ID: 1049789737

View in Genome Browser
Species Human (GRCh38)
Location 8:144467077-144467099
Sequence AGAGAGCTGCGGGGGCCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 285}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049789723_1049789737 8 Left 1049789723 8:144467046-144467068 CCGAGTTCCTCTCCGTCCAGCTG 0: 1
1: 0
2: 1
3: 16
4: 203
Right 1049789737 8:144467077-144467099 AGAGAGCTGCGGGGGCCCGGCGG 0: 1
1: 0
2: 2
3: 32
4: 285
1049789722_1049789737 13 Left 1049789722 8:144467041-144467063 CCTCGCCGAGTTCCTCTCCGTCC 0: 1
1: 0
2: 1
3: 5
4: 124
Right 1049789737 8:144467077-144467099 AGAGAGCTGCGGGGGCCCGGCGG 0: 1
1: 0
2: 2
3: 32
4: 285
1049789728_1049789737 1 Left 1049789728 8:144467053-144467075 CCTCTCCGTCCAGCTGGGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1049789737 8:144467077-144467099 AGAGAGCTGCGGGGGCCCGGCGG 0: 1
1: 0
2: 2
3: 32
4: 285
1049789721_1049789737 22 Left 1049789721 8:144467032-144467054 CCTACTGCGCCTCGCCGAGTTCC 0: 1
1: 0
2: 0
3: 8
4: 60
Right 1049789737 8:144467077-144467099 AGAGAGCTGCGGGGGCCCGGCGG 0: 1
1: 0
2: 2
3: 32
4: 285
1049789731_1049789737 -8 Left 1049789731 8:144467062-144467084 CCAGCTGGGGGCGGAAGAGAGCT 0: 1
1: 0
2: 2
3: 14
4: 272
Right 1049789737 8:144467077-144467099 AGAGAGCTGCGGGGGCCCGGCGG 0: 1
1: 0
2: 2
3: 32
4: 285
1049789720_1049789737 23 Left 1049789720 8:144467031-144467053 CCCTACTGCGCCTCGCCGAGTTC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1049789737 8:144467077-144467099 AGAGAGCTGCGGGGGCCCGGCGG 0: 1
1: 0
2: 2
3: 32
4: 285
1049789730_1049789737 -4 Left 1049789730 8:144467058-144467080 CCGTCCAGCTGGGGGCGGAAGAG 0: 1
1: 0
2: 1
3: 21
4: 225
Right 1049789737 8:144467077-144467099 AGAGAGCTGCGGGGGCCCGGCGG 0: 1
1: 0
2: 2
3: 32
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049789737 Original CRISPR AGAGAGCTGCGGGGGCCCGG CGG Exonic
900052244 1:605571-605593 GGAGAGCTGCCGGGGCTGGGTGG + Intergenic
900390347 1:2431191-2431213 AGAGAGCAGCAGGGGCCCCCAGG - Intronic
900507989 1:3039198-3039220 AGAGAGCTGCTGGGGCCGCAGGG - Intergenic
900532197 1:3160156-3160178 ACAGAGCTGGGTGGGCCCTGTGG + Intronic
901004499 1:6165324-6165346 AGAGACCTGTGGGAGCCCTGTGG - Intronic
901792064 1:11658866-11658888 AGGGAGGTGCGTGGGCCTGGGGG + Exonic
903769346 1:25754150-25754172 AGAGAGCTGCAGGGTGCCCGGGG - Intronic
903860108 1:26360022-26360044 CGAGCGGTGCGGAGGCCCGGGGG - Intergenic
904282680 1:29432439-29432461 AGAGGGCTGTGGGGTCCCAGTGG - Intergenic
905199463 1:36306489-36306511 AGAGGGCAGCGGGGGTCGGGGGG - Intronic
905347793 1:37323048-37323070 AGAGAACTGTGGGAGCCCAGAGG - Intergenic
907456400 1:54579257-54579279 AGAGAGCTGCATGGGCCTTGAGG - Intronic
908155929 1:61353125-61353147 TGAGAGCTTTGGGGGCTCGGTGG - Intronic
915519943 1:156436247-156436269 AGAGAGTCGCGGGAGCCCGAGGG + Intergenic
915528116 1:156488481-156488503 AGAGAGCTGAGGGGACCAGGGGG + Intronic
915564483 1:156706078-156706100 TGGGAGCTGCGGGGTTCCGGGGG + Intergenic
915902000 1:159854406-159854428 AGAGGGCCCCGGGGGCCGGGTGG - Exonic
919779602 1:201213434-201213456 AGAGAACTGGGGGTGCCTGGAGG + Exonic
919907016 1:202085248-202085270 AGGGAGCTGGGGGGGACAGGAGG - Intergenic
920264579 1:204712266-204712288 AGAGAGGGGCGGGGGCACGGAGG - Intergenic
920279825 1:204834456-204834478 AGAGAGCAGCAGGAGCCGGGAGG - Intronic
920688494 1:208128042-208128064 GGAGAGCTGCGGGGAGCCTGAGG + Intronic
920841065 1:209554217-209554239 AGAGAGCTACGGGAGCACAGAGG - Intergenic
922373005 1:224929918-224929940 GGAGGGCTGCGTGGGCGCGGAGG + Intronic
922766082 1:228157330-228157352 AGGGAGCTGGAGGGGCCAGGAGG + Intronic
922796428 1:228341898-228341920 GGAGAGCAGTGGGGGCTCGGGGG - Intronic
1063623447 10:7667922-7667944 AAAGAGTTGCGGGGGCGCGTGGG - Intergenic
1064137403 10:12762834-12762856 AGAGAGCAGAGAAGGCCCGGAGG - Intronic
1064561557 10:16599399-16599421 AGAGAGCTGCAGTGGCCCTGAGG - Intronic
1067398951 10:45953177-45953199 AGCGAACTGCGGGGAGCCGGTGG - Intergenic
1067414607 10:46094047-46094069 TGAGAGCTGCGGAGGCCCTGGGG - Intergenic
1067434668 10:46268602-46268624 TGAGAACTGCGGAGGCCCTGCGG - Intergenic
1067439064 10:46298064-46298086 TGAGAGCTGCGGAGGCCCTGGGG + Intronic
1067497767 10:46774915-46774937 AGAGAGCTTCGGGGCCTCGCCGG + Intergenic
1067596882 10:47565499-47565521 AGAGAGCTTCGGGGCCTCGCCGG - Intergenic
1067867273 10:49922390-49922412 AGCGAACTGCGGGGAGCCGGTGG - Exonic
1070314186 10:75295093-75295115 ACAGGGCTGCGGCGGCCGGGAGG + Intergenic
1070657842 10:78283408-78283430 GGACAGCTGCGGAGGCCAGGAGG + Intergenic
1070857083 10:79614484-79614506 AGAGAGCTGAGGGGACCAGGAGG - Exonic
1072089648 10:92115086-92115108 AAAGAGCTGCGGGGCGCGGGAGG + Intronic
1072925455 10:99612948-99612970 AGGGAGATACGGGGGCCAGGTGG + Intronic
1073207989 10:101778777-101778799 AGCGGCCTGCGGGGGCCCGGCGG - Intronic
1074182901 10:111078806-111078828 CGAGCGCAGCGCGGGCCCGGGGG + Exonic
1074721611 10:116270569-116270591 AGAGGTCAGCGGGGTCCCGGGGG + Intronic
1075091849 10:119448272-119448294 AGGGAGCTGCTGGGGGCTGGGGG - Intronic
1075102908 10:119518653-119518675 AGAGAGCTGTGGGGTCAAGGGGG - Intronic
1075800738 10:125152005-125152027 CGCGAGGTGGGGGGGCCCGGGGG + Intronic
1075809864 10:125217341-125217363 GGAGAGCTGCAGGGGCCAAGGGG + Intergenic
1076163709 10:128265911-128265933 AGAGACCTGCGGGGGGCGCGGGG + Intergenic
1076166511 10:128286744-128286766 AAAGAGATGGGGGGGCCGGGGGG - Intergenic
1077029861 11:460393-460415 AGAGGGCTGCGTGGGGCCGCCGG + Intronic
1077052602 11:574501-574523 AAAGAGCAGCTGGGCCCCGGGGG - Intergenic
1077089351 11:771421-771443 AGAGGGCTGCGGGAGCGGGGTGG + Exonic
1077221724 11:1420919-1420941 AGAGGGCCGAGGGGGCCCTGGGG - Intronic
1077231953 11:1461665-1461687 ACAGAGCTGGTGGGGCGCGGGGG + Exonic
1077351980 11:2097249-2097271 AGAGAGCTGGGGAGGCCTTGGGG + Intergenic
1077390640 11:2299278-2299300 AGAGACCTGTGGGGGCCACGCGG - Intronic
1077614837 11:3667210-3667232 GGTGAGCAGCGGGGGCGCGGGGG - Exonic
1077671827 11:4164880-4164902 AGAGTGCTGTGGGAGCCCAGAGG + Intergenic
1077956008 11:7020492-7020514 CGGGAGCTGCGGGCGCTCGGGGG + Exonic
1078334108 11:10450669-10450691 TGAGAGCAGCAGGGGCGCGGCGG - Exonic
1078636136 11:13052238-13052260 TGAGAGCTGCTGGAGCCCAGAGG + Intergenic
1079321273 11:19453696-19453718 AGAGAGCTGTGGGGGCCCTGAGG - Intronic
1083275510 11:61594893-61594915 AGGGAGCCCCGGGAGCCCGGAGG - Intergenic
1083309577 11:61777471-61777493 ACAGGGCTGTGGGGGCCGGGCGG + Intronic
1083883137 11:65558096-65558118 AGGGGACCGCGGGGGCCCGGCGG + Exonic
1083938710 11:65883621-65883643 ACAGAGCTGAGGGGGCCAGGTGG - Exonic
1084225278 11:67711521-67711543 AGGGGGCTGCGGAAGCCCGGAGG + Intergenic
1084263092 11:67991368-67991390 AGGGGGCTGCGGAAGCCCGGAGG + Exonic
1084810299 11:71607753-71607775 AGGGGGCTGCGGAAGCCCGGAGG - Intergenic
1084978155 11:72814463-72814485 AGCGCGCTGCGGGGGCACCGGGG - Exonic
1085849162 11:80099663-80099685 AGGGAGCTGCGGGGGCCAGGAGG + Intergenic
1089002541 11:115064002-115064024 AGGGTGCTGTGGGGGCACGGAGG + Intergenic
1090404001 11:126466462-126466484 ACAGAGCTGGGGGGCCCAGGGGG + Intronic
1091915370 12:4269331-4269353 AGAGCGCGGCGGCGGCGCGGCGG - Intergenic
1092204479 12:6606939-6606961 CGGGCGCTGCGGGGGGCCGGAGG + Intronic
1092240531 12:6833594-6833616 TGAGAGCTGCAGGGGTCCAGGGG - Exonic
1092539790 12:9413628-9413650 AGAGAGGGGCGGGGGGCGGGGGG + Intergenic
1094116519 12:26920262-26920284 AGAGTGCTGTGGGAGCACGGAGG - Intronic
1096469956 12:51869529-51869551 AGAGTGATGTGAGGGCCCGGTGG + Intergenic
1096503983 12:52081500-52081522 GGGGAGCTGAGGGGGCCCTGAGG - Intergenic
1097160955 12:57046445-57046467 AGAGGGCTGTAGGGGCCCAGAGG + Intronic
1097793972 12:63843670-63843692 AGGGAGGTGCGGGGCCTCGGCGG + Intergenic
1100434909 12:94562409-94562431 AGAGGGTTGCAGGGGGCCGGTGG - Intergenic
1102933535 12:116879706-116879728 AGGGAGCTGCGGGGGTGCGCGGG - Intronic
1105015869 12:132786631-132786653 TGGGAGGTGCGGGGGCCGGGGGG - Intronic
1105015881 12:132786651-132786673 GGGGAGGTGCGGGGGCCAGGTGG - Intronic
1105278521 13:18949905-18949927 AGCGGGCTGAGGGGGACCGGCGG + Intergenic
1107133524 13:36920360-36920382 AGGGGGCTGCGCGGGCCCGGCGG + Intronic
1107604867 13:42048059-42048081 GGAGAGCTGAGGGGACCCGACGG + Intronic
1111950376 13:94704843-94704865 AGAGAGGGGCAGTGGCCCGGAGG + Intergenic
1112705670 13:102066843-102066865 AGAGAGCAGCAGAGGCCTGGAGG - Intronic
1113561246 13:111283330-111283352 AGAGAGCAGCTGAGGGCCGGAGG - Exonic
1113663959 13:112128036-112128058 AGAGAGCTGCTGTGGCCAGCTGG - Intergenic
1114553624 14:23548843-23548865 AGAGCACTGCGGGGGCGCCGGGG - Intronic
1116844445 14:49852468-49852490 AGAGAGCTGGGAGGACGCGGGGG + Intronic
1117807650 14:59511213-59511235 ATGGAGCTGCGGAGGCCCAGAGG - Intronic
1118808939 14:69260137-69260159 AGAGAGGTGGGGGGGCGGGGGGG - Exonic
1118992664 14:70809808-70809830 AGGGAGCTGCGGCGGGCCAGTGG - Intergenic
1121278672 14:92685159-92685181 TGAGAGCGGGAGGGGCCCGGTGG + Intronic
1122225422 14:100274042-100274064 AGAGAGCTCCTAGGGCCTGGTGG - Intronic
1122623870 14:103074378-103074400 ACTGGGCTGCGGGGCCCCGGAGG - Intergenic
1124201264 15:27680302-27680324 AGAGAGCTGAGGTGTTCCGGAGG - Intergenic
1124937054 15:34183336-34183358 AGAGAGCTGGGAGGGGCAGGAGG - Intronic
1125554028 15:40569540-40569562 AGCCGGCTTCGGGGGCCCGGGGG - Exonic
1125602049 15:40920787-40920809 AGAGAGCAACTGGGGCCCCGAGG - Intergenic
1125603538 15:40928040-40928062 CGAGGGCAGCGGGGGCCCTGTGG - Intergenic
1127007218 15:54583994-54584016 AGAGAGCGGCAGGAGCCCGAGGG - Intronic
1128552992 15:68610159-68610181 AGAGGGCTGCAGGGTCCCTGAGG - Intronic
1129540407 15:76343069-76343091 AGACAGAGGCGGGGGCCGGGCGG + Intergenic
1129676085 15:77632958-77632980 AGTGAGCCGCGGGAGCCGGGCGG + Intronic
1129704291 15:77785615-77785637 TGAGAGCTGCTGGGGGCTGGGGG - Intronic
1131311124 15:91290920-91290942 GGAGAGCTGCGAGAGCCCCGGGG + Intronic
1132516794 16:369828-369850 AGAGACCTGGGTGGGCCCTGGGG - Intronic
1132577069 16:669022-669044 TGGGAGCTCCGGGTGCCCGGAGG - Intronic
1132724549 16:1333236-1333258 AGAGAGCGGCGGGGCCCGCGAGG + Intergenic
1133167446 16:3958109-3958131 AAAGAGCAGCGGGGGCTCTGCGG + Intronic
1133350499 16:5097831-5097853 AGAGAGGGGGCGGGGCCCGGGGG + Intergenic
1136428398 16:30183899-30183921 AGAGCGCTCTGGGGCCCCGGCGG - Intronic
1136779241 16:32886415-32886437 GGAGGGCTGAGGGGGCCCGGGGG - Intergenic
1136891376 16:33975103-33975125 GGAGGGCTGAGGGGGCCCGGGGG + Intergenic
1137582246 16:49640591-49640613 TCAGCGCTGCGGGGGCCAGGGGG - Intronic
1137753138 16:50881289-50881311 AGAGAGCTGGGGGTGCTGGGTGG - Intergenic
1137925031 16:52532444-52532466 AGAGAACTGAGGGACCCCGGTGG + Intronic
1139866445 16:70065824-70065846 AAAGAGCTGCGGGGCGCGGGAGG - Intergenic
1139916726 16:70432946-70432968 AGAGAGCCTCTGGGGCTCGGCGG + Intronic
1141010194 16:80389645-80389667 AGAAAGCTTTGGGGGCCAGGAGG - Intergenic
1142246246 16:88971457-88971479 AGAGAGCTGCCTGGGGCCTGGGG + Intronic
1142312820 16:89323760-89323782 AGAGAGCTGGTGCGGCCCTGAGG - Intronic
1203081657 16_KI270728v1_random:1148503-1148525 GGAGGGCTGAGGGGGCCCGGGGG - Intergenic
1142484621 17:238734-238756 AGAGAGCTGCTGGGGGTGGGAGG - Intronic
1142555047 17:769497-769519 AGAGAGCTGAGGGGGTCGGATGG + Intronic
1142998397 17:3775036-3775058 AGAGACCTGCCTGAGCCCGGGGG - Intronic
1143521374 17:7446004-7446026 AGAGAAATGAGGGGGCTCGGGGG - Intronic
1143635796 17:8163120-8163142 AGGGAGCTGCCGGGGCATGGTGG - Intronic
1143865052 17:9917451-9917473 AGAGGGCTCCGGGGCCCCAGGGG + Intronic
1146057627 17:29589234-29589256 AGAGCGCTGTGCGGGGCCGGAGG - Intronic
1147608271 17:41786302-41786324 GGCGAGCTGCGCGGGCCCCGGGG + Intronic
1147629702 17:41921906-41921928 AGTGAGCTGGGTGGGCACGGTGG + Intronic
1148211880 17:45813541-45813563 TAGGAGCTGCGGGGGCCAGGAGG + Intronic
1148698811 17:49576297-49576319 GCAGAGGGGCGGGGGCCCGGAGG + Intronic
1148699587 17:49579579-49579601 AGAGAGATGCTGGGTCCCCGAGG + Exonic
1148764481 17:50029137-50029159 AGAGAGGAGCGGGGTCCAGGTGG - Intergenic
1148787015 17:50150482-50150504 ACGGAGCCACGGGGGCCCGGGGG - Exonic
1148945564 17:51259749-51259771 AGGGAGCTGCGGGGTTCCTGGGG + Intronic
1149406543 17:56357497-56357519 GGAGAGATGCAGGGGCCCAGAGG - Intronic
1150388999 17:64780317-64780339 AGTGCGCTGCGGGGTCCGGGGGG - Intergenic
1151692590 17:75695956-75695978 AGCGAGCTGGGGGGCCCCAGGGG - Intronic
1151785819 17:76274389-76274411 GGGGAGCTGCCGGGGCCGGGGGG + Intronic
1152070554 17:78131880-78131902 AGGCAGCTGCGGGAGCCCGCGGG + Exonic
1152121539 17:78421891-78421913 AGAGAGCAGCGGGCGGCGGGCGG + Intronic
1152378217 17:79929471-79929493 AGAGAGCTGCAGGGAGCCCGGGG + Intergenic
1152427278 17:80225172-80225194 AGAGAGCGGCGGGGGGTTGGGGG - Intronic
1152778825 17:82217538-82217560 AGGGAGCTGGGGGGACCCTGGGG + Intergenic
1152862042 17:82702172-82702194 AGAGACCTGTGGGGGCCCATGGG + Intergenic
1153228175 18:2913239-2913261 GCATACCTGCGGGGGCCCGGGGG + Exonic
1153804101 18:8696946-8696968 AGAGAGCCGCGATGTCCCGGAGG - Intergenic
1153997649 18:10455243-10455265 AAAGAGCTCCGGGCGCCCTGGGG - Intronic
1155110262 18:22707801-22707823 AGAGAGCTGTGGGGGGCCCAGGG + Intergenic
1157585082 18:48795885-48795907 TGAGAGCTGTGGGTGCCAGGTGG - Intronic
1157922982 18:51732988-51733010 AGAGAGCTGCTGGGGGCGTGTGG + Intergenic
1158435715 18:57434748-57434770 AGCGAGCTGCGGCCGGCCGGCGG - Intergenic
1160698998 19:497338-497360 GGAGAGGGGAGGGGGCCCGGGGG + Intronic
1160706611 19:532816-532838 AGAGAGCTGCAGGGAGCAGGTGG - Intronic
1160781087 19:878255-878277 GGCGAGCTGCTGGGGCCCGTGGG - Intronic
1160860701 19:1236286-1236308 AGAGAGCCCCCGGGGCCCGCTGG - Intronic
1161353467 19:3806253-3806275 AGAAAGCGGCGGGGGGCCGGGGG - Intronic
1161430275 19:4227764-4227786 AGAGAGATGGTGGGGCACGGTGG - Intergenic
1162019075 19:7860527-7860549 AGAGAGCTGCGTGGGGCCCCAGG - Intronic
1164564898 19:29318750-29318772 GGTGAGCTGCGGGGGCAGGGAGG - Intergenic
1164620792 19:29695026-29695048 GGAGAGCTGCGGGCTGCCGGTGG - Intergenic
1164648142 19:29873758-29873780 GGAGAGCGGCGCGGGCGCGGGGG - Intergenic
1164821774 19:31256326-31256348 AGAGAGCTGATGGGGCTGGGCGG - Intergenic
1165422350 19:35728480-35728502 AGGGGGCGGTGGGGGCCCGGAGG + Intronic
1165899135 19:39160580-39160602 AGATAGGTGCAGAGGCCCGGAGG + Intronic
1166932309 19:46308646-46308668 ACAGGGCTGGGGAGGCCCGGGGG - Exonic
1168296012 19:55377618-55377640 GGAGAGCTGTGGGGGCCAGGCGG + Exonic
1168416997 19:56175586-56175608 AGGGAGCTGCGGAGGCTTGGAGG + Intergenic
925042099 2:740164-740186 GGAGAGCTGGAGAGGCCCGGAGG + Intergenic
925546716 2:5024557-5024579 AGAGACCAGCTGGGCCCCGGGGG + Intergenic
926154939 2:10448431-10448453 GGGGAGGGGCGGGGGCCCGGCGG + Exonic
926646920 2:15300067-15300089 AGAGAGCTGCTGGGCTCCAGGGG + Intronic
928022472 2:27715547-27715569 AGGGGGCTGCGGGCGCGCGGCGG + Intronic
931252792 2:60549310-60549332 CGAGAGCTGCCGGGGAGCGGAGG + Intronic
934557285 2:95294219-95294241 AGAGAGCTGAGGGGTACAGGGGG - Intergenic
934561797 2:95317390-95317412 AGTGAGCTCCGGGGGCCTGGAGG + Intronic
938549822 2:132369777-132369799 AGAGTCCTGTAGGGGCCCGGAGG + Intergenic
940640870 2:156342762-156342784 CGAGTGCTGCCGGGGCCCCGGGG + Intergenic
942890301 2:180980397-180980419 AGAGCGCGGCGGGGACCCGGCGG - Intronic
946684078 2:222249699-222249721 AGAGAACTGCGGGACCCCGGGGG - Intronic
948990454 2:241551352-241551374 AGAGAGAGGCCGGGGCCTGGGGG + Intergenic
1169002492 20:2178052-2178074 AGAGGGCTGTGGGGGCACAGAGG - Intergenic
1169006007 20:2207620-2207642 TGGGAGCTGCCGGGGCCCGGTGG + Intergenic
1169437921 20:5610415-5610437 AGAGAGCGGCGGTGAGCCGGGGG + Intronic
1169673799 20:8132491-8132513 AGGGAGGTGCGGAGGCCGGGAGG + Intronic
1171344661 20:24456926-24456948 AGAGAGCTGCAAGGGCCTGTGGG - Intergenic
1172684843 20:36745889-36745911 AGAGGGCCCCGGGGGCACGGGGG + Intronic
1175381188 20:58565639-58565661 AGAGAGCTGCGGGGGCAGGTAGG + Intergenic
1175754914 20:61523300-61523322 AGAGACCAGCGTGGGCCCGCTGG - Intronic
1175765568 20:61590341-61590363 AGGGAGCTGCGATGGCCCAGTGG + Intronic
1175994808 20:62807288-62807310 AGAGGGCTGCGGTAGCCAGGTGG - Intronic
1176194696 20:63831614-63831636 AGGGCGCAGCGGGGGCCAGGGGG - Intergenic
1176380559 21:6110610-6110632 CGGGACGTGCGGGGGCCCGGGGG - Intergenic
1176547285 21:8207449-8207471 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1176555190 21:8251658-8251680 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1176566236 21:8390496-8390518 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1176574110 21:8434682-8434704 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1177014993 21:15775748-15775770 AGAGTGCAGCGGGGGCGGGGGGG - Intronic
1178579918 21:33829654-33829676 AGTGAGCTGCTCGGGGCCGGTGG - Exonic
1179520343 21:41939601-41939623 GGAGAGCTGGGAGGGCCCTGCGG - Intronic
1179742913 21:43427630-43427652 CGGGACGTGCGGGGGCCCGGGGG + Intergenic
1181026777 22:20131609-20131631 CGAGAGCCGCGGGCGCCCGCCGG + Intronic
1182439921 22:30357152-30357174 TGAGTGCGGCGGGGGTCCGGCGG - Intronic
1183271669 22:36866140-36866162 AGAGAACTTTGGGGGCCCTGGGG - Intronic
1183401688 22:37608809-37608831 CGAGAGCTGCGGGGGGCGGGGGG + Exonic
1183465368 22:37977724-37977746 GCAGAGCTGCAGGGGCCCAGAGG - Intronic
1183479096 22:38053035-38053057 AGGGTGTTGCGTGGGCCCGGAGG - Intergenic
1183727091 22:39596161-39596183 AGAGAGATGGGGGGGCAGGGCGG + Intronic
1183727178 22:39596398-39596420 AGAGAGATGGGGGGGCAGGGCGG + Intronic
1184122623 22:42462379-42462401 ATAGAGCAGTGGGGGCCTGGGGG + Intergenic
1184507040 22:44910157-44910179 TGGGAGCTGCAGGGGCCCAGGGG + Intronic
1185216312 22:49601857-49601879 TCAGGGCTGCGGGGGGCCGGGGG - Intronic
1203252158 22_KI270733v1_random:123734-123756 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1203260212 22_KI270733v1_random:168817-168839 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
950579003 3:13850686-13850708 AGGGAGCTCCGGGGGCCTGGGGG - Intronic
950905849 3:16537145-16537167 ACAGAGCTGAGGGCGCCCTGGGG - Intergenic
952846152 3:37689573-37689595 AGGGAGCTCCTGGGGCCGGGGGG + Intronic
955485768 3:59433259-59433281 ACAGAGCTGAGGGGGATCGGGGG - Intergenic
961352187 3:126311107-126311129 GGTGAGCTGCAGGGGCCCAGTGG - Intergenic
961584347 3:127909988-127910010 AGAGAGCTGGGGTGGCCACGTGG - Intergenic
962797494 3:138861863-138861885 AGAGAACTGTGGGAGCCTGGGGG - Intergenic
962808690 3:138944870-138944892 AGCCAGCCGCCGGGGCCCGGAGG + Exonic
966883261 3:184361599-184361621 AGAGTGCGGCGGGCCCCCGGCGG + Exonic
968520080 4:1031241-1031263 AGAGAGCTGGGGTGCCCTGGGGG - Intergenic
968997596 4:3955511-3955533 AGAGAGGGGGCGGGGCCCGGGGG + Intergenic
969021616 4:4143278-4143300 AGGGGGCTGCGGAAGCCCGGAGG + Intergenic
969116108 4:4871728-4871750 TGGGAGCTGCGGTTGCCCGGGGG - Intergenic
970549710 4:17166994-17167016 TGAGAGCTGCGGGGGCCTGTAGG - Intergenic
975395483 4:73869467-73869489 AGAGAGCAGCGCGGGCCATGGGG - Exonic
978224380 4:106316339-106316361 AAAGAGGTGCGGGGGGACGGGGG + Intronic
978754281 4:112285903-112285925 AGAGCGCAGCGGTGGCGCGGAGG + Exonic
982234872 4:153242987-153243009 AGAGAGCTGCCCGGGCCCTGGGG - Intronic
983533245 4:168832502-168832524 AGAGAGGGGCGGGGGGCCGTGGG - Intronic
984765605 4:183398410-183398432 AGTCAGCTGCGGGGGCCAGCGGG - Intergenic
985655483 5:1129484-1129506 GGAAAGCTGAGGGGGCCAGGAGG - Intergenic
985788953 5:1915238-1915260 AGAGTGATGCGGGGACCCGGGGG - Intergenic
985792746 5:1939271-1939293 AGAGTGATGTGGGGACCCGGGGG - Intergenic
985792757 5:1939300-1939322 AGAGTGATGCGGAGACCCGGGGG - Intergenic
985995605 5:3595594-3595616 AGACAGCTGCGGGGGCTGGTCGG + Intergenic
987116691 5:14731443-14731465 AAAGAGCTGCCAGGGGCCGGGGG + Intronic
989043199 5:37249573-37249595 AGTGAACTGAGGGGGTCCGGCGG - Intergenic
993495344 5:88602673-88602695 AGAGGGCGACGGCGGCCCGGCGG - Intergenic
997476674 5:134146450-134146472 AGGGTGCTGCGGGGGGCCTGTGG - Exonic
999831012 5:155320194-155320216 AGAGAGCTACAGGAGCCAGGGGG - Intergenic
1001480986 5:172089147-172089169 GGAGAGCTGGGGGAGCCCAGGGG - Intronic
1001534128 5:172486696-172486718 AGGCAGCTGCGGGAGCTCGGAGG + Intergenic
1002567398 5:180119632-180119654 AGAGGGCTAGGTGGGCCCGGTGG + Intronic
1003218343 6:4135574-4135596 CTAGGGCTGCGGGGGCTCGGGGG + Exonic
1003425760 6:5997241-5997263 AGGAAGCTGCGGGGGCCCCGGGG - Intergenic
1003619279 6:7683527-7683549 ATAGGGCTGCAGGGGCCAGGTGG + Intergenic
1004690233 6:17987305-17987327 AGAGCGCGGCCGGGGCCGGGGGG - Intronic
1006891538 6:37433342-37433364 AGCGAGCTGCCGGGGAGCGGAGG - Exonic
1007304728 6:40894965-40894987 AGAGGTCTGTGGGGGTCCGGAGG - Intergenic
1007728843 6:43933393-43933415 AGAGACCTGTGGGGCCGCGGCGG + Intergenic
1015785887 6:136921707-136921729 CGGGAGCTTCGGGGGCCCGCCGG + Intergenic
1016863726 6:148746918-148746940 AGAGTGCTGCGGAGCGCCGGAGG + Intergenic
1017005365 6:150025122-150025144 AGAGGGCTGCGAGGGCTAGGTGG - Intronic
1018046320 6:159969290-159969312 AGAGCGCTGCGGGCGGCGGGCGG - Exonic
1018798260 6:167203652-167203674 AGAGAGCTGCGGGTGCCACGGGG - Intergenic
1018814451 6:167320524-167320546 AGAGAGCTGCGGGTGCCACGGGG + Intergenic
1018927685 6:168217711-168217733 AGAGAACTGCTGTGGCCCCGAGG + Intergenic
1019142354 6:169956867-169956889 AGGGAGCTCCGGGGTCCCGCTGG - Intergenic
1019274297 7:167653-167675 TGAGGGCTGCGGTGGCCCAGCGG + Intergenic
1019404867 7:877819-877841 AGAGAAAGGCGGGGGGCCGGGGG - Intronic
1019713969 7:2529967-2529989 ACAGAGCTGGTGGGGCCCCGGGG + Intergenic
1020309031 7:6855308-6855330 AGGGGGCTGCGGAAGCCCGGAGG + Intergenic
1023722938 7:43113651-43113673 AGGGAGCTGCCGGGGCGGGGAGG + Intronic
1024046550 7:45589395-45589417 TGAGGGCTGCAGGGGCCTGGGGG - Intronic
1029123105 7:98281476-98281498 AGAGAGCAGCGGCGGCGGGGCGG + Intronic
1031886851 7:127252829-127252851 ATGGAGCTGCGGGCCCCCGGCGG - Exonic
1032439030 7:131927777-131927799 AGAGCGCTCTGGGGGCACGGAGG + Intergenic
1033220656 7:139524539-139524561 TGAGAGCCGCGGGGACCCCGTGG + Intronic
1033358953 7:140624233-140624255 GGAGAGCTGCTGAGGCCAGGAGG - Intronic
1034671503 7:152862275-152862297 TGAGAGCTGCAGGGGACTGGAGG + Intergenic
1036434954 8:8724352-8724374 AGAGAGCTGGCTGGGCGCGGTGG + Intergenic
1037401322 8:18497767-18497789 AGAGAGTTGGGGGAGCCCGGTGG + Intergenic
1045010823 8:97957094-97957116 ATAGTGCTGTGGGGGCCCAGGGG + Intronic
1045438253 8:102185900-102185922 GGAGAGCTGGGGGGGACCGGAGG - Intergenic
1048182704 8:132211015-132211037 AGAGTGCTGTGGGGGCCCAGAGG - Intronic
1049283625 8:141762999-141763021 AGGGAGCTGCGGGGGGTTGGGGG - Intergenic
1049416757 8:142498938-142498960 AGAGAGAGGCTGGGGCCCCGGGG - Intronic
1049441280 8:142610916-142610938 AGAGGTCTCCGGGGGCTCGGGGG - Intergenic
1049599216 8:143499262-143499284 AGAGGGATGAGGGGGCCTGGAGG + Intronic
1049643805 8:143727293-143727315 AGCGAGACGCTGGGGCCCGGCGG - Exonic
1049655230 8:143794242-143794264 AGAGAGCAGGGAGGGCTCGGGGG + Intronic
1049658125 8:143807846-143807868 TGATAGCTGAGGGGGCCCGGAGG - Intronic
1049707693 8:144050512-144050534 AGAGAGAGGCGGGCGCGCGGTGG - Intergenic
1049789737 8:144467077-144467099 AGAGAGCTGCGGGGGCCCGGCGG + Exonic
1052904049 9:33817977-33817999 AGAAAGCGGCGGGGAGCCGGAGG - Intronic
1053209925 9:36219085-36219107 TGAGAGCTGTGAGGGCCCAGGGG - Intronic
1054808307 9:69413309-69413331 ATGGAGCTGCGGGAGCCAGGTGG - Intergenic
1054835333 9:69671027-69671049 AGAGAGATGCGGTGGGGCGGGGG - Intronic
1057274438 9:93668825-93668847 AGCGGGCTGAGGGGGGCCGGCGG - Intronic
1057488654 9:95506159-95506181 AGAGAGCGGCGGGGGCGGGACGG - Intronic
1057795835 9:98157428-98157450 AGAGAGCTGTTTGGGCCTGGGGG + Intronic
1059417964 9:114173690-114173712 AGTGAGATGCGGGGGTCGGGGGG + Intronic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1061272163 9:129549878-129549900 CGAGAGCTGGGCGGACCCGGCGG + Intergenic
1061715287 9:132514960-132514982 AGAGAGCTGGGGCGGGCTGGGGG - Intronic
1061924308 9:133798430-133798452 AGAGCGATGCTGGGGCCAGGAGG - Intronic
1062292948 9:135805550-135805572 AGAGAGCAGCGGTGGGCCAGTGG - Intergenic
1062380507 9:136284593-136284615 AGGGAGCCGCGGGGACCAGGAGG + Intronic
1062611033 9:137373509-137373531 GGAGAGCTGCCGGGGCCAGCGGG - Exonic
1203468561 Un_GL000220v1:106884-106906 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1203476382 Un_GL000220v1:150856-150878 AGACAGAGGCGGCGGCCCGGGGG - Intergenic
1188811395 X:34657263-34657285 AGAGCGCGGCGCGGGGCCGGCGG - Exonic
1199699003 X:150363030-150363052 AAAGAGCTGCGGCCGCCCGAGGG - Intronic
1200100515 X:153687585-153687607 GGAGGGCTGAGGGGGCCCGGGGG + Intronic
1200156712 X:153980447-153980469 AGAGAGCACCTGGGGCCAGGAGG + Intronic
1200157673 X:153985892-153985914 AGAGAGCACCTGGGGCCAGGAGG - Intergenic