ID: 1049788804

View in Genome Browser
Species Human (GRCh38)
Location 8:144463607-144463629
Sequence CTGGAACTCCACCATGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049788798_1049788804 3 Left 1049788798 8:144463581-144463603 CCACCTGCCAGGCCAGGCCAGGA 0: 1
1: 0
2: 8
3: 75
4: 531
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788794_1049788804 12 Left 1049788794 8:144463572-144463594 CCCAGAGGGCCACCTGCCAGGCC 0: 1
1: 0
2: 1
3: 51
4: 659
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788799_1049788804 0 Left 1049788799 8:144463584-144463606 CCTGCCAGGCCAGGCCAGGATAT 0: 1
1: 0
2: 5
3: 24
4: 224
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788800_1049788804 -4 Left 1049788800 8:144463588-144463610 CCAGGCCAGGCCAGGATATCTGG 0: 1
1: 0
2: 1
3: 26
4: 235
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788795_1049788804 11 Left 1049788795 8:144463573-144463595 CCAGAGGGCCACCTGCCAGGCCA 0: 1
1: 0
2: 2
3: 35
4: 329
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788802_1049788804 -9 Left 1049788802 8:144463593-144463615 CCAGGCCAGGATATCTGGAACTC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data
1049788793_1049788804 13 Left 1049788793 8:144463571-144463593 CCCCAGAGGGCCACCTGCCAGGC 0: 1
1: 0
2: 0
3: 38
4: 356
Right 1049788804 8:144463607-144463629 CTGGAACTCCACCATGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049788804 Original CRISPR CTGGAACTCCACCATGTCCC TGG Intronic
No off target data available for this crispr