345244 CAAAATATCCTGGCCGGGCGCGG + Intronic
912611003 1:111043967-111043989 CCAGGAATCCTAGCCAGGCCAGG - Intergenic
913452568 1:119001851-119001873 CCAGGTTTCCTGGCCTTGCAAGG + Intergenic
914797324 1:150931293-150931315 ACAGACATCCTGGCCAGGCGTGG + Intronic
916059497 1:161088984-161089006 CCAGACATAGTGACCTGGCCTGG + Intronic
916059685 1:161089808-161089830 CCTTTCATCCTGGCCTGGCCTGG - Intergenic
916213125 1:162374350-162374372 CAAGAAATCCAGGCATGGCCTGG - Exonic
916908080 1:169311126-169311148 TCAAATATCCTGGCCGGGCGCGG + Intronic
919844164 1:201630510-201630532 CCAGATATCCCTTCTTGGCCTGG + Intronic
920066338 1:203272559-203272581 CCAGAGAACCCAGCCTGGCCTGG + Intronic
920243850 1:204573365-204573387 GCAGAGATGCTGCCCTGGCCTGG - Intergenic
922051598 1:221995723-221995745 CCAGAAAAGCTGGCCTGGCCAGG - Intergenic
922852093 1:228741457-228741479 CCAGATACCAGGGCATGGCCAGG + Intronic
924192492 1:241568531-241568553 ACAGATATCATGGGCTGGGCAGG - Exonic
1069752435 10:70752893-70752915 CTGGTTATCATGGCCTGGCCTGG - Intronic
1070281098 10:75049485-75049507 CCTGAGGCCCTGGCCTGGCCTGG - Intronic
1070933942 10:80279206-80279228 CCACTGATCCTGGCCTGGCTGGG + Intronic
1072731152 10:97848027-97848049 ACAGATATCGTGGCCGGGCGCGG - Intergenic
1074110195 10:110417436-110417458 AAAGACAGCCTGGCCTGGCCTGG - Intergenic
1077109141 11:854432-854454 CCCCATATACTGGCCTGGCTCGG + Intronic
1077147748 11:1053509-1053531 CCAGGCAGCCTGCCCTGGCCCGG - Intergenic
1077800241 11:5529538-5529560 CCTGATATCCTAACCTGTCCTGG + Intronic
1078476223 11:11632682-11632704 CCCGAAATCCTGCCCTGGGCTGG + Intergenic
1079204105 11:18398907-18398929 CAAGACAGCCTGGCCAGGCCAGG - Intronic
1079428254 11:20363944-20363966 CCAGGTCTCCTGGCCGGGCCGGG + Intronic
1079674130 11:23203267-23203289 CCACACCTCCTGGGCTGGCCTGG - Intergenic
1081667470 11:44925011-44925033 ACTGATGTCCTGGCCTGGCCTGG + Intronic
1081713725 11:45234088-45234110 CCAGACATCCCCGCCCGGCCCGG - Intronic
1083140677 11:60718689-60718711 CCACAGTTCCTGGGCTGGCCTGG + Intergenic
1084013458 11:66365352-66365374 CCAGAAATCAGGGACTGGCCTGG + Intronic
1084593998 11:70106417-70106439 CCAGAAAGCCCAGCCTGGCCGGG + Intronic
1085243130 11:75075095-75075117 CCAGATATCCTGGCAGGCCTGGG - Intergenic
1085246813 11:75108610-75108632 CCAGATATCCTGGCAAGTCTGGG - Intronic
1088597039 11:111448564-111448586 ACAGGCATCCTGGCCGGGCCAGG - Intronic
1090447542 11:126776845-126776867 CCAGCTTTCCTGGCCCTGCCTGG + Intronic
1091695594 12:2626146-2626168 CCAGATGCCCTGGCCATGCCTGG + Intronic
1092151513 12:6252094-6252116 CAAGATATCCTGACCGGGCGCGG - Intergenic
1092241973 12:6840901-6840923 CCAGAGGAGCTGGCCTGGCCTGG - Exonic
1095473804 12:42565167-42565189 CCAGATGTGCTGTGCTGGCCGGG - Intronic
1096145477 12:49275950-49275972 GCAGATCTCCTGGCCTGGGAAGG - Intergenic
1097593223 12:61597119-61597141 ATACATATCCTGGCCTAGCCTGG + Intergenic
1101620050 12:106377066-106377088 CCAGAGTTACTGGCCTTGCCTGG + Intronic
1101915068 12:108889628-108889650 CCAGATTTCCTGTCCTACCCAGG + Intronic
1104190609 12:126479157-126479179 CCAGAAACCCTTCCCTGGCCAGG - Intergenic
1105612994 13:21985679-21985701 CCACCTTGCCTGGCCTGGCCTGG + Intergenic
1105848232 13:24311401-24311423 CCAGACATACTGGCATGGTCAGG - Intronic
1106606072 13:31230587-31230609 CCAGAGAACCTGGCCTTGCAGGG - Intronic
1108356266 13:49631121-49631143 CAAGAAATGCTGGCTTGGCCCGG + Exonic
1108584997 13:51863433-51863455 ACAGGCATCCTGGCCTGACCTGG + Intronic
1111618502 13:90693004-90693026 ACAGATGTCCTGGCCAGGCGCGG - Intergenic
1112158882 13:96848232-96848254 CCACACATCCTGGCCTGGGCTGG - Intergenic
1113476939 13:110590666-110590688 CCAGCTGTCCTGGCTTGCCCAGG - Intergenic
1119211463 14:72835355-72835377 AAAGAAATCCTGGCCTGGCATGG - Intronic
1119747837 14:77057056-77057078 CCATATATCCTGGCAGGGTCAGG + Intergenic
1122352028 14:101101860-101101882 CCAGCTATCCATGACTGGCCAGG - Intergenic
1124367183 15:29080421-29080443 CCAGAGCTCCTGGCCTTGTCAGG + Intronic
1125213931 15:37247267-37247289 CCAAATATCAGGGCCTGGCAAGG + Intergenic
1126908099 15:53389262-53389284 GTAGATGTCCCGGCCTGGCCTGG + Intergenic
1127282713 15:57505470-57505492 CCAGGTAGCCTGGCCTTGCAAGG + Intronic
1127670002 15:61186348-61186370 CCAGATGCCCTGGCCAGGCACGG + Intronic
1127866897 15:63040990-63041012 CCAGGGATCCAGACCTGGCCTGG - Intergenic
1128139004 15:65285948-65285970 ACAGATTTTCTAGCCTGGCCAGG - Intronic
1129323378 15:74787012-74787034 CCCAAGATGCTGGCCTGGCCTGG + Intronic
1130525089 15:84699017-84699039 CAAAATATGCTGTCCTGGCCAGG + Intronic
1130561949 15:84965747-84965769 CCAACTATCCTGGCTTGCCCAGG - Intergenic
1132347463 15:101116910-101116932 CCAGACCTCCTGGCCTGGGTGGG - Intergenic
1132467332 16:83374-83396 CCCGAAACCCTGGCCTGGCCTGG - Intronic
1132552200 16:558165-558187 ACTGATATCCCGGCCTCGCCTGG + Intergenic
1132878831 16:2152161-2152183 ACAGGTATCCTGGCCAGGCATGG + Intronic
1133313813 16:4869593-4869615 CCACATGGCCTCGCCTGGCCGGG + Intronic
1136278317 16:29192315-29192337 CCAGACACCCTTGCCTGCCCCGG - Intergenic
1137043993 16:35639471-35639493 GCAGAACTTCTGGCCTGGCCAGG - Intergenic
1140899993 16:79358488-79358510 CCAGAGATCCCAGCCAGGCCTGG + Intergenic
1142082695 16:88158349-88158371 CCAGACACCCTTGCCTGCCCCGG - Intergenic
1143386480 17:6534165-6534187 CCAGATATCCTGTCTTGACAGGG + Intronic
1143645230 17:8225662-8225684 CCGGCTGGCCTGGCCTGGCCTGG - Intergenic
1144245531 17:13360061-13360083 CCAGGTATCCTGTCCTGGAAGGG - Intergenic
1145292811 17:21563389-21563411 ACACATATCATGTCCTGGCCTGG - Intronic
1145387149 17:22422546-22422568 ACACATATCATGTCCTGGCCTGG + Intergenic
1146004415 17:29151849-29151871 GCAGAAATCCTGGCATGCCCTGG - Intronic
1146169286 17:30620931-30620953 GCAGACATGCTGGCCTGGACAGG + Intergenic
1146170276 17:30626518-30626540 GCAGACATGCTGGCCTGGACAGG - Intergenic
1146343731 17:32042548-32042570 GCAGACATGCTGGCCTGGACAGG - Intronic
1147652337 17:42069675-42069697 CCAGCCAGCCTGGCCTGGTCTGG - Intergenic
1147754119 17:42756893-42756915 CTAGATTTCCAGGCCAGGCCCGG + Intergenic
1148187424 17:45654802-45654824 CCAGATGACCAGGCCTTGCCAGG + Intergenic
1149870961 17:60181167-60181189 ACAGAAATCTTGGCCTGCCCAGG - Intronic
1150224575 17:63516976-63516998 ACAGATATCTTGGCCAGGCGTGG - Intronic
1150347220 17:64413580-64413602 CCAGACTTCCTGCCCTGCCCAGG + Intronic
1150953227 17:69825428-69825450 CCAGATATACTACCCTGGCTAGG - Intergenic
1151451560 17:74201140-74201162 CCAAATGTCCTGGAGTGGCCGGG - Intergenic
1152178457 17:78802804-78802826 CGGCAGATCCTGGCCTGGCCCGG + Intronic
1154492880 18:14934636-14934658 CCAGATGCCCTAGCCTGGCATGG - Intergenic
1155270264 18:24134563-24134585 CCAGATGTCCAGGCCGGGCACGG - Intronic
1156586244 18:38434067-38434089 CCAGATCTCCTGACCAGGCCAGG - Intergenic
1157877557 18:51287800-51287822 CCAAATCTCCCTGCCTGGCCAGG - Intergenic
1159963030 18:74570313-74570335 AAAGAAATCCTGGCTTGGCCCGG + Intronic
1160328614 18:77972103-77972125 GCAGATGCCCTAGCCTGGCCTGG - Intergenic
1160691749 19:463581-463603 CCACCTGGCCTGGCCTGGCCTGG + Exonic
1160879325 19:1312441-1312463 CCAGGGCCCCTGGCCTGGCCCGG + Intergenic
1160997485 19:1890049-1890071 CCAGCCATGCTGGCCTGGCCAGG + Intergenic
1161634022 19:5375827-5375849 CCATGTATCCTGTCCTGGCAAGG + Intergenic
1162175702 19:8828664-8828686 TCAGAAATCCTTGCCTAGCCGGG + Intronic
1162390399 19:10386317-10386339 CCAACTGTCCTGGCCTGCCCAGG - Intergenic
1163603020 19:18259973-18259995 CCACATCTCCTGGCCTAGCTGGG - Intronic
1163832026 19:19551669-19551691 CCTGGAATCCTGGCCAGGCCGGG + Intergenic
1164244949 19:23420708-23420730 TCAGATGGCCTGGCCTGGCCTGG + Intergenic
1164533017 19:29062377-29062399 ACAGCTTTCTTGGCCTGGCCAGG - Intergenic
1164578938 19:29422396-29422418 CCTGCTGTCATGGCCTGGCCTGG + Intergenic
1165039289 19:33057748-33057770 ACAGATCTCCTGGTCTGGGCTGG - Intronic
1165741362 19:38207038-38207060 CCAGCTAACCAGGCCAGGCCGGG + Exonic
1165874677 19:38997816-38997838 CAAGAGATCCTCCCCTGGCCAGG + Intronic
1166798781 19:45443675-45443697 CCGGATGTCCTGGCCGGGCCGGG + Intronic
1166864261 19:45826532-45826554 GCAGATATCCTGGCCAGGGCCGG + Intronic
1166916266 19:46197825-46197847 CCAGGGCTCCTGTCCTGGCCAGG - Intergenic
1168366412 19:55791972-55791994 CCAAAGATCCTGCCCTGGCCTGG - Intronic
926678227 2:15644591-15644613 CCAGAGCTCCTGGCCCAGCCTGG + Intergenic
929396320 2:41527199-41527221 CCAGATACCCAGACCTTGCCTGG + Intergenic
929711158 2:44267946-44267968 CCAGGGATACTGGGCTGGCCTGG + Intergenic
929746140 2:44660885-44660907 CAAAATACACTGGCCTGGCCAGG - Intronic
933304260 2:80577630-80577652 CCAGCAAGTCTGGCCTGGCCTGG - Intronic
933752467 2:85611828-85611850 CCACCACTCCTGGCCTGGCCTGG - Intronic
934763549 2:96868866-96868888 CCAGGGACCCTGGCCTGGGCGGG + Intronic
937047365 2:118858894-118858916 CCAGAAATGCTGACCTGGGCAGG + Intergenic
937985649 2:127637027-127637049 CCAGATCTGCTGGCCCCGCCTGG - Intronic
939034792 2:137117847-137117869 CCAGATCTCTTGGCCTAGGCTGG + Intronic
940636650 2:156306052-156306074 CCAGAGATGGTGGCTTGGCCAGG + Intergenic
942047832 2:172110161-172110183 CCAAATCCCCTGGCCTGGCCTGG - Intergenic
943087861 2:183334820-183334842 TAAGATATCCTGGCCGGGCGCGG - Intergenic
943890023 2:193275253-193275275 CCTGCTATCCTGGCCCAGCCAGG - Intergenic
946066829 2:216995140-216995162 CCAGAAATCCTGGCTGAGCCAGG - Intergenic
947215648 2:227747623-227747645 CCAGGTATTCTGGCCAGGCGTGG + Intergenic
947301071 2:228689145-228689167 CCAGAGACCCTGGCCTGGGGTGG + Intergenic
948050128 2:234973928-234973950 CCAAAAATCCAGGCTTGGCCAGG - Intronic
948159579 2:235813093-235813115 CCAGATATTCTGGACTGTTCTGG - Intronic
948562705 2:238864872-238864894 GCGGATCTCCAGGCCTGGCCTGG - Intronic
948754271 2:240150093-240150115 CCAGGCATCCTGCCCTGGACTGG - Intergenic
948776431 2:240291297-240291319 CCAGAGATGCTGGGCTGGCCGGG + Intergenic
948776455 2:240291384-240291406 CCAGAGATGCTGGGCTGGCCGGG + Intergenic
948864202 2:240767215-240767237 CCAGATCCCAGGGCCTGGCCAGG + Intronic
948939866 2:241190347-241190369 ACCGCTCTCCTGGCCTGGCCTGG + Intronic
1168734109 20:115524-115546 CCAGCTAGCCTTGCCTGGCTCGG - Intergenic
1168814159 20:725285-725307 ACAGTGATCCTTGCCTGGCCTGG - Intergenic
1168954975 20:1828395-1828417 CCATGTATCCTGGCCTGACTTGG + Intergenic
1170828688 20:19820643-19820665 CCAGGAAGACTGGCCTGGCCTGG - Intergenic
1172432729 20:34906043-34906065 TCTGATATCCTGGCCGGGCGCGG + Intronic
1172842029 20:37907737-37907759 ACAAAGATCCTGGCTTGGCCGGG + Intronic
1173162741 20:40664381-40664403 CCTGATGGCCTGGCCTGGCCTGG + Intergenic
1173468384 20:43302515-43302537 CTATGTATCCTGGCCTGGGCTGG + Intergenic
1173585849 20:44182518-44182540 GCAGACATCGTGGCCTGGGCTGG - Intronic
1174745616 20:53058806-53058828 GCAGAGATCCAGGTCTGGCCTGG + Intronic
1177680684 21:24365663-24365685 CTAGATTTCCTGGCATAGCCAGG - Intergenic
1177944987 21:27456495-27456517 TAAGATATCCTGGCCGGGCGCGG - Intergenic
1179474266 21:41633307-41633329 CCAGAACTGCTAGCCTGGCCGGG + Intergenic
1181522401 22:23457116-23457138 CCGGCTGGCCTGGCCTGGCCTGG - Intergenic
1181725444 22:24807662-24807684 GCAGACATCGTGGGCTGGCCTGG + Intronic
1181873690 22:25923337-25923359 CCAGCCATCCTGGCTTGCCCAGG - Intronic
1183618651 22:38960073-38960095 CCAGGGATCCTGTCCTGCCCAGG + Intronic
1184775464 22:46620804-46620826 CCTGAGAACCTGGCCTGGTCAGG + Intronic
949262520 3:2118975-2118997 CCAAATATCCAGACCTAGCCTGG - Intronic
949675974 3:6453758-6453780 CCAGATATCTCAGCCTGGACTGG + Intergenic
949865036 3:8540574-8540596 CCAGTTCGCCTGGCCTGGCCTGG - Intronic
949875107 3:8621436-8621458 CCAGATCTCCAGGGATGGCCAGG - Intronic
950371167 3:12531933-12531955 TGAGAAGTCCTGGCCTGGCCAGG - Intronic
950652605 3:14416612-14416634 GCAGATCCCCTGGCCTGGCTTGG + Intronic
953079280 3:39600324-39600346 CCAAGCATGCTGGCCTGGCCAGG + Intergenic
953958373 3:47248185-47248207 CCAGACATCCTGGCCATTCCTGG + Intronic
955618930 3:60840215-60840237 GCATATATCCTGGCCTGCCTGGG - Intronic
957879154 3:86187757-86187779 CCACACATCCTGGCCTGTCAGGG + Intergenic
959484685 3:106913385-106913407 CCGCATCTCCTGGACTGGCCTGG - Intergenic
960302870 3:116025748-116025770 CCAGAAATACTGGGCTGGCCAGG - Intronic
961033017 3:123623025-123623047 CCAGCCATCCTGGCTTGCCCAGG + Intronic
963054993 3:141179091-141179113 CCTGGAACCCTGGCCTGGCCAGG - Intergenic
963804251 3:149707333-149707355 CCAAAAACCCAGGCCTGGCCTGG - Intronic
965687233 3:171317199-171317221 CCAAAGAACCTGGCCTGACCCGG - Intronic
967513412 3:190338866-190338888 CCAGATCTCCTTGACTGGGCTGG + Intronic
969677229 4:8620827-8620849 CCAGAGCTCCAGGCCTGGGCAGG + Intergenic
969678181 4:8626465-8626487 CCAGAGCTCCAGGCCTGGGCAGG + Intergenic
969679137 4:8632103-8632125 CCAGAGCTCCAGGCCTGGGCAGG + Intergenic
972486721 4:39548902-39548924 CCAGATTTTCTGGCCAGGCACGG + Exonic
972852700 4:43070707-43070729 CCAGGTATCCAGGCTTGGCAGGG - Intergenic
972978322 4:44664115-44664137 CCCCGGATCCTGGCCTGGCCCGG - Intronic
975629794 4:76388308-76388330 CCAGAAATGCTGCCCTGCCCAGG - Intronic
980435340 4:132764713-132764735 CAAGAACTCCTGGACTGGCCTGG + Intergenic
981418548 4:144521651-144521673 CCACATACCCTGTCCTTGCCTGG + Intergenic
983627369 4:169815305-169815327 CCAGGTGTCCAGGACTGGCCTGG - Intergenic
984847483 4:184120233-184120255 CCAGCTCCCCTGTCCTGGCCTGG - Intronic
986667964 5:10119446-10119468 CCATATCACCTGGCATGGCCAGG - Intergenic
987297023 5:16562357-16562379 ACAGATATCCTGGGCTGCCTTGG - Intronic
988366103 5:30302146-30302168 ACAGAAAGCATGGCCTGGCCAGG - Intergenic
990531625 5:56679752-56679774 CCAGATGGCCTGGCCTCTCCAGG - Intergenic
993700169 5:91109735-91109757 ACAGATACTCTGGCCAGGCCTGG + Intronic
996292955 5:121875751-121875773 CAAGATTTCCTGGCCGGGCGAGG - Intergenic
997528239 5:134567075-134567097 CCATCTACCCTGCCCTGGCCCGG - Intronic
998181903 5:139951819-139951841 CCAGGCAGCCTGGCCTGGCCTGG + Intronic
998186394 5:139982981-139983003 CCAGACATCAGGGCCTGGCCTGG - Intronic
1002699495 5:181112695-181112717 CCTGATATCCTAGGCTGGGCCGG + Intergenic
1003343396 6:5243061-5243083 GCAGAAATCCTGGCCGGGCGCGG - Intronic
1006427869 6:33977425-33977447 ACAAAGATCCTGTCCTGGCCAGG - Intergenic
1006600427 6:35221986-35222008 CCATATATCCTGGGCTAGCCTGG + Intronic
1007776861 6:44228778-44228800 CCATACCTCCTGGCCTGCCCTGG + Intronic
1007957190 6:45928966-45928988 TGAGTTCTCCTGGCCTGGCCTGG - Intronic
1013300104 6:108797068-108797090 TGAGATATGCAGGCCTGGCCTGG + Intergenic
1019168546 6:170115554-170115576 CCAGATATCCAGCCCTGGGGTGG - Intergenic
1020082637 7:5295079-5295101 CCATCTTTCCTGGCCTGGCTGGG + Intronic
1020638575 7:10727304-10727326 CCAGACATTCCAGCCTGGCCTGG - Intergenic
1023982342 7:45077315-45077337 CCAGATCCTCTGGCTTGGCCTGG - Intergenic
1024196411 7:47063808-47063830 CCAGATACCCTGTACAGGCCAGG - Intergenic
1025004238 7:55342754-55342776 CCAGTTCCCCAGGCCTGGCCTGG + Intergenic
1025956898 7:66189958-66189980 CCAGACACCTGGGCCTGGCCTGG - Intergenic
1026680617 7:72463846-72463868 CCACTTTTCCTGGCCTGGCCTGG + Intergenic
1026979853 7:74519789-74519811 CCAGGCATCCTGACCTGCCCTGG - Intronic
1029540895 7:101181251-101181273 ACAATTAGCCTGGCCTGGCCGGG + Intergenic
1029594237 7:101528372-101528394 CCAGAGTTCCTGGACAGGCCAGG + Intronic
1030220197 7:107090407-107090429 CCAGCTATCCTGGATTGACCTGG + Intronic
1032423205 7:131799866-131799888 CCAGATGTCCAGGCTGGGCCTGG + Intergenic
1035706914 8:1682762-1682784 CTAGATATCCTGGCTGGGCATGG - Intronic
1045331884 8:101162306-101162328 CCAGAAACCCTGTCCTGGCCGGG - Intergenic
1048992902 8:139771798-139771820 GCAGCTCTCCTGGCCAGGCCAGG + Intronic
1049086346 8:140481301-140481323 CCAGGTAACCTGGCCGGGCGCGG + Intergenic
1049095710 8:140546996-140547018 CCACATATCCTGTCCTGGCCTGG + Intronic
1049475124 8:142793786-142793808 CCTGGAAGCCTGGCCTGGCCCGG - Intergenic
1049493018 8:142914996-142915018 CCAGAGACCCTGGAGTGGCCAGG - Intronic
1049788239 8:144461557-144461579 CTAGGAAGCCTGGCCTGGCCTGG + Intronic
1049788800 8:144463588-144463610 CCAGATATCCTGGCCTGGCCTGG - Intronic
1054703480 9:68437995-68438017 CCAGAGTTCCTGGCCAGGCGAGG + Intronic
1056100361 9:83294968-83294990 GCACGTATCCTAGCCTGGCCTGG - Intronic
1056436188 9:86577864-86577886 CCTGCCCTCCTGGCCTGGCCGGG + Intergenic
1057245773 9:93452516-93452538 CGGGATAGCCTGGCCGGGCCGGG + Exonic
1060116305 9:120943965-120943987 TAAGATATCCAGGCCTGGCGTGG - Intergenic
1060723971 9:125995377-125995399 CCATCCATCCTGGCCTGGCCAGG + Intergenic
1060723976 9:125995390-125995412 ACAGCCAGCCTGGCCTGGCCAGG - Intergenic
1061201668 9:129141746-129141768 GCAGCCAGCCTGGCCTGGCCAGG - Intronic
1062064446 9:134518569-134518591 CCAGGTCTCCAGGCCTGGACAGG + Intergenic
1062138885 9:134944520-134944542 CCAGGGAGCTTGGCCTGGCCAGG + Intergenic
1062217737 9:135398461-135398483 CGAGACAGCCTGGCCTGTCCGGG - Intergenic
1189237963 X:39503085-39503107 GCAGAGATCATGGCCTGGACAGG + Intergenic
1190654334 X:52597966-52597988 CCAGAAATGCTGGCTTGGGCTGG - Intergenic
1193232614 X:79066110-79066132 ACAGAATTTCTGGCCTGGCCTGG - Intergenic
1197203751 X:123772152-123772174 AGAGATACCCTGCCCTGGCCGGG + Intergenic